ID: 1085627307

View in Genome Browser
Species Human (GRCh38)
Location 11:78083311-78083333
Sequence GTCACTGCACAGATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085627307_1085627312 9 Left 1085627307 11:78083311-78083333 CCATGTTCCATCTGTGCAGTGAC No data
Right 1085627312 11:78083343-78083365 ATCAGACCGCCCAGCTCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085627307 Original CRISPR GTCACTGCACAGATGGAACA TGG (reversed) Intergenic
No off target data available for this crispr