ID: 1085632688

View in Genome Browser
Species Human (GRCh38)
Location 11:78132383-78132405
Sequence AGGCAGAAGGAGAGTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1196
Summary {0: 1, 1: 1, 2: 8, 3: 102, 4: 1084}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085632688_1085632691 -4 Left 1085632688 11:78132383-78132405 CCTTCCTGACTCTCCTTCTGCCT 0: 1
1: 1
2: 8
3: 102
4: 1084
Right 1085632691 11:78132402-78132424 GCCTCCTCCAATCATTTATATGG 0: 1
1: 1
2: 1
3: 7
4: 145
1085632688_1085632693 -3 Left 1085632688 11:78132383-78132405 CCTTCCTGACTCTCCTTCTGCCT 0: 1
1: 1
2: 8
3: 102
4: 1084
Right 1085632693 11:78132403-78132425 CCTCCTCCAATCATTTATATGGG 0: 1
1: 0
2: 0
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085632688 Original CRISPR AGGCAGAAGGAGAGTCAGGA AGG (reversed) Intronic
900228281 1:1543060-1543082 AGGCAGAGGCAGAGGCGGGACGG + Intronic
900583692 1:3422317-3422339 AAGCAGATGGACAGGCAGGAAGG + Intronic
900583698 1:3422373-3422395 AGGCAGACAGACAGTCAGGCAGG + Intronic
900640929 1:3687758-3687780 AGGCGCCAGGAGAGGCAGGAAGG - Intronic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901017038 1:6237891-6237913 GGGCAGAAGGAGAGCAAGGATGG + Intergenic
901187315 1:7383218-7383240 AGGAAGAAGGAGGGCCAGGACGG + Intronic
901197914 1:7450518-7450540 ATGCAGAAGTAGAGACAGGTGGG + Intronic
901560586 1:10067126-10067148 AGGCAGAAGCTAAGACAGGATGG - Intronic
901692306 1:10981451-10981473 AGGAAGAAGGAGAGACAGAGAGG + Intronic
901768108 1:11516578-11516600 AGGCAGAAGGGGAATCACTATGG - Intronic
902040089 1:13486204-13486226 AGACAGAGGGAGAGGCTGGAGGG - Intronic
902128269 1:14236218-14236240 AGGCAAAAGGGAAGTCAGGCAGG - Intergenic
902274830 1:15331653-15331675 AGGCAGGAGGGAAGGCAGGAGGG + Intronic
902274833 1:15331665-15331687 AGGCAGGAGGGAAGGCAGGAAGG + Intronic
902274840 1:15331689-15331711 AGGCAGGAGGGAAGGCAGGAAGG + Intronic
902274847 1:15331713-15331735 AGGCAGGAGGGAAGGCAGGAAGG + Intronic
902490787 1:16779246-16779268 AGGCAGGAGGAGAGCCGGGCAGG + Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903166447 1:21523753-21523775 GGGCAGAAGGAGGCTCAGGGAGG + Intronic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903479335 1:23641704-23641726 AGACAGAAGCAGAGACTGGAGGG - Intergenic
903575907 1:24339631-24339653 GACCAGAAGGAGAATCAGGAAGG - Intronic
903680757 1:25095190-25095212 AGGCAGAAGGAACAACAGGAAGG + Intergenic
904203204 1:28835230-28835252 AGCCAGAAGCAGAGCCAGGGTGG + Intronic
904225925 1:29019307-29019329 AGGTAGAAGGATAGTCTGGGAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904676435 1:32201697-32201719 AGGCAGAAGGGGAATTAGGTTGG + Intronic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905028729 1:34867633-34867655 AAGCAGAAGGAAATTCAGGGAGG + Intronic
905082880 1:35340353-35340375 CGTCAGAGGGAGAGGCAGGATGG + Intronic
905522889 1:38613920-38613942 AGGCAGAAGCAAGGTCAGTAGGG - Intergenic
905583882 1:39102500-39102522 AGGCCAAAGGAGAGTGATGAAGG + Intronic
905795364 1:40813114-40813136 AGCCAGCAGGAGAGTGAAGAAGG + Intronic
905921542 1:41722552-41722574 AGGCAGAAGGAAGGGAAGGAGGG - Intronic
905945819 1:41900800-41900822 AGGCTGAAGGAGAGGGAGAAAGG + Intronic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
906672419 1:47666043-47666065 AGGAAGAGGGAGTGTCTGGAGGG - Intergenic
906698932 1:47843537-47843559 AACCAGACGGAGTGTCAGGAAGG + Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907255287 1:53174179-53174201 AGGCAGGAGGAAAGTGAGGGTGG + Intergenic
907352419 1:53843521-53843543 AGAGAGAAGGAGATCCAGGAGGG + Intergenic
907379968 1:54078850-54078872 AGACAGGACGAGAGTCAGGGCGG + Intronic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907492830 1:54819856-54819878 AGGAAGAAAGAGAGGAAGGAAGG - Intronic
907555054 1:55336156-55336178 AGGCAGAAGAAGGGGCAGGAGGG + Intergenic
907566863 1:55443580-55443602 GGGCAGAATGAGCCTCAGGACGG - Intergenic
907929541 1:58986495-58986517 AGGCAGAGAGAGAGACAGAAGGG + Intergenic
908523747 1:64968141-64968163 AAGAAAAAGGAAAGTCAGGAAGG + Intergenic
908848167 1:68346195-68346217 AGGGAAAAGGAGAGTGAGGCAGG - Intergenic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
910445092 1:87291720-87291742 AGGCAGAGGGCCATTCAGGAAGG + Intergenic
911161795 1:94688854-94688876 AGGCGGGAGGAGAGTGAGGTTGG - Intergenic
911488796 1:98536645-98536667 AGAAAGAAGGAGAGGAAGGAAGG - Intergenic
912203417 1:107483971-107483993 AAGCTGGAGGAGAGTCAGAATGG - Intergenic
912493866 1:110078753-110078775 GGGCAGATGGAGAGGCAGGCAGG + Intergenic
912580637 1:110718024-110718046 AGGCAGAAGGACCCTCAGGAAGG - Intergenic
912679671 1:111721126-111721148 AGGCAGACGGTGAGGCAGGCGGG + Intronic
912777869 1:112517377-112517399 AGGCTGCAGGTGAGTAAGGAAGG + Exonic
912867108 1:113267363-113267385 GGGCACAGGGAGAGTCAGGGTGG - Intergenic
914433947 1:147643452-147643474 AGGTAGAAGGAGGGCAAGGAGGG + Exonic
914698355 1:150107019-150107041 AGGTAGGAGGAGAATCAGAAGGG - Intronic
914716761 1:150260288-150260310 AGGCAGGAGGAGATCCAGAAGGG - Intronic
914860479 1:151381795-151381817 AGGCAGAAGGAGAGTCCCCAGGG + Intergenic
914964025 1:152237076-152237098 AGGTAGAAGAAAAGGCAGGAAGG - Intergenic
915164718 1:153942122-153942144 GGGCAGAAGGGTAGTCAGGCAGG + Intronic
915500709 1:156315051-156315073 TGGTAGAAGGGGAGGCAGGATGG - Intronic
915705371 1:157838783-157838805 AAGCAGAAGGGGAGACTGGAAGG + Intronic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916259714 1:162829408-162829430 AGGAAGAAGGAAAGGAAGGAAGG - Intronic
916315310 1:163442283-163442305 CTCCATAAGGAGAGTCAGGAAGG + Intergenic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916843374 1:168623783-168623805 AGGCACAAAGAGTCTCAGGAGGG - Intergenic
916936213 1:169630807-169630829 AGCCAGAAGAGGAGCCAGGATGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917476782 1:175375595-175375617 AGAGACCAGGAGAGTCAGGAAGG + Intronic
917715220 1:177728574-177728596 AGGAAGAAGGAAGGACAGGAGGG + Intergenic
917716304 1:177741309-177741331 TGGCAGAAGGAGAGGCAGGGTGG - Intergenic
917909503 1:179628255-179628277 AGGTGGAAGGAAAGTAAGGAGGG + Intronic
917926753 1:179795514-179795536 TGGCAGAAGGTGAGTGAGCAAGG - Intronic
918354441 1:183693514-183693536 AGAAAGAAAGAGAGTAAGGAGGG - Intronic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919017108 1:192052758-192052780 GGGCAGAAAGAGACTAAGGATGG + Intergenic
919263260 1:195226373-195226395 AGGAAGAAAGAGAGGGAGGAAGG + Intergenic
919344854 1:196362282-196362304 AGGCAGGAGGAAAGCAAGGAAGG - Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919766691 1:201132063-201132085 AGGGAGACGGGGAGACAGGAAGG + Intergenic
919771013 1:201158592-201158614 AGTCAGAATGTGAGCCAGGAGGG + Intronic
919804310 1:201371993-201372015 AGGCAGGTGGAGAGCCAGAAAGG - Intronic
919869890 1:201812375-201812397 AGGCAGAAGGAGGGACAGACTGG + Intronic
920035614 1:203063468-203063490 AGGCTCACTGAGAGTCAGGAAGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920273031 1:204781310-204781332 AGTCAGATGTAGAGTCATGAAGG + Intergenic
920308282 1:205032756-205032778 AGGCAGAAGGAACGTGAGGCTGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920458259 1:206117134-206117156 AGGAAGATGGGGAATCAGGACGG + Exonic
920509032 1:206537048-206537070 AGGCAGCAGGAGACTCAGGGAGG - Intronic
920666456 1:207966101-207966123 GGGCAGGAGGTGAGACAGGAGGG + Intergenic
920916900 1:210265067-210265089 AAGGTGAGGGAGAGTCAGGAAGG + Intergenic
920982980 1:210855685-210855707 AGGCAGCAGGTGAGTGGGGAGGG - Intronic
921295278 1:213695460-213695482 AGTAAGAAGTAGAGTCAGGTGGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921545976 1:216475670-216475692 AGGCTGAAGGAAAGGAAGGAAGG + Intergenic
922434290 1:225588178-225588200 AGGAAGAAAGAGAGGGAGGAGGG + Intronic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922600181 1:226845222-226845244 AGTCAGGAGGGAAGTCAGGAAGG + Intergenic
922627113 1:227059919-227059941 TGGCTGAAGTTGAGTCAGGATGG - Intronic
922644081 1:227267720-227267742 AGGCAGCAGGAGAGCAAGCAAGG + Intronic
922723284 1:227909791-227909813 AGGCAGGAGGGGAGGGAGGAGGG + Intergenic
922723315 1:227909872-227909894 AGGCAGGAGGGGAGGGAGGAGGG + Intergenic
922723323 1:227909896-227909918 AGGAAGAAGGGGAGGAAGGAGGG + Intergenic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
923295877 1:232594548-232594570 TCCCAGAAGGAGAGTGAGGATGG - Intergenic
923357632 1:233176339-233176361 AGGAAGAAGGAGAGAAAGGAAGG - Intronic
923386365 1:233469159-233469181 AGGCAGAAGAAATGTCTGGAAGG + Intergenic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923529657 1:234803289-234803311 AGGCAGGAGGAGAGCCGGGCAGG - Intergenic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924196014 1:241607591-241607613 AGGAAGAAAGAGAGAAAGGAGGG + Intronic
924196021 1:241607671-241607693 AGGAAGAAAGAGAGAAAGGAGGG + Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
1063159973 10:3412122-3412144 AGACAGCAGGAGAGTGAGGGGGG - Intergenic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1063780157 10:9313579-9313601 AGCAAGAAAGAGAGTCAGAAAGG - Intergenic
1064462820 10:15551366-15551388 TGGCAGAAAGAGAACCAGGAGGG + Intronic
1064555155 10:16540610-16540632 AAACAGAAGGAAAGTCAGTATGG + Intergenic
1064652081 10:17519589-17519611 AGGGAGAAAGAGAGGAAGGAGGG + Intergenic
1064997661 10:21310662-21310684 AGGCAGATGGTGAGCCAAGATGG + Intergenic
1065804545 10:29382712-29382734 AGAGAGAGGGAGAGTCAGGTGGG - Intergenic
1065944591 10:30595028-30595050 AGAGAGAGGGAGAGTCAGGTGGG + Intergenic
1066045277 10:31589273-31589295 TGGGAGAGGGAGAGGCAGGAAGG - Intergenic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066290511 10:34010368-34010390 AGGAAGAAAGAGAGAAAGGAAGG + Intergenic
1066423167 10:35280388-35280410 AGGAAGAAGGAAAGGAAGGAAGG + Intronic
1066444479 10:35469534-35469556 AGGAAGATGGAGAGGCAGAACGG + Intronic
1068022328 10:51600962-51600984 AGGAAGAAGGAGAGAAAGGGAGG + Intronic
1068201427 10:53788627-53788649 AGGGAGAAAGAGAGAAAGGAAGG + Intergenic
1068271762 10:54736812-54736834 AGGGAAAAGGAGAGTGAGGCAGG + Intronic
1068652939 10:59542505-59542527 AGGCAAAATGAGAGGCAAGAAGG - Intergenic
1068722550 10:60262142-60262164 AGGCAGAAGAATAGCCAGGGAGG + Intronic
1068750076 10:60582400-60582422 AGACAGAAAGAGAGGAAGGAAGG - Intronic
1068800967 10:61139341-61139363 AGGAAGAAGGAAAGGAAGGAAGG - Intergenic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069065019 10:63933319-63933341 AGGCATTAGAAGAGACAGGAAGG - Intergenic
1069277892 10:66615454-66615476 AAGAAGAAGGAGACACAGGAAGG + Intronic
1069599295 10:69693067-69693089 AGGCAGAAGGAGCATCAAGGAGG - Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069758001 10:70785533-70785555 AGGCAGCAGGGAAGTCAGGAGGG - Intergenic
1070144181 10:73761699-73761721 AGTGAGAAGGAGAGTCTGGTTGG + Intronic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070435667 10:76390344-76390366 GGGTAGAAGGAGGGTCAGAATGG + Intronic
1070714279 10:78707914-78707936 AGGAGGAAGGAGAACCAGGAAGG - Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1070911229 10:80120245-80120267 AGACAGAAAGAGAGGAAGGAAGG - Intergenic
1070959323 10:80487814-80487836 AGACAGAAGGAGGGTCTGGTGGG + Intronic
1071806109 10:89122960-89122982 AGTCAGAAGAGAAGTCAGGATGG - Intergenic
1072039105 10:91590741-91590763 AGGCAGCAAAACAGTCAGGAAGG + Intergenic
1072222317 10:93336855-93336877 AGGAAGAAGGAAAGAAAGGAAGG + Intronic
1072287130 10:93926993-93927015 AGGGAGAAGGACTGGCAGGAAGG - Intronic
1072302088 10:94071412-94071434 AGGCAGAAAGAGAGTAAAGGAGG - Intronic
1072755652 10:98019154-98019176 AGGCAGGAGGAGGAGCAGGAAGG + Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073253306 10:102134844-102134866 TAGCACAGGGAGAGTCAGGAAGG + Intronic
1073290863 10:102412623-102412645 AGGCAGAAGGAGGGTCTGGATGG - Intronic
1073568439 10:104555576-104555598 AGGGAGAAGGAGAGAAGGGATGG + Intergenic
1073731371 10:106292114-106292136 AGGAAGAAAGACAGACAGGAAGG + Intergenic
1074147438 10:110729357-110729379 GGTGAGAAGGAGAGGCAGGAAGG - Intronic
1074320179 10:112394504-112394526 AGGCAGACCAAGGGTCAGGAAGG - Intronic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1074746180 10:116534837-116534859 GGGTAGAAGGAGGGTGAGGATGG - Intergenic
1075256112 10:120926965-120926987 AGGCAGAGGGAAACTCAGGGAGG + Intergenic
1075764092 10:124879205-124879227 AGGCAGAGAGAGAGCCAGGCTGG + Intergenic
1075770467 10:124930253-124930275 AGACAGAAGGAAAGGAAGGAAGG - Intergenic
1075808133 10:125204786-125204808 AGACAGTAGGAGAGTGGGGAGGG + Intergenic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076210745 10:128642722-128642744 AGGCAGAAGGAGATACAAGAGGG + Intergenic
1076407813 10:130224935-130224957 AAGCACAAGGAGGGCCAGGATGG - Intergenic
1076474943 10:130745387-130745409 GGGGAGAAGGAGGGTCAGGAGGG - Intergenic
1076597248 10:131631718-131631740 AAGCAGAAGGAAAACCAGGAAGG - Intergenic
1077101990 11:826416-826438 CCCCAGAAGGAGAGCCAGGAGGG + Intronic
1077142444 11:1030537-1030559 AGGGAGAGGGAGGGGCAGGAAGG - Intronic
1077148966 11:1060014-1060036 AGGCAGAACGACAGTCAAGCTGG + Intergenic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1078001838 11:7503032-7503054 AGGCAGAAAGAGAGTTTGGAGGG + Intronic
1078157889 11:8814380-8814402 AGGCAGGAGGAGAATCATGCTGG - Intronic
1078432687 11:11300019-11300041 GGGCAGAGGGAGAGTCAAGGAGG + Intronic
1078579184 11:12525636-12525658 TGGCAGAAGGTGATTCAGGGTGG + Intronic
1078938737 11:15976857-15976879 AGTAAGAAGGTGAGTCAGTAAGG - Intronic
1079100349 11:17537734-17537756 AGACAGAAAGAGACTCAGGCTGG - Intronic
1079116147 11:17641782-17641804 AGGCAGTGGGAGAGCCAGGGTGG + Intronic
1079346590 11:19657742-19657764 GGGCAGAAAGTGAGTCAGGGAGG + Intronic
1080187356 11:29505805-29505827 AGGCTGAAGGAGAGTAAGGTTGG + Intergenic
1080470342 11:32539378-32539400 AGGAAGGAGGAGAGGAAGGAAGG - Intergenic
1080556604 11:33422587-33422609 AGGAAGAAGGAAAGAAAGGAGGG - Intergenic
1080605558 11:33862135-33862157 AGGCAGCAGGGGAGGCTGGAGGG + Intronic
1080909805 11:36584197-36584219 AGGCAGGAGGAGATGAAGGAAGG + Intronic
1081205288 11:40267951-40267973 AGGCACAAGGAGAGCAATGAAGG - Intronic
1081413282 11:42784861-42784883 AGGAAGGAAGAGAGGCAGGAAGG + Intergenic
1081620090 11:44614330-44614352 AGGGAGAAGGAGGGACAGGGAGG - Intronic
1081651796 11:44828783-44828805 AAGCAGGGGGAGAGTCAGGGAGG - Intronic
1083185863 11:61017542-61017564 TGGAGGAAGGTGAGTCAGGATGG + Exonic
1083902867 11:65652180-65652202 AGGGAAAAGGAGAGGCAGGCTGG + Intergenic
1084171217 11:67401852-67401874 GGGCGGAAGGAGAGCCAGGCCGG - Intronic
1084199121 11:67543592-67543614 AGGCAGGAGGAGAGGCAGGGAGG - Intergenic
1084964351 11:72736664-72736686 AGAGAGAAGGAGAGGCAGGATGG - Intronic
1085029378 11:73260359-73260381 AGGGAGCTGGGGAGTCAGGAGGG + Intergenic
1085107820 11:73861289-73861311 AAGCAGGAGGAGAATCATGAAGG - Intronic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1085639958 11:78187432-78187454 AGGCAGGAGGAGAGAAAGGTGGG + Intronic
1085694534 11:78692672-78692694 AGTCAGAAAGAAAGGCAGGAAGG - Intronic
1085988966 11:81816929-81816951 AGGAAGAAGGGGAGGAAGGAGGG - Intergenic
1086261193 11:84943341-84943363 AGGCAGAAAGGCAGGCAGGAAGG - Intronic
1086408008 11:86515855-86515877 AGGCACAATGGGAGGCAGGAAGG + Intronic
1086592953 11:88537550-88537572 AGGCAGAAGGGAAGTCATTATGG + Intronic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1087000549 11:93415622-93415644 AAGCAGAAGTAGAGACTGGAAGG - Intronic
1087146249 11:94814515-94814537 AGGGAGAAGGAGTGTCAGAAGGG + Intronic
1087347056 11:96984775-96984797 AGACAGATGGACAGTCAGGAAGG + Intergenic
1088164104 11:106911058-106911080 AGGAAGAAAGAGAGGGAGGAAGG + Intronic
1088350718 11:108884423-108884445 AGGCAGAAGGTGAGAAACGAAGG - Intronic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1088751310 11:112844409-112844431 AGGCAAAAGGAGAGAAAGGAGGG + Intergenic
1088946611 11:114519634-114519656 AGGTGGAAGGAGGGGCAGGAGGG + Intergenic
1089217127 11:116841183-116841205 AGCCAGAATGAGAGTTAGGGAGG + Intergenic
1089295192 11:117463157-117463179 AGGCACAAGGTGAAGCAGGAAGG + Intronic
1089459037 11:118642058-118642080 AGGAAGAAGGGGAGGAAGGAAGG - Intronic
1089562638 11:119352309-119352331 TGTCAGAAGCAGAGACAGGATGG - Intergenic
1090259595 11:125309167-125309189 AGGAAGAAAGAGAGAGAGGAAGG - Intronic
1090259602 11:125309229-125309251 AGGAAGAAAGAGAGGAAGGAAGG - Intronic
1090669142 11:128933998-128934020 AGGAGGAAGGAGGGTCAGGCAGG - Intergenic
1090899618 11:131016640-131016662 AGGTAGAAGGGGAGACAGGGAGG + Intergenic
1090908205 11:131095842-131095864 ACGAGGAAGGAGAGTGAGGAGGG - Intergenic
1091011722 11:132007397-132007419 GGTCACTAGGAGAGTCAGGAGGG + Intronic
1091038115 11:132252093-132252115 AGGGAAAAGGAGAGGTAGGAGGG - Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091109039 11:132948278-132948300 AGGCAGAAGGAGTGAGAGGAAGG + Intronic
1091228044 11:133969807-133969829 TCCCAGAAGGACAGTCAGGAGGG + Intergenic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1092096475 12:5846743-5846765 AGGCAGAAGGAGATTTGAGAGGG - Intronic
1092244759 12:6857517-6857539 GGACAGAAGGAGAGCCAGTAAGG - Intronic
1092525120 12:9305148-9305170 AGGGAGAAGGAAAGCAAGGAGGG - Intergenic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1095475285 12:42580937-42580959 AGGGAGAGAGAGAGTAAGGAAGG + Intronic
1096147134 12:49286384-49286406 AGACAGAGGGAGAGACTGGAGGG + Intergenic
1096529901 12:52235962-52235984 AGCCAGAAGGAGGCTCAGGAAGG + Intronic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096639899 12:52985692-52985714 AGGCAGAAGGCCAGTCACGGTGG - Intergenic
1096908235 12:54956264-54956286 TGGCAGCAGAAGAGACAGGAGGG - Intronic
1097221879 12:57455881-57455903 AGGCAGAAGGGGAGCCTGGCAGG + Intronic
1097241352 12:57577657-57577679 AGGAGGAAGGAGAGTCCTGAGGG + Intronic
1097254629 12:57664457-57664479 AGGAAGAAGGAAAGAAAGGAAGG - Intergenic
1097270622 12:57771942-57771964 GGGCAGAGGGAGAGAGAGGAGGG - Intronic
1097767049 12:63537993-63538015 AGTCTGAATAAGAGTCAGGAAGG + Intergenic
1097783397 12:63732937-63732959 AGTCTGAATAAGAGTCAGGAAGG + Intergenic
1097905558 12:64915553-64915575 AGGCAGAAGTGCAGTCAGAAGGG - Intergenic
1098010774 12:66048810-66048832 AGGCAAAAGGAGAGGCAAAATGG + Intergenic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098224887 12:68311245-68311267 TGGCAGAAGACCAGTCAGGAAGG - Intronic
1098460806 12:70731089-70731111 AGGAGGAAGGAGAGAGAGGAAGG + Intronic
1098631922 12:72733806-72733828 AGGCAGTAGGAGAGAAAGAATGG - Intergenic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099389453 12:82061397-82061419 AGTCAGAAGCACAGTCAGGCTGG + Intergenic
1099732619 12:86525262-86525284 AGGCAGTAGGAGAGAGAGGATGG - Intronic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1100598219 12:96089703-96089725 AGAAAGAAGGAGAGAAAGGAAGG - Intergenic
1100641432 12:96485300-96485322 AGGCAGAAGATGAGGCAGAAAGG - Intergenic
1100848455 12:98684443-98684465 AGGGAGGAGGAGAGAAAGGAAGG - Intronic
1101535555 12:105613147-105613169 AGGCAGCAGGAGAGAGAGGAAGG - Intergenic
1101708139 12:107240041-107240063 AGGGAGCAGGGGAGTCAGGGAGG + Intergenic
1101708565 12:107243552-107243574 AGGCAGCAGGTGAGCCAGCAGGG + Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102501007 12:113352411-113352433 AGGCAGAAAGACAGAAAGGAGGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1102729817 12:115098665-115098687 AGGCAGGAAGGCAGTCAGGAAGG - Intergenic
1102757378 12:115353981-115354003 ACACAGAAGGAGAGACAGAAAGG + Intergenic
1103131613 12:118473724-118473746 TGGTAGTAGGAGAGTCAAGATGG + Intergenic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104418761 12:128617595-128617617 GGGCAGATGCAGAGTCAGGTGGG + Intronic
1104427484 12:128690032-128690054 AGGCAGGTGCAGACTCAGGAAGG + Intronic
1104432707 12:128729596-128729618 AGGGAAAAGGAGAGAAAGGATGG - Intergenic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1104549952 12:129747186-129747208 AGTAAGAAGGAGAGGGAGGAGGG - Intronic
1104579536 12:130000590-130000612 AGGAAGGATGAGAGTCAGGAAGG + Intergenic
1104714375 12:131006638-131006660 ACCCAGAAGGAGAGCAAGGAGGG + Intronic
1104941227 12:132396309-132396331 AGGCAGCAGGAGACTCACGGGGG + Intergenic
1105284446 13:18993116-18993138 AAGCAGAAGGAAAGGAAGGAAGG + Intergenic
1105384903 13:19920610-19920632 GGAGAGAAGGAGAGTCGGGAGGG + Intergenic
1105984370 13:25550716-25550738 AGGACCAAGAAGAGTCAGGAAGG - Intronic
1106171863 13:27295455-27295477 AGGCAAAAGGAGTCTCAGGCTGG + Intergenic
1106593387 13:31116934-31116956 GGGCAGAGGGAGAGGGAGGAGGG + Intergenic
1107230868 13:38108709-38108731 AGCAAGAGGGAGAGTGAGGAAGG + Intergenic
1107318540 13:39160809-39160831 AGGGAGAAAGAGAGGTAGGAAGG + Intergenic
1107354056 13:39546967-39546989 AGGCAGAGGCAGAGTCTGAAAGG - Intronic
1107708202 13:43127609-43127631 AGACAGAGGGAGAGGGAGGAGGG - Intergenic
1107862170 13:44671187-44671209 AGACAGAAAGGGGGTCAGGATGG + Intergenic
1108762902 13:53591640-53591662 AGGAAGAGGGAGAGACAGAAGGG + Intergenic
1109214318 13:59570554-59570576 AGGAAGAAGGAGAGAAGGGATGG + Intergenic
1109587190 13:64421889-64421911 AAGCAGATGAAGAGTCAGAAAGG + Intergenic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1110935260 13:81279696-81279718 AGGTGGAAGGGGAGACAGGAGGG - Intergenic
1111057063 13:82964849-82964871 AGGCAGAAGGAGGTTGAGGGAGG + Intergenic
1112373941 13:98821260-98821282 GGGCAGGAGGAGAGTGAGGTGGG + Intronic
1112571394 13:100596757-100596779 TGGTAGAATGTGAGTCAGGATGG + Intergenic
1112573354 13:100613785-100613807 AGGCAGGAAGAAAGGCAGGAAGG - Intronic
1112870860 13:103969047-103969069 AGGAAGCAGGAGGGTGAGGAGGG + Intergenic
1113561782 13:111287182-111287204 AAGGAGAAGGACAGTCAGGATGG - Intronic
1113603306 13:111586590-111586612 AGGCAGAAGGAGGGACAGACAGG - Intergenic
1113680143 13:112238230-112238252 TGGCAGAAGGTGAAGCAGGAGGG + Intergenic
1113710062 13:112457309-112457331 AGGCACCAAGACAGTCAGGAGGG + Intergenic
1114417209 14:22552855-22552877 TGGCAGCAGGAGTCTCAGGAGGG - Intergenic
1114563016 14:23607081-23607103 AGGGAGGGAGAGAGTCAGGAGGG + Intergenic
1115217491 14:31026905-31026927 AGGCAGAGCGAGTGACAGGAAGG - Intronic
1115919918 14:38361069-38361091 AGGCAGAAGGAAAATAATGAGGG + Intergenic
1117330408 14:54706692-54706714 AAGAGGAAGGAGAGTCTGGAGGG + Intronic
1117487548 14:56213352-56213374 AGGCAGAAGGAGATCCAGAAGGG + Intronic
1117502411 14:56366513-56366535 TCTCAGAAGGAGAGTAAGGAAGG - Intergenic
1117601556 14:57381148-57381170 AGGAAGAAGGAAAGAAAGGAAGG + Intergenic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1118588150 14:67376600-67376622 AGGTAGAAGGAGAGTCAAGAAGG - Intronic
1118760619 14:68878545-68878567 AGACACAAGGAGGGTCGGGAAGG + Intronic
1119187087 14:72650688-72650710 AGGCAGATGGAGAGGCAGCATGG - Intronic
1119621745 14:76136799-76136821 AGGGGGAAGGAGAGGAAGGAAGG - Intergenic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1120056075 14:79925640-79925662 AGGAAGAAAGAGAGAAAGGAAGG + Intergenic
1120093222 14:80358270-80358292 TGGCAGAAGGTGCGTGAGGAAGG + Intronic
1120640204 14:87001163-87001185 AGGCAGAAAGAAACTAAGGAGGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1120814604 14:88842050-88842072 AGGCAGAAGGAGAGGGAGAAAGG + Intronic
1120929654 14:89835976-89835998 AAGAAGATGGAGAGTCAGGTTGG + Intronic
1121063254 14:90937118-90937140 AGAGAGAAGGAAAGTCAGGTGGG + Intronic
1121373949 14:93388364-93388386 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1121433019 14:93900580-93900602 AGGCAGGAGGGGAGGCAGGTGGG + Intergenic
1121638326 14:95468630-95468652 AGGAAGGAGCAGGGTCAGGAGGG - Intronic
1122048087 14:99037568-99037590 AGGGAGAGGGAGAGTCAGGTGGG + Intergenic
1122048321 14:99038877-99038899 AGGGAGAGGGAGAGTCAGGTGGG + Intergenic
1122316524 14:100828600-100828622 AGGCAGAGGGAAAGGCAGGGAGG - Intergenic
1122407508 14:101509110-101509132 AGGCAGAGGGAGAGTGAAGGCGG - Intergenic
1122648287 14:103209481-103209503 AAGCAGGTGGAGAGTCAGAAGGG - Intergenic
1122818067 14:104323804-104323826 AGGCAGATGGAGAGTCGGTTGGG + Intergenic
1122822230 14:104353394-104353416 GGGCAGGAGGGGAGTGAGGATGG + Intergenic
1123874128 15:24606636-24606658 AGACAGAAGGAGAGTAAGCAAGG - Intergenic
1124033946 15:26036232-26036254 AGGTAGAAAGGGAGGCAGGAAGG + Intergenic
1125087872 15:35752330-35752352 AGGGAGAAGGAGAGGGAGAAAGG - Intergenic
1125222016 15:37349479-37349501 ATGCAGAAGGGGAATCAGAACGG + Intergenic
1125340443 15:38670342-38670364 AGACAGAAAGAGGGTCAGGGTGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125729283 15:41883684-41883706 AGCCAGAAGGAGGGCCTGGAAGG + Intronic
1125926741 15:43569145-43569167 AGACAGAAGGCAAGACAGGAAGG + Intronic
1125939885 15:43668710-43668732 AGACAGAAGGCAAGACAGGAAGG + Intergenic
1126125899 15:45293995-45294017 AGGCAGAGGGAGAGGCAGAGAGG + Intergenic
1126257640 15:46646582-46646604 AGACAGAAGGCGAGTCAGACAGG + Intergenic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1126355959 15:47796220-47796242 AGTCAGAAGAAGAGGGAGGAAGG - Intergenic
1127268146 15:57377254-57377276 CGGCATAAGCAGAGTCGGGAGGG - Intronic
1127318585 15:57819978-57820000 AGGCGGAAGCAGAGGCAGGTAGG - Intergenic
1127936449 15:63644159-63644181 AGGAAGAAGGAGCTTAAGGATGG - Intronic
1128102569 15:65015201-65015223 AGGAAGTAGCAGAGTCAAGATGG + Intronic
1128335695 15:66784460-66784482 AGGCTCAAGGGGAGCCAGGATGG - Intergenic
1128534634 15:68481393-68481415 AGGCAGAAGGGGACACAGGGTGG - Intergenic
1128605692 15:69035306-69035328 AGGCAGACAGAGAGTGAGGCAGG + Intronic
1128674592 15:69599409-69599431 ACACTGAAGGAGAGTGAGGAAGG + Intergenic
1128683674 15:69668589-69668611 AGGCAGAAAGAGGGTGAGGCTGG + Intergenic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1129333779 15:74840646-74840668 AGGCAAGAGGAGAGGCAGCAGGG + Intronic
1129389760 15:75214668-75214690 GTGCAGCAGGAGAGACAGGAGGG - Intergenic
1129538386 15:76332551-76332573 AGAGAGAAGGGGACTCAGGAAGG + Intergenic
1130987543 15:88854616-88854638 AGGCAGAAGGACAGGGAGAAAGG - Intronic
1131540193 15:93269249-93269271 AGGGAGCAGGAGAGACGGGAGGG + Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131823898 15:96301006-96301028 GGGCAGGAGGAGAGGCATGAAGG - Intergenic
1131925893 15:97383414-97383436 AGGAAGAAGGAAAGGAAGGAAGG + Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132322399 15:100935604-100935626 AGGCACCAGGAGGGCCAGGATGG + Intronic
1132387308 15:101409630-101409652 AGGCAGGAGGGGTGTCATGAGGG - Intronic
1133470338 16:6069067-6069089 AAGCAGAAAGAGAGGAAGGAAGG + Intronic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134511872 16:14855004-14855026 AGGCGGAAAGAGGGTCAGGGAGG + Intronic
1134699515 16:16253503-16253525 AGGCGGAAAGAGGGTCAGGGAGG + Intronic
1134866329 16:17610667-17610689 AGGAAGAAGGAAAGGAAGGAAGG - Intergenic
1134972314 16:18541168-18541190 AGGCGGAAAGAGGGTCAGGGAGG - Intronic
1135053125 16:19208452-19208474 TGGCAGCAGGAGAGTGAGGGGGG + Intronic
1135206685 16:20490982-20491004 AGGCAGAAGGAGATTAAAGTTGG - Intergenic
1135212200 16:20532650-20532672 AGGCAGAAGGAGATTAAAGTTGG + Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135935862 16:26779442-26779464 AGGCAGAAGTAGAGGAAAGAAGG - Intergenic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1136062710 16:27737656-27737678 AGGCAGGAGGAAAGCCAGGTGGG + Intronic
1136636710 16:31528961-31528983 AGGCTGAACGAGGGCCAGGAAGG + Intergenic
1136996560 16:35194872-35194894 AGCCAGCAGGGGGGTCAGGAGGG + Intergenic
1137614089 16:49836743-49836765 GGGGAGAAGGAGCATCAGGAGGG - Intronic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138047854 16:53744635-53744657 TGGCAGGAAGTGAGTCAGGAAGG - Intronic
1138242594 16:55439822-55439844 AGGCAGAAAGACAGTGAGGCAGG + Intronic
1138277439 16:55746041-55746063 AGGCAGAAGGAGAGAGGGCAGGG + Intergenic
1138329557 16:56202628-56202650 AGACAGGAGGACAGTAAGGATGG + Intronic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138863243 16:60785386-60785408 AGGCAGAGGGAGCTTTAGGAAGG - Intergenic
1139006287 16:62575449-62575471 AGGATGAAGAGGAGTCAGGAAGG + Intergenic
1139329687 16:66177672-66177694 AGGGAGAATGAGAGTAAGGATGG + Intergenic
1139536443 16:67577802-67577824 AGCCAGGAGGAGAGTAAGGCAGG + Intronic
1140382630 16:74504235-74504257 AGGGCCAAGGAGAGACAGGAGGG + Intronic
1140997166 16:80272256-80272278 AGAGAGAATGAGAGCCAGGAGGG + Intergenic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141764689 16:86050817-86050839 AGGCAGAAGCACTGCCAGGAGGG - Intergenic
1141798971 16:86294567-86294589 AGGGAGAGGGAAAGACAGGAGGG - Intergenic
1142103971 16:88292147-88292169 AGGCAGAGGGGGAGCCAGAAGGG + Intergenic
1142255937 16:89013996-89014018 AGGCAGAGAAAGAGTGAGGAAGG + Intergenic
1142486193 17:248940-248962 AGGCTGAGGGAGAGCCAGGCTGG + Intronic
1142494544 17:299381-299403 AGGTAAGAGGAGAGTCTGGAAGG + Intronic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143373169 17:6453025-6453047 AGGGAGAAAGAAAGACAGGAAGG - Exonic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144023870 17:11260730-11260752 AGACAGAAGGAGAGTGAGAGGGG - Intronic
1144031820 17:11329924-11329946 AGGCAAATAGAGAGACAGGAGGG - Intronic
1144639014 17:16927373-16927395 AGGCAGGAGGACACTCAGGGAGG + Intergenic
1145029777 17:19495636-19495658 AGGCCGCAGGAGAGTTAGAAGGG - Intronic
1145750547 17:27352590-27352612 GGAAGGAAGGAGAGTCAGGATGG + Intergenic
1145756026 17:27390589-27390611 AGGCAGGATGGGAGTGAGGATGG - Intergenic
1145898630 17:28475341-28475363 AGACAGGACCAGAGTCAGGATGG - Intronic
1146187185 17:30731722-30731744 AGGCAGGAGGAGAGGAGGGAAGG - Intergenic
1146488484 17:33262810-33262832 AGGGAAAAGGAGGGTCAGAATGG + Intronic
1146581414 17:34041277-34041299 AGGCAGAAGAAGAGACTGGTTGG + Intronic
1146908526 17:36633189-36633211 AGGGAGAAGGGGAGACGGGAGGG - Intergenic
1147228231 17:38997662-38997684 AGGGAGAAAGAGAGAGAGGAAGG - Intergenic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1147335877 17:39726789-39726811 TGGAGGAAGGAGAGGCAGGATGG - Intronic
1147410590 17:40248595-40248617 TGGTAGAAAGAGAGTCAGGCAGG - Intronic
1147613306 17:41813673-41813695 AACCAGAAGGGGAGTCAGGGTGG - Intronic
1148384916 17:47227518-47227540 AGGTGAAAGGAGAGGCAGGAGGG - Intergenic
1148632207 17:49119904-49119926 AGACAGGAAGACAGTCAGGAAGG - Intergenic
1148741321 17:49894747-49894769 AGGAGGAAGGACTGTCAGGAAGG + Intergenic
1149283957 17:55140968-55140990 AGGCAGAAGGATGGACAAGATGG - Intronic
1149573376 17:57693412-57693434 AGGCAGAGGCAGAGGCAGGTGGG - Intergenic
1149654509 17:58303111-58303133 AGTCAGGAGGAGATTCAGTAAGG - Intronic
1149940292 17:60857262-60857284 AGGCTGTAGGAAAGGCAGGAAGG - Intronic
1150054982 17:62006308-62006330 AAGGAGAAGGGGAGACAGGAAGG + Intronic
1150252372 17:63713970-63713992 AGAAAGCAGGAGAGTAAGGACGG + Intronic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150562486 17:66304934-66304956 AGGAAGTAGGAGAGTTAGAAAGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150918496 17:69459945-69459967 AGGGAGAAGGAAAGGAAGGAAGG - Intronic
1151385871 17:73754962-73754984 AGGCAGAGGGAGATTTGGGAGGG + Intergenic
1151404441 17:73877642-73877664 AGGGAGAGTGAGAGTCAGGGTGG - Intergenic
1151429826 17:74054967-74054989 AGACAGAAGGAGAGAGAGAAAGG - Intergenic
1151484511 17:74389934-74389956 AGGAAGAAAGAGAGAAAGGAAGG - Intergenic
1151557776 17:74855158-74855180 AGGCAGATGGACAGACAGGAGGG + Intronic
1151573565 17:74939529-74939551 AGGAAGAAGGAGTGTCCGGTGGG + Intronic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151877046 17:76872820-76872842 AGGAAGGAGGCGGGTCAGGAGGG - Exonic
1151898035 17:76993539-76993561 AGGATGAAGGAAAGTCAGGGGGG - Intergenic
1152768421 17:82153171-82153193 AGGCAGAGGGAGAGGAAGGGAGG + Intronic
1153192165 18:2553243-2553265 AGGTTGGAGGAGAGTTAGGAGGG - Intronic
1153320808 18:3772317-3772339 AGAGAGAAGGAGAGAAAGGAAGG - Intronic
1153488398 18:5625240-5625262 AGGCAGAATGAGAGTGAGCTGGG + Intronic
1153562880 18:6388980-6389002 AGGGACAAGGAAAGTCAGGAAGG + Intronic
1153588791 18:6651417-6651439 AGGGGAAAGGAGAGTGAGGAAGG - Intergenic
1154269379 18:12906285-12906307 AGGCAGCTGCAGAGACAGGAAGG - Intronic
1154316187 18:13304860-13304882 AGACGGAAGGAGTGTGAGGAAGG + Intronic
1155035286 18:22020645-22020667 AGGCATAAGGAGGGCCAGCAGGG - Intergenic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155116502 18:22773556-22773578 AGGAAGCAGGAGAGAGAGGAGGG - Intergenic
1155455092 18:26003608-26003630 AGGCAGAAGGAAGCTCATGATGG + Intergenic
1155654202 18:28176640-28176662 AGGCAGCAGGAGGGTGAGGCAGG - Intronic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156229280 18:35138202-35138224 CGGCAGAAGGGGAGTAAAGAGGG + Intronic
1156278541 18:35609183-35609205 AGGCAGAAGAAAAGTAAAGAGGG - Intronic
1156492854 18:37506541-37506563 AGGCAGATGGAGAGGGAGGTTGG + Intronic
1156894936 18:42235186-42235208 GGGCAGGAGGAGAGAAAGGAAGG - Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157334135 18:46724974-46724996 AGGAAGAAAGAGAGAGAGGAAGG + Intronic
1157403602 18:47405770-47405792 AGGGAGAAGGTGAGGCAGGGAGG + Intergenic
1157442476 18:47721391-47721413 AGACAAAAGGAGAGTGATGAGGG + Intergenic
1157506392 18:48229778-48229800 AGGGAGATGGACAGTCAGGAAGG - Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157690091 18:49674476-49674498 AGGCAGAAGGAAAGAAGGGAGGG + Intergenic
1157717895 18:49901723-49901745 AGGCAGACAGAGAGACAGAAGGG + Intronic
1157873199 18:51248842-51248864 GGGGGAAAGGAGAGTCAGGAAGG - Intergenic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1158515446 18:58126864-58126886 AGGCAGAGTGAGAGTCTGCAGGG - Intronic
1158687735 18:59629833-59629855 AGGTAGCAGGCGAGCCAGGAGGG + Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1159349283 18:67250756-67250778 AGGAAGACTGAGATTCAGGAAGG + Intergenic
1159448618 18:68571675-68571697 AGGAAGAAATAGAGCCAGGAAGG + Intergenic
1159744220 18:72211211-72211233 AGGCAAGAGGAGAAGCAGGAAGG + Intergenic
1159989109 18:74881558-74881580 AGGCAGAGAGAGAGAGAGGAAGG - Intronic
1160082781 18:75745202-75745224 AGGCAAGAGGAGAGGCAGGTTGG - Intergenic
1160380143 18:78448373-78448395 AGGAAGATGGAAAGGCAGGAGGG - Intergenic
1160689854 19:456477-456499 AGGGAGGAGGAGGGTCTGGAAGG - Intronic
1160754823 19:751659-751681 AGGCGGAAGGAGTCTCAGGCCGG + Intronic
1160810461 19:1010903-1010925 AGGGAGAGTGGGAGTCAGGACGG + Intronic
1160953917 19:1680942-1680964 AGGCAGATGGGGAGGCTGGAAGG + Intergenic
1161103967 19:2434224-2434246 GGGCAGGAGGAGAGGCGGGACGG - Intronic
1161524228 19:4743486-4743508 AGGCAGGAAGAGAGACAGGGAGG + Intergenic
1161637000 19:5395244-5395266 TGCCAGAAGGAGAGCCGGGACGG - Intergenic
1161659360 19:5536545-5536567 AGGAGGAAGGAGAGCCGGGAGGG + Intergenic
1161791374 19:6362067-6362089 AGCCAGGAGGGGAGTCAGAAGGG - Intronic
1161919989 19:7258928-7258950 AGGAAGAAGGAAAGGAAGGAGGG - Intronic
1162104702 19:8363403-8363425 AGGAAGAAGGAAAGAAAGGAAGG - Intronic
1162324964 19:9993499-9993521 AGGCAGATGGGGTGTGAGGAGGG + Intronic
1162337635 19:10071431-10071453 AGGGACAAGGAGGGGCAGGAGGG + Intergenic
1162779661 19:13000431-13000453 AGGCAAGAGGAGAGTTTGGAAGG + Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163020760 19:14479819-14479841 AGGCAGCTGGAGACTCAGGCTGG - Intronic
1163207240 19:15812618-15812640 GGAAAGAAGGAGAGTGAGGAAGG + Intergenic
1163233750 19:16019687-16019709 AGGCAGAGGGAGGAGCAGGAAGG + Intergenic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1163783449 19:19262164-19262186 AGGCAGAGGGAGAGACAGAGGGG + Intronic
1163783474 19:19262356-19262378 AGGCAGAGGGAGAGACAGAGAGG + Intronic
1163783481 19:19262396-19262418 AGGGAGAGGGAGAGACAGAAAGG + Intronic
1164565245 19:29321301-29321323 AGACAGCAGGAGAGGCAGGCAGG + Intergenic
1164573425 19:29390523-29390545 AGGCAGGAAGAAAGGCAGGAAGG + Intergenic
1164608886 19:29618807-29618829 AGGCAGGAGGAGAGGCCGGAAGG + Intergenic
1164633623 19:29777449-29777471 AGGCAGTGGCAGAGTCAGGTTGG - Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680442 19:30130871-30130893 AGGGAGGAGGAGAGGAAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164714087 19:30378975-30378997 AGGCATAAGGAGTGTGGGGAGGG + Intronic
1164934675 19:32201559-32201581 AAGCAAAAGGAGAATCAGCAGGG + Intergenic
1165384565 19:35502768-35502790 AGGCTTGGGGAGAGTCAGGAGGG + Intronic
1165392052 19:35544517-35544539 AGGTAGAAGGAGCTGCAGGAAGG - Intronic
1165421310 19:35723327-35723349 AGGCAGAAGAGGAGTGAGGTAGG - Intronic
1165485428 19:36092640-36092662 AGGCAGAGGAAGAGTAAGCATGG - Intronic
1165847388 19:38827042-38827064 AGGGAGAAGGAGGGGAAGGAGGG + Intronic
1165948471 19:39459157-39459179 AGGGAGGAGGGCAGTCAGGAAGG - Intronic
1166073289 19:40398714-40398736 AGGCAGAAGGAGACTTTGTAAGG + Exonic
1166123608 19:40700455-40700477 GGGCAGAAGGAAAGGGAGGAAGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166310901 19:41962071-41962093 AGGCCGTAGGAGATTCAGGATGG + Intergenic
1166326053 19:42051835-42051857 AGGCAGCAGGAGCGGCAGGAGGG - Intronic
1166391058 19:42409150-42409172 AGGCAGAAAGACAGTCAGAGAGG + Intronic
1166524290 19:43501567-43501589 AGGGAGAAGGAAAACCAGGAGGG + Intronic
1166787183 19:45375071-45375093 AGGGAGAAAGAGAGAAAGGATGG + Intergenic
1166981629 19:46635030-46635052 GGGCAGAGCGAGAGCCAGGAGGG + Intergenic
1167286658 19:48602233-48602255 AGGGAGGAGGGGAGCCAGGAAGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167632079 19:50631639-50631661 AGGCTGAGGGAGAGTTGGGAAGG - Intronic
1167733864 19:51279303-51279325 AAGTAGAAGGAGAGGCAGCATGG + Intergenic
1167789705 19:51666637-51666659 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1167960984 19:53103701-53103723 AGGCAGAGGGACCGCCAGGAAGG + Intergenic
1168182584 19:54672197-54672219 AGGCAGAGAGAGAGAGAGGATGG + Intronic
1168236668 19:55068026-55068048 AGAGAGAAGGAGACACAGGAGGG - Intronic
1168336828 19:55601833-55601855 ATCCAGAAGGAGAGTTAGGGAGG + Intronic
1168430298 19:56273694-56273716 AGGCAGAAGGAGGGGCATGGTGG + Intronic
1168591139 19:57634982-57635004 AGGGAGAAGGCAAGTCAGGTGGG - Intronic
1168659687 19:58155884-58155906 AGGGAGAAAGAGAGAGAGGAAGG + Intergenic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
925180083 2:1811834-1811856 AGGCAGGAGAAGACCCAGGAGGG - Intronic
925394695 2:3524868-3524890 AGGGAGGAAGAGAGACAGGAGGG - Intergenic
925476355 2:4221069-4221091 AGGTGCAAGGAGAGGCAGGAGGG - Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925862619 2:8194527-8194549 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
926056590 2:9777385-9777407 AGGGATCAGGAGAGTCAGCAGGG + Intergenic
926220864 2:10934723-10934745 AGGCAGAGGGAGGGGCAGGTGGG - Intergenic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926335281 2:11858174-11858196 AGGGAGCAAGAGAGCCAGGAGGG + Intergenic
926686007 2:15698073-15698095 AGGCAGAGGCAGAGGCAGAATGG + Intronic
927276391 2:21265930-21265952 TGGAAGAAGGAGAGTTATGAAGG + Intergenic
927637556 2:24827292-24827314 AGGCAGCAGGAAAATGAGGAGGG - Intronic
927688268 2:25188143-25188165 AGGCAGAGGGAAAGTCTGAAAGG + Intergenic
927734560 2:25507662-25507684 AGACTAAAGCAGAGTCAGGATGG - Intronic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
927932846 2:27056579-27056601 ACTCAGAAGGAGAGACAGAAGGG - Intronic
927947964 2:27148835-27148857 AGGCAGGAGGATAGTGGGGAAGG - Intergenic
927991790 2:27453346-27453368 AGGGAGAAGGAGGGCCAGAAAGG + Intronic
928066177 2:28166582-28166604 GGGTGGAAGGAGAGTAAGGAGGG + Intronic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929664450 2:43822893-43822915 AGCGACCAGGAGAGTCAGGACGG - Exonic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
929985564 2:46728300-46728322 ATTCAGTAGGAGAGACAGGATGG + Intronic
930001040 2:46861546-46861568 GGGCGGAATGAGAGTCAGGACGG + Intergenic
930371466 2:50506740-50506762 AGGAAGAAAGAGAGAGAGGAGGG + Intronic
930956782 2:57212333-57212355 AGGCCTTAGGATAGTCAGGAAGG - Intergenic
931121617 2:59226367-59226389 AGGAAGAAAGAGAGGGAGGAAGG + Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
931683255 2:64770051-64770073 AGGCAGAAGAGGTGGCAGGATGG - Intergenic
931776527 2:65545742-65545764 TGGCAGGAGGAGATACAGGATGG - Intergenic
931825881 2:66000557-66000579 AGGAAGAAGGAAAGGAAGGAAGG + Intergenic
932170210 2:69548498-69548520 AGGAAGAAAGAGAGAAAGGAAGG - Intronic
932468684 2:71940013-71940035 GGGCAGAAGCAGGGCCAGGAGGG - Intergenic
932487086 2:72090777-72090799 AGGCAGAGGAAGGGGCAGGAGGG - Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
932770510 2:74498417-74498439 AAGTAGAGGGAGAGCCAGGAAGG + Intronic
933053978 2:77638294-77638316 AGGAAGAAAGAGAGGGAGGAGGG - Intergenic
933496240 2:83053597-83053619 AGGAAGAAGAAGAGGCAGAAGGG + Intergenic
934750720 2:96792499-96792521 AGGCACAAAGAAAGACAGGAGGG + Intronic
935098533 2:99970304-99970326 AAGCAGAAGGGGAGAAAGGATGG - Intronic
935103120 2:100015707-100015729 AGGCAGAAAGACAGTGAGCATGG + Intronic
935333174 2:101992140-101992162 AGGCAGAGAGAGAGGCAGGGGGG + Intronic
935489542 2:103699363-103699385 AGGCAGAAGAAGAGGCAAAAAGG + Intergenic
935658241 2:105443232-105443254 AGGCACAAGGATCGACAGGATGG + Intergenic
935831601 2:107006483-107006505 AGGCTGAAGGAGAGGAAGGGAGG - Intergenic
935844918 2:107155356-107155378 AGGCAGGAGAAAAGTCAAGAAGG - Intergenic
936639105 2:114292652-114292674 TGTCAGAAGGTGAGTAAGGAAGG - Intergenic
936982484 2:118277221-118277243 GGACAGGAGGAGAGACAGGAGGG - Intergenic
937249681 2:120515509-120515531 AGGAGAAAGGAGAGTCAGGGAGG - Intergenic
937249711 2:120515628-120515650 AGGAGGAGGGAGAGTCAGGGAGG - Intergenic
937249759 2:120515850-120515872 AGGAGAAAGGAGAGTCAGGGAGG - Intergenic
937249767 2:120515884-120515906 AGGAAGAGGGAGAGTCAGAGAGG - Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
937922274 2:127138690-127138712 AGGCATCAGGAGATTCAAGATGG + Intergenic
938067405 2:128288723-128288745 AGGAGGTAGGAGAGTCAGGGAGG + Intronic
938380058 2:130831584-130831606 AGGCAGGGGAAGAGGCAGGAGGG - Intergenic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
938656699 2:133442212-133442234 AGGAAGAAAGAGAGGCAGGGAGG + Intronic
938698814 2:133858447-133858469 AGACAGAGGGAGAGACAGGGAGG + Intergenic
938992543 2:136644062-136644084 AGGGAGGAGGAGAGGAAGGAAGG + Intergenic
939369189 2:141276429-141276451 AGGTGGGAGGAGAGTCAAGATGG - Intronic
939490850 2:142874444-142874466 AGGGGAAAGGAGAGGCAGGAGGG + Intergenic
939890034 2:147725600-147725622 AGGTGGAAGAAGAGACAGGAGGG + Intergenic
939955533 2:148525121-148525143 AGGCAGGAGGAGTGGAAGGATGG + Intergenic
940217408 2:151315116-151315138 AGTCCGAAGGAGAGTCAGCAAGG - Intergenic
940219519 2:151337216-151337238 AGGAAGGAGGAGGGTCAGGTTGG - Intergenic
940949836 2:159661085-159661107 AGGAAGAAGGGGAGTAGGGAGGG - Intergenic
941167728 2:162101366-162101388 AGGTAGAAGAAAAGGCAGGAAGG + Intergenic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942058577 2:172207247-172207269 AGGATGAAGCAGAGTCAGGGAGG - Intergenic
942095996 2:172537156-172537178 AGGCAGAGGCAGAGGCAGAAAGG - Intergenic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
943330781 2:186556369-186556391 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
943751896 2:191517915-191517937 GGGCAGAAGGATTGTCAGGAAGG + Intergenic
944313041 2:198256716-198256738 GAGCAGATGGAGAGTCAGGGAGG - Intronic
944486426 2:200211218-200211240 AGGCAGCAAGACAATCAGGAAGG + Intergenic
945043494 2:205762311-205762333 AGGCAGCTGGGGAGTCAAGAAGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945471261 2:210230036-210230058 AGACAGAGAGAGAGTGAGGAAGG + Intergenic
945768441 2:214009593-214009615 AGGCAGAATGAGGGTCGTGAGGG + Intronic
945874720 2:215266684-215266706 AGGCAGCAGGACAGCCAAGAGGG - Intergenic
946169493 2:217886176-217886198 AGGGAGAAAGAGAGAAAGGAAGG + Intronic
946759844 2:222982721-222982743 AGGTAGAGGGAGAGGCAGGTGGG - Intergenic
947366777 2:229404361-229404383 AGACAGAATGAGAGCCAGCAGGG + Intronic
948356864 2:237384983-237385005 AGGCAGAAGGAAGAGCAGGAGGG - Intronic
948386123 2:237582107-237582129 AGGCAGGAGCAGAGGCAGAACGG - Intronic
948454293 2:238097591-238097613 AGGGAAAAGGAGGGGCAGGATGG + Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
948835116 2:240622690-240622712 AAGCAGGAGGAGGGGCAGGAAGG + Intronic
1168764710 20:373773-373795 GGGCCTAAGGAGAGGCAGGAAGG - Intronic
1168814167 20:725335-725357 AGGCAGAAAGAGAGGGAGGGAGG - Intergenic
1168911541 20:1451877-1451899 TGGCAGAGTGAGTGTCAGGAAGG + Intronic
1168953538 20:1818632-1818654 ACCCAGAAAGAGAGGCAGGAGGG - Intergenic
1168997422 20:2143756-2143778 AGACAGAAGGCGGGTAAGGAGGG - Intronic
1169189187 20:3646530-3646552 AGGCGGAGGGAGGGTCAGGGTGG + Intronic
1169427724 20:5509712-5509734 AGGAAAAAGGGGAGGCAGGAGGG + Intergenic
1169547514 20:6665695-6665717 AGGGAGGAAGAGAGGCAGGAAGG - Intergenic
1169598912 20:7234381-7234403 AGGAAGAAGGAGATGTAGGAAGG - Intergenic
1169668559 20:8068303-8068325 AGGCAGAAAGAGAGTAGGGAAGG + Intergenic
1169907865 20:10621549-10621571 AGAAAGCAAGAGAGTCAGGAGGG - Intronic
1170547082 20:17443588-17443610 AGGCCAAAAGAGAGTCGGGAAGG + Intronic
1170606987 20:17882147-17882169 AGCAAGAATTAGAGTCAGGAGGG + Intergenic
1171431853 20:25087910-25087932 AGGTAGAAGGAGATTCCAGAGGG - Intergenic
1172038570 20:32028036-32028058 ACTCAGCTGGAGAGTCAGGAGGG + Intronic
1172192401 20:33069830-33069852 CGGCAGAAGGAGCTTGAGGACGG - Intronic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172700603 20:36851573-36851595 AGGCAGAAGGCAAGCCAGCAGGG - Intronic
1172771265 20:37384034-37384056 AGGCCCAAGGAGAGGCAGCAGGG - Intronic
1173060023 20:39651817-39651839 AGCCAGAAGCAGAGTCAGCCAGG + Intergenic
1173335975 20:42112678-42112700 AGGCAGTGAGAGAGCCAGGATGG - Intronic
1173350732 20:42243024-42243046 AGGCAGAGGCAGAGGCAGAAAGG + Intronic
1173486981 20:43448317-43448339 AGGGAGAGGGAGAGACAGGGAGG + Intergenic
1174404417 20:50294254-50294276 AGGCTGAAGGGGTGTGAGGAGGG + Intergenic
1174755122 20:53150689-53150711 AGGAAGGAGGAGAGGAAGGAAGG + Intronic
1175027784 20:55921288-55921310 ACTCAGAAAGTGAGTCAGGAAGG + Intergenic
1175096654 20:56546563-56546585 AGGCTGGAGGAGACTAAGGAGGG - Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175768172 20:61605580-61605602 AGACAGAGGGAGAGACAGGGAGG - Intronic
1175840747 20:62025599-62025621 TGGCGGCAGGAGAGACAGGAGGG - Intronic
1175871368 20:62210946-62210968 AGGCAGAAAGTGTGTCTGGAGGG - Intergenic
1177034108 21:16020307-16020329 AGACAGAATGAGATTCAGAATGG + Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178291661 21:31373638-31373660 AAACAGAAAGAGAGGCAGGAGGG + Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1179033133 21:37737424-37737446 AAGCAGAACGAAAGTCAAGAGGG + Intronic
1179238548 21:39568387-39568409 AAGCAGCTGGAGAGGCAGGAGGG - Intronic
1179786534 21:43733497-43733519 AGACAGATGGAGAGGAAGGACGG - Intronic
1179927104 21:44540753-44540775 AGGGAGAAGGGGAGCAAGGAAGG + Intronic
1180084088 21:45499767-45499789 AGGCAGGAGGGCAGGCAGGACGG + Intronic
1181042950 22:20201461-20201483 AGGCAGAAAGGGAGGAAGGAAGG - Intergenic
1181375580 22:22455208-22455230 AGGCAGAAAGAGAGAGAGGGAGG + Intergenic
1181538078 22:23557135-23557157 ATGCAGAAGGAGTTTCAAGAAGG + Intergenic
1181761151 22:25059681-25059703 AGGCGGAGGGAGGGGCAGGAAGG + Intronic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181844741 22:25698124-25698146 AGGAGGAAGGAGAGGGAGGAAGG + Intronic
1181890180 22:26055635-26055657 AGGCAAGAGGAGAGGCAGGAGGG + Intergenic
1181915778 22:26278890-26278912 AGAAAGAAGGAGAGGAAGGAAGG + Intronic
1181983213 22:26781320-26781342 AGGCAGAGGGAGGGAGAGGAAGG + Intergenic
1182395911 22:30035818-30035840 AGGCAGAAGAACTGGCAGGAGGG - Intergenic
1182441458 22:30366717-30366739 AGGCTGCAGGAGAATCAGCAAGG - Intronic
1182750400 22:32637223-32637245 AGCAAGCAGGAGTGTCAGGATGG - Intronic
1182786397 22:32911431-32911453 AGGCAGGAGAAGAGTCAAGATGG - Intronic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183582469 22:38734115-38734137 AGGCAGAAAGCCAGTCAGTAGGG - Intronic
1183618352 22:38958590-38958612 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1183628693 22:39020536-39020558 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183632172 22:39040295-39040317 GGGAAGAAGGAGAAGCAGGAAGG + Intergenic
1183637993 22:39076696-39076718 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183741294 22:39670018-39670040 AGGCTGCAGGGGAGTCAGAAAGG - Exonic
1184099567 22:42335032-42335054 ATGCAGAACGAAAGTCAGGCTGG - Intronic
1184308916 22:43628527-43628549 AGTGAGAAGGAGAGTCAAGGGGG - Intronic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184535770 22:45085826-45085848 AGGCAGCAGGAGAGAAAGGGGGG + Intergenic
1184959351 22:47917854-47917876 GGGAAGAAGGAGAGGGAGGAGGG - Intergenic
1184981213 22:48097147-48097169 AGGCAGCAGGAGTGGCAGGGTGG - Intergenic
949367899 3:3302786-3302808 AGGCAGCAGGAGAGAGAAGAAGG - Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949618771 3:5786513-5786535 AGGCAGGAGGAGAGAGAGGTTGG + Intergenic
950018098 3:9768356-9768378 ACCCAGATGGGGAGTCAGGAGGG - Intronic
950080206 3:10216518-10216540 AGGTAGGAGGAAAGTCAGGAGGG + Intronic
950190179 3:10971089-10971111 AGGCTGAAGGAAGGACAGGAAGG + Intergenic
950398873 3:12755007-12755029 AGGGGGAAGGAGAGAGAGGAAGG - Intronic
951145451 3:19221043-19221065 TGGCAGAAGGAAAATCAGAATGG - Intronic
951597215 3:24331366-24331388 AGAAAGTAGGAAAGTCAGGACGG - Intronic
952181917 3:30925686-30925708 AGGGAGAAGGAGGGTCAGACAGG + Intergenic
952590148 3:34942636-34942658 AGGCAGAGAGAGAGGAAGGAAGG - Intergenic
953039016 3:39238257-39238279 AGGAAGAAGGAGATTGAGAAAGG - Intergenic
953096422 3:39781138-39781160 AGGCAGGAGGAGAGATAGAAGGG - Intergenic
953159006 3:40400861-40400883 AGGGAAAGGGAGAGTCAGAATGG - Intronic
953839144 3:46374781-46374803 TGGCCAAAGGAGGGTCAGGAAGG + Exonic
953979225 3:47405395-47405417 AGGCAGGAGGAGAGTGTGGCTGG + Intronic
954299449 3:49691666-49691688 AGGAAGAAGCAGAGTACGGAAGG - Intronic
954416634 3:50396464-50396486 AGGAAGAAGAGGAGTCAGGTGGG - Intronic
954706177 3:52481781-52481803 GGGCACAAGGGGAGTGAGGAGGG - Intronic
954807207 3:53227413-53227435 AGGCCGGAGGAGGGTCAGGCAGG - Intronic
955229607 3:57086997-57087019 AGGAAGAGGTGGAGTCAGGAGGG + Intergenic
955266820 3:57452065-57452087 AGGCAGAAAGAGACTGAGGCAGG - Intronic
955640746 3:61081274-61081296 GGGCAGCAGGAGAGGCAGGTTGG - Intronic
955784724 3:62525242-62525264 AGTCAGAAAGAGAGTCACGTGGG + Intronic
956309209 3:67860449-67860471 AGGCAGAAGGGGAGCGAGCAAGG + Intergenic
956326971 3:68063851-68063873 TGGCACAAGGAAAGTTAGGAAGG + Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956765754 3:72482887-72482909 AGGCAGAAGGAGAAGTAGGTTGG + Intergenic
956767553 3:72496654-72496676 AGGAAGAAGGAAAGGAAGGAAGG - Intergenic
957036525 3:75298469-75298491 AGGAAGAAGGAAAGAAAGGAAGG + Intergenic
957448125 3:80340595-80340617 AGGCAGAGAGGGAGTAAGGAAGG + Intergenic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
959243872 3:103837437-103837459 AGGCAGCAGGGGAGAAAGGAAGG + Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959933928 3:112010857-112010879 AGGCAGATGGAAAGTGAGAATGG - Intronic
959970999 3:112409813-112409835 GGTCAAAAGGAGAGTAAGGAGGG + Intergenic
961035622 3:123639569-123639591 AGGCAGAATGTGAGCCAGGCAGG + Intronic
961105908 3:124241136-124241158 GGGAAGTAGGAGAGTCAGAATGG - Intronic
961375887 3:126465527-126465549 AGGCAGACGGAAACACAGGAGGG + Intronic
961555314 3:127693026-127693048 AGGCAGAAGGGAAGTCTGGCTGG - Intronic
961725642 3:128927311-128927333 AGGCAGAAGGAAAGGAAGGAAGG + Intronic
961829401 3:129615774-129615796 AGGATGCAGCAGAGTCAGGAGGG + Intergenic
961872131 3:129996292-129996314 AGCCACAAGGAGAGGCATGAGGG + Intergenic
962072159 3:132044595-132044617 AGGGAGAAGGAGGGGCAGGGAGG + Intronic
962930373 3:140030428-140030450 AGACAGAAGGAGAGTGGGTAGGG + Intronic
963367982 3:144363268-144363290 AGGCAAAAGGAGAACCAGAAGGG + Intergenic
963796307 3:149634153-149634175 AGGGAAAAGGAGAGCCAGGGTGG + Intronic
963873096 3:150441386-150441408 AGGTAGAAGGAAAAACAGGAGGG - Intronic
965117362 3:164508454-164508476 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
965198173 3:165625285-165625307 AGTCAGAAGGGGAGGCAGTAAGG + Intergenic
965564288 3:170095617-170095639 TGGCAGAAGTCGAGTAAGGAGGG - Exonic
965605604 3:170495413-170495435 AGGCAGGAGTGGAGTCAGGCAGG - Intronic
966767432 3:183475938-183475960 AGACAGAAAGAGAGAGAGGAAGG - Intergenic
966872839 3:184302881-184302903 AGTCAGAGGTAGAGTCAGGGAGG - Intronic
967232677 3:187355187-187355209 AGGCAGAAAGGGAGGAAGGAAGG - Intergenic
967562829 3:190936714-190936736 AGGGAGAAAGAGAGATAGGAAGG - Intergenic
968615426 4:1575556-1575578 AGGAAGACAGAGAGGCAGGACGG + Intergenic
968651691 4:1762676-1762698 TGGCAGAAGGGGAGCCAGGGCGG + Intergenic
968949976 4:3685465-3685487 AGGCAGCTGGAGAGTGAGGCTGG + Intergenic
969136739 4:5035423-5035445 ACACAGCAGGAGAGGCAGGAGGG + Intergenic
969471123 4:7389893-7389915 AGGCTGAAGGACAGTGAGCAGGG + Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969842614 4:9893480-9893502 AGGCCCAGTGAGAGTCAGGAGGG + Intronic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
969997414 4:11326981-11327003 AGCCAGAAGAAGAGATAGGATGG - Intergenic
970223806 4:13836669-13836691 AGGCAGATGGAGGGGCAGGCAGG + Intergenic
970935246 4:21562095-21562117 AGGCAAATGGAGAGACAGAAAGG - Intronic
970947702 4:21714530-21714552 AGGAAGAAAGAGAGGGAGGAAGG + Intronic
971194725 4:24461769-24461791 AGGCAGAAGGAAAGTGTAGAAGG - Intergenic
971258614 4:25035653-25035675 AGCTAGAAGGCCAGTCAGGATGG + Intergenic
971278127 4:25217195-25217217 AGGCAGAAGGAGAGAGAGAGTGG + Intronic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
972164080 4:36260992-36261014 AGGCAGGCGGAGAAGCAGGATGG - Intergenic
972371060 4:38423896-38423918 AAGCAGAAGGAGAGGCATTAGGG + Intergenic
973264954 4:48201693-48201715 AGCCAGAAGGAGGCTAAGGAAGG + Intronic
973370548 4:49243656-49243678 AGCCAGAAGGAGTGTTTGGAAGG - Intergenic
973941838 4:55919089-55919111 AGGCAGAAGGGTAGAAAGGAGGG + Intergenic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
974093286 4:57334929-57334951 AGGCAGAAGGAGATTGTGCACGG + Intergenic
975640025 4:76491126-76491148 AGTCAAAAGGAGAGGCAAGATGG + Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
976958472 4:90935322-90935344 AGGAAGCAGGAGAGACAGCAGGG - Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
978623701 4:110660809-110660831 AGTAAGAAAGAGTGTCAGGAAGG + Intergenic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
978795125 4:112701185-112701207 AGCCAGAGGGAGAGAGAGGAGGG + Intergenic
978955182 4:114603531-114603553 AGGCAAGAGGAGAGTTAGGAGGG + Intronic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
980204264 4:129697556-129697578 AGGAAGAAAAAGATTCAGGAAGG - Intergenic
981212882 4:142129717-142129739 AGACAGGAAGAGGGTCAGGAAGG - Intronic
981359767 4:143832520-143832542 AGAGAGAATGAGAGTCAGCAGGG - Intergenic
981370265 4:143951625-143951647 AGACAGAATGAGAGCCAGCAGGG - Intergenic
981370528 4:143953595-143953617 AGAGAGAATGAGAGTCAGCAGGG - Intergenic
981380289 4:144063519-144063541 AGAGAGAATGAGAGTCAGCAGGG - Intergenic
981614192 4:146629481-146629503 AGGAAGAAGGGGAATAAGGAAGG + Intergenic
981761483 4:148200125-148200147 TGGCAGAAGCACAGGCAGGATGG + Intronic
981955974 4:150474768-150474790 AGGAAGAAAGAGAGGAAGGAAGG - Intronic
982111555 4:152061046-152061068 AGGTGGAAGGGGAGGCAGGAGGG + Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982777153 4:159453568-159453590 AGGTTGAAGAAGAGGCAGGAAGG - Intergenic
982782040 4:159501309-159501331 AGGCAGGAAGAGAGAAAGGAAGG - Intergenic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
984006273 4:174313774-174313796 AGGGTGAAGGAGAGTAAGGAAGG + Intronic
984228146 4:177060748-177060770 AGGGAGAATGATAGTGAGGAGGG - Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
984791297 4:183617298-183617320 AGACAGAAAGAGAGAGAGGAAGG - Intergenic
984821445 4:183886098-183886120 AGGCAGATGCAAAATCAGGAGGG + Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985145184 4:186889156-186889178 AGGCGGGAGGAGTGGCAGGAAGG - Intergenic
985145190 4:186889176-186889198 AGGCGGGAGGAGTGGCAGGAAGG - Intergenic
985145196 4:186889196-186889218 AGGCGGGAGGAGTGGCAGGAAGG - Intergenic
985145202 4:186889216-186889238 AGGCGGGAGGAGTGGCAGGAAGG - Intergenic
985387229 4:189460885-189460907 AGGAAGAAAGAGAGGAAGGAAGG + Intergenic
985387248 4:189460993-189461015 AGGAAGAAAGAGAGGAAGGAAGG + Intergenic
985387297 4:189461263-189461285 AGGAAGAAAGAGAGGAAGGAAGG + Intergenic
985940752 5:3133909-3133931 GGGCAGAAGGGGAGTCAAGCCGG - Intergenic
985987592 5:3529689-3529711 AGGGAGAAGGAGAGAAAAGAGGG - Intergenic
986089889 5:4493604-4493626 AGGCAGGAGGAGAGAGAGGAAGG - Intergenic
986105774 5:4658116-4658138 AGGCAGAAGGGGAGGATGGAGGG - Intergenic
986299329 5:6466029-6466051 AGGAAGAGGGAGGGGCAGGAAGG - Intronic
986322681 5:6645774-6645796 AGGCAAAAATAGAGTCAGGGTGG - Intronic
986556251 5:9012566-9012588 AGGGAAATGGAGAGTCAGGTTGG - Intergenic
986767457 5:10940641-10940663 AGACAGAAGGGGTGGCAGGAAGG - Intergenic
986995780 5:13605526-13605548 AAGAAGAATGAGAGTAAGGAGGG + Intergenic
987115388 5:14722569-14722591 AGGCAGAAGGAGCTTCCGAATGG + Intronic
987259670 5:16190460-16190482 AAGGGGAAGGAGAGTCAAGAAGG + Intergenic
987269630 5:16293279-16293301 AGGAAGAAGGAAACTAAGGAAGG - Intergenic
987298259 5:16573655-16573677 AGGCACAGGGAGAGGGAGGATGG + Intronic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987761503 5:22168659-22168681 AGCTGCAAGGAGAGTCAGGATGG - Intronic
987869954 5:23603256-23603278 AGGCAGAAGGCAGGACAGGAGGG - Intergenic
988315861 5:29627289-29627311 AGACAGAAGGAAAGTCTGGGTGG + Intergenic
988949760 5:36244284-36244306 ATGCAGAAGTAGTCTCAGGAAGG - Intergenic
989145059 5:38241228-38241250 TGGCAGAATGAGGCTCAGGATGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990172033 5:53062273-53062295 AGAGAGCAGGAGAGTCAGGAAGG - Intronic
990211313 5:53483209-53483231 AGGCAGAATTAGAGTCTGCACGG - Intronic
990352843 5:54936087-54936109 AGGGAGAATGAGACTCAGGAAGG - Intergenic
990798050 5:59566300-59566322 AGGCAGCAGAAGAGCCAGGGTGG - Intronic
990966145 5:61450167-61450189 GGGCAGAAAGAAAGGCAGGATGG - Intronic
990969872 5:61493571-61493593 AATCAGTTGGAGAGTCAGGAAGG + Intronic
991109184 5:62879500-62879522 AGGCAGAAGGGAAGTCAGATAGG + Intergenic
991799209 5:70341547-70341569 AGGCAGAAGCAGAGTAACAAGGG - Intergenic
991896291 5:71402126-71402148 AGCTGCAAGGAGAGTCAGGATGG - Intergenic
992047722 5:72912610-72912632 AGGCAAAAGGCTTGTCAGGAGGG - Exonic
992158619 5:73979462-73979484 AGTCAGAAGGAGAAGCAGAAAGG + Intergenic
992240212 5:74761400-74761422 AGTCAGAAGCTGAGTCAGAAAGG + Intronic
992865635 5:80954448-80954470 ACACAGCAGGAGAATCAGGAAGG + Intergenic
993393519 5:87353505-87353527 AGGCAAAAGTAGAGACAGCAGGG + Intronic
993426131 5:87766175-87766197 AGGCAGAAGGAAAGGGAGAAGGG + Intergenic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
993723140 5:91341458-91341480 AGGCAGAAGTAGAAACAGGGAGG + Intergenic
995238323 5:109856601-109856623 AGGCAGAAGAAGGGACAGAATGG + Intronic
995881402 5:116848232-116848254 AGGTTGAAGGAGAGGCTGGAAGG - Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996472211 5:123873946-123873968 AGTAAGCAGCAGAGTCAGGATGG + Intergenic
997198233 5:131993844-131993866 AGGCAGAAGGAGTGCCTGGTAGG + Intronic
998167829 5:139854587-139854609 AGTCTGGAGGAGAGTCAGGAGGG - Intronic
998205457 5:140154138-140154160 AGGGAGGAGGAGAGAAAGGAGGG + Intergenic
998250655 5:140549906-140549928 AGGCACAGGGAGAGACAGGATGG - Intronic
998454818 5:142263658-142263680 TGGCAGAAGGGGAGGAAGGAAGG - Intergenic
998508994 5:142695884-142695906 AGACAGCAGGAAAGTCTGGAAGG + Intronic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
998604610 5:143621082-143621104 AGGTAGGAGGAGAGTCAGTGAGG - Intergenic
998638972 5:143987666-143987688 AGTAAGAAGGAAAGGCAGGAAGG - Intergenic
999742406 5:154566254-154566276 AGGCAGGAGGAGTGTGAGGTAGG + Intergenic
999856634 5:155601689-155601711 AGACAGGAAGAGAGGCAGGAAGG - Intergenic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000422294 5:161052617-161052639 AGGAAGTAGTAGAATCAGGATGG - Intergenic
1000591112 5:163158447-163158469 AGGGAAAAGGAGAGTCACAATGG + Intergenic
1000918957 5:167116232-167116254 TGACAGAAGGAGAGGAAGGAAGG + Intergenic
1000984831 5:167855656-167855678 AGGAAGAAAGAGAGGAAGGAAGG + Intronic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001806482 5:174591025-174591047 AGACAGAAAGAGAGAAAGGAAGG + Intergenic
1001946650 5:175784395-175784417 AGGCAGAGTGGGAGGCAGGATGG - Intergenic
1001968120 5:175928849-175928871 AGGAAGAAAGAAAGTAAGGAAGG + Intronic
1002088850 5:176792854-176792876 AGGCAGAAGGAGAGGAGGGGAGG - Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002349425 5:178573074-178573096 AGGCAGGAGGAAACTCTGGAGGG + Intronic
1002383047 5:178844140-178844162 AGGCAGGAGAGGAATCAGGAGGG - Intergenic
1003239965 6:4336010-4336032 AGGGAGAAGGAGGGTCAGCATGG + Intergenic
1003355537 6:5366017-5366039 AGGCGGAAGGGGAGGCAGGAAGG + Intronic
1003369579 6:5511064-5511086 AGGGAGAAGGAGAGGCCAGATGG + Intronic
1003708784 6:8565616-8565638 AGGCAGGTGGAGATTGAGGAGGG + Intergenic
1004278573 6:14259311-14259333 GGGCAGAAGGAGCACCAGGAAGG + Intergenic
1004769134 6:18762163-18762185 AGGCAGGAAGGGAGGCAGGAAGG - Intergenic
1005409919 6:25533625-25533647 TGGCAGAAGGACATTCAGAATGG - Intronic
1005518510 6:26577473-26577495 AGCCAGCAGGAGACTCAGGGAGG - Intergenic
1006034806 6:31202822-31202844 GGGCAGAAGGTGCGGCAGGAAGG - Exonic
1006089496 6:31620239-31620261 AGGGAGAAAGAGAGAGAGGACGG - Intergenic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006304666 6:33211815-33211837 AGGAAGCAGGGGAGCCAGGAGGG + Exonic
1006491108 6:34389300-34389322 AGGCAGCAGGAGAGAGAGAAGGG - Intronic
1006599074 6:35213963-35213985 AGGAAGAAAGAGAGGCAGAAAGG + Intergenic
1006726823 6:36205105-36205127 AGGCTGAATGAGAGCCAGGGTGG + Intronic
1006735653 6:36270716-36270738 AGACAGAAGGAGCGTGAGGGAGG + Intronic
1006965324 6:37977859-37977881 AGGAAGAAGGAAAGGAAGGAAGG - Intronic
1007151934 6:39702173-39702195 AGAGAGAATGAGAGTCTGGAAGG - Intronic
1007236362 6:40393531-40393553 AGGCAGAGGGAGAGACAGAGAGG + Intronic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008385000 6:50879241-50879263 ACTCTGATGGAGAGTCAGGAGGG + Intergenic
1008459530 6:51752113-51752135 AGGAAGATGGGGAATCAGGAAGG - Intronic
1008485946 6:52035898-52035920 AGGGAGAAGTAGTGACAGGAGGG + Intronic
1008537595 6:52518577-52518599 AGGCAGGAGAAGAGAGAGGAAGG + Intronic
1009388840 6:63121088-63121110 AAGCACATGGAGAGTCAGGGAGG - Intergenic
1009901448 6:69812240-69812262 AGGTGGAAGCAGAGTCAGGTGGG + Intergenic
1010024919 6:71204132-71204154 AGGAAGAAAGAGAGTGGGGAAGG + Intergenic
1010485665 6:76410430-76410452 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
1011430955 6:87286163-87286185 AGGTTTAGGGAGAGTCAGGAAGG - Intronic
1011642649 6:89430533-89430555 AGGCAGAAGGAGGGTGAGCTAGG + Intergenic
1011770029 6:90665442-90665464 AGGGAGAAAGAGAGAAAGGAAGG - Intergenic
1011850726 6:91625102-91625124 AGACAGAAGCAGAGTAAAGAGGG - Intergenic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1012423054 6:99085477-99085499 AGCCTGAAGGAGAGCCACGAGGG + Intergenic
1012549698 6:100455540-100455562 ACTCAGAAGGAGTGACAGGAGGG + Intronic
1012806168 6:103896025-103896047 AGGCAGAAGAAGAGAGAGAATGG + Intergenic
1012832846 6:104227627-104227649 AGGCTTAAAGAGAGGCAGGAAGG - Intergenic
1012872818 6:104692062-104692084 GGGTAGAAGGAGGGTAAGGAAGG + Intergenic
1013236944 6:108205519-108205541 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1013377420 6:109531241-109531263 AGTCAGAAGGATGGTCTGGAAGG + Intronic
1013710508 6:112891901-112891923 AGGAGGCAGGAGAGTGAGGAAGG - Intergenic
1014309014 6:119775507-119775529 AGTCTCAAGGAGAGTCTGGATGG + Intergenic
1014342951 6:120231142-120231164 AGGCAGCAGGAGAGACAGCCAGG - Intergenic
1014730273 6:125024229-125024251 AAGCAGAAGAAAAGTCGGGAGGG + Intronic
1014800104 6:125769324-125769346 AGGCTGAAAGAAAGCCAGGAGGG - Intergenic
1015234903 6:130959446-130959468 AGGCAGAAGAAAAGGCATGAGGG + Intronic
1015248434 6:131101548-131101570 AGGCAGAAAGAGAGAAATGAAGG + Intergenic
1015889693 6:137957775-137957797 AGTCAGGAGGGGAGTCATGATGG + Intergenic
1016142840 6:140634313-140634335 AGGAAGAAAGAGAGAAAGGAAGG - Intergenic
1016512834 6:144862939-144862961 GGGCAGCAGGAGAGACAGGGAGG - Intergenic
1016646271 6:146412065-146412087 AGGCAGAAGGAGGGGATGGAGGG - Intronic
1016700706 6:147050750-147050772 AGAAAGAAGGAGAGGAAGGAGGG - Intergenic
1016792364 6:148079160-148079182 AGGTAGAAGGGGAGTGAGGAAGG + Intergenic
1017020812 6:150138685-150138707 AGGTAGGAGGAAAATCAGGAGGG + Intergenic
1017102147 6:150858228-150858250 AGTGAGAAGGTGGGTCAGGAGGG - Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1018036699 6:159888207-159888229 AGAAAGATGGAGAGTCAGGAGGG - Intergenic
1018260812 6:161969055-161969077 ATGCTGAAAGAGAGGCAGGAGGG + Intronic
1018691982 6:166353760-166353782 AGGCAGAAAGAGAGGAAGAAAGG - Intergenic
1018694153 6:166377382-166377404 AGGCAGAAGTGGAGGCAGGCAGG + Intronic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019158112 6:170052502-170052524 AGACAGAAGGAGAGAGAGGGAGG - Intergenic
1019163865 6:170086698-170086720 AGGCAGAAGGGGCGGCAGGAGGG + Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019201586 6:170320809-170320831 AGGAGGAAGGAGAATAAGGAGGG + Intronic
1019332331 7:466591-466613 AGGGTGAAGGAGAGTGAGGGAGG - Intergenic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019497021 7:1345505-1345527 AGGCAGAGGGAAGGGCAGGAAGG + Intergenic
1019637238 7:2082403-2082425 AGACAGAAGGAGAGACCAGAGGG + Intronic
1019718642 7:2555008-2555030 AGCCAGTAGGAGGGTGAGGAGGG + Intronic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1022303989 7:29129110-29129132 AGGCTTAAGGAGAATCAGGATGG + Intronic
1022309855 7:29186597-29186619 AGGAAGGAAGAGAGGCAGGAAGG + Intronic
1022504328 7:30901036-30901058 AGGCAGAAAGAGGGCCAGGAGGG - Intergenic
1022508516 7:30921401-30921423 AGAGAGAAGGAGAGACAGGGAGG + Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022816001 7:33914802-33914824 AGGCAAGAGGAGAACCAGGAAGG + Intronic
1022857519 7:34329946-34329968 AGGCTGAAGGAGAGAGAAGAAGG + Intergenic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1023945271 7:44797552-44797574 AGGCAGAGGGACAATCGGGAGGG - Intronic
1024047530 7:45595371-45595393 AGGCAGAAGGAGAGGGAGAACGG - Intronic
1024603403 7:51006561-51006583 AGGCAGGAGAAGAGAGAGGATGG + Intergenic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026183023 7:68059050-68059072 AGGTAGAAGGAGAGACAGGGAGG - Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026904071 7:74052730-74052752 AGGGAGAGAGAGAGGCAGGAAGG + Intronic
1027386353 7:77662993-77663015 GGGAAGAAGGAGAGAGAGGAAGG + Intergenic
1027481364 7:78701659-78701681 AGGAAGGAGGAAAGTAAGGAAGG - Intronic
1027539963 7:79453949-79453971 AGGCAGAGAGAGAGGCAGGCTGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027827565 7:83135395-83135417 TGGCTGAAGGAGAGCCATGAAGG + Exonic
1029360660 7:100086306-100086328 AGGAAGAAGGAGAGGCAGTGAGG + Intergenic
1029375396 7:100174279-100174301 AGGCAGAAGGTGAGGCTGGGAGG + Intronic
1029382507 7:100222876-100222898 AGTGAGATGGAGAATCAGGACGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029424023 7:100485621-100485643 AGGCCAGAGGTGAGTCAGGAAGG - Intronic
1029856755 7:103525131-103525153 AGGCAGAAAGAGAGAGAGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030114018 7:106049683-106049705 ATGCAGAATGGGAGACAGGAGGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030656525 7:112174055-112174077 ACGCAGGTGGAGACTCAGGAGGG - Intronic
1030685555 7:112483589-112483611 AGGCAAAAGGAAAGACAGGTTGG + Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031555968 7:123176778-123176800 AGGTAGGAGGAGAACCAGGAGGG - Intronic
1032566685 7:132954108-132954130 AGGCAGAGGGACAGGCAGGAGGG + Intronic
1032748572 7:134812985-134813007 GGGCAGAAAGAGAACCAGGAGGG + Intronic
1033222232 7:139535837-139535859 AAGCAGCAGGAGATTCAAGATGG + Intronic
1033314432 7:140285776-140285798 AGAGAGAAGGAGTCTCAGGAAGG - Intergenic
1033615764 7:143012755-143012777 AGGAAGAAGGAGAGGGAGAATGG + Intergenic
1034256032 7:149725093-149725115 AGACAGGAGGGGAGTGAGGAGGG - Intronic
1034339958 7:150346539-150346561 AGGGAGAGAGAGACTCAGGAGGG + Intergenic
1034821928 7:154223841-154223863 AGGCAGGAGGGGAGTGAGCATGG + Intronic
1034995106 7:155572074-155572096 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1035032214 7:155868870-155868892 TGGCAGAAGGAGAGCCAGGAGGG + Intergenic
1035050236 7:155994533-155994555 AGGCAGACAGAGGCTCAGGAGGG - Intergenic
1035355263 7:158272812-158272834 CGGCAGAAGGAGAGGTGGGAAGG + Intronic
1035520495 8:272423-272445 AGGCACAAGGAAAGTCAGCACGG - Intergenic
1035522710 8:287862-287884 AGACAGAAGGAAAGTCAGAAAGG + Intergenic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1036051586 8:5205415-5205437 AGAAAGAAGGAGAGGAAGGAAGG + Intergenic
1036488327 8:9200101-9200123 AGGCAGAAGAAAAGACAGCAAGG + Intergenic
1036708445 8:11061796-11061818 GGGCTGAAGAAGAGGCAGGAGGG + Intronic
1036711521 8:11082528-11082550 AGTCAGAAGGACAGACAAGACGG - Intronic
1037053796 8:14410217-14410239 AGGCAGAAGGAAAGGGAGGAGGG - Intronic
1037193424 8:16155768-16155790 AGGCATGAGGAAAGGCAGGAAGG + Intronic
1037648576 8:20816245-20816267 AGGCAGAGGGAGTGTGAGGGAGG - Intergenic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1037882835 8:22581246-22581268 AGGCAGAGGGACATGCAGGAGGG + Intronic
1038012464 8:23486046-23486068 AGGGAGAAAGAGAGTCAGGGAGG - Intergenic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038269862 8:26066342-26066364 AGGCATCAGGAGAGAGAGGAAGG - Intergenic
1038406489 8:27326116-27326138 TGGCTGCAGGAGAGTCAGGGTGG - Intronic
1038656715 8:29459469-29459491 AAACAGAAGGAGAGTCAGCTGGG + Intergenic
1038707521 8:29908767-29908789 AGGGAGAGAGAGAGACAGGAAGG + Intergenic
1039091599 8:33835539-33835561 AGGCTGAAGGAGAGGCAGGAAGG + Intergenic
1039198018 8:35053992-35054014 AGAAAGAAAGAGAGACAGGAAGG - Intergenic
1039412691 8:37368535-37368557 AGGAAGAATGAGAGGGAGGAAGG + Intergenic
1039488053 8:37927220-37927242 AGGCTGAGGGAGAATCAGGCAGG - Intergenic
1039706034 8:40008382-40008404 AGGCAGAAGGAGAGGTGAGAAGG - Intronic
1039772405 8:40700717-40700739 AGCCAGAAGGAGTTTCAGGCTGG - Intronic
1039830365 8:41208754-41208776 AGGAAGAAGGAGAGCAAGGGAGG + Intergenic
1039835209 8:41250329-41250351 AGGCAGAAGGGGAGAAATGAAGG + Intergenic
1039845195 8:41321022-41321044 AGGCTGAAGGTGAGGAAGGAGGG - Intergenic
1039963761 8:42269503-42269525 AGGAAGGAGGAGAGATAGGAAGG + Intergenic
1040063626 8:43126395-43126417 AGGCAGGAGGAGCAACAGGAGGG - Intergenic
1040483640 8:47850205-47850227 AGGAAGGAGGTGAGCCAGGAAGG - Intronic
1040801678 8:51349226-51349248 AGGCAGGAGCAGCGTCAGGGTGG - Intronic
1041830885 8:62151944-62151966 AGGGTGCAGGAGGGTCAGGAAGG - Intergenic
1042166301 8:65949110-65949132 AGGAAGGAGGAGAGTCTGAAGGG - Intergenic
1042189044 8:66167052-66167074 AGGCAGACAGAGAGGCAGGTTGG - Intronic
1042552353 8:70005213-70005235 AGGAAGAAAGAGAGAGAGGAAGG + Intergenic
1043499635 8:80839786-80839808 AGGCAGGAAGACAGGCAGGAAGG - Intronic
1045174018 8:99700738-99700760 GGGCAGAAGGATTGTGAGGAGGG + Intronic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1046389401 8:113549350-113549372 AGGAAGGAAGAGAGGCAGGAAGG - Intergenic
1046494774 8:114999005-114999027 AGGAAGAAGGAGAGGAAGGGAGG - Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046686339 8:117231733-117231755 GGGCAGAAGAAGCTTCAGGAAGG + Intergenic
1046756936 8:117981883-117981905 AGGCAGAAAGAAAGAAAGGAGGG + Intronic
1046949639 8:120007555-120007577 TGACAGAAGGAGACACAGGAAGG - Intronic
1047539847 8:125754184-125754206 AGCCAGAGGAAGAGGCAGGAGGG - Intergenic
1047741759 8:127812201-127812223 AGGAAGGAGGAAAGGCAGGAAGG + Intergenic
1048070253 8:131013324-131013346 GGGCAGAAGGAGAGCAGGGAGGG + Intronic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1048901919 8:139046998-139047020 AGGCAGGAAGACAGGCAGGAAGG - Intergenic
1048938572 8:139377225-139377247 AGGCTGGATGAGAGTGAGGAGGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049072657 8:140368736-140368758 TAGCAGGAGGAGAGTCAGGCGGG - Intronic
1049154639 8:141059281-141059303 TGGGAGAAGGGAAGTCAGGAGGG + Intergenic
1049200264 8:141336674-141336696 AGGGAGGAGGAGAGACAGGCAGG - Intergenic
1049306482 8:141906894-141906916 AGGCCGAAGGTGGGTCTGGAGGG - Intergenic
1049469248 8:142768164-142768186 AGGGAGGAGGAGAGGAAGGAAGG + Intronic
1050839584 9:10131131-10131153 AGGAATAAAGAGAGTGAGGATGG + Intronic
1051140562 9:13974695-13974717 AGGAAGAAGGGGGGTCAAGAGGG - Intergenic
1051317665 9:15859586-15859608 AGGCAGAAAGAGAGGAAGGGAGG - Intronic
1051871354 9:21741216-21741238 TGGCATAATGAGTGTCAGGAAGG + Intergenic
1052053347 9:23874732-23874754 AGGCAGCAGGAGAGAGAGAAGGG - Intergenic
1052341598 9:27369397-27369419 AGGCAGGAGGTGAGCTAGGAAGG - Intronic
1053008389 9:34619583-34619605 AGGTAGAAGGAAAACCAGGAGGG + Intronic
1053161849 9:35818825-35818847 AGTCAGAAGGCCAGGCAGGAAGG - Intronic
1053297100 9:36922933-36922955 AGGCAGAATCTGAGTCAAGAAGG - Intronic
1053321793 9:37105230-37105252 AGGCAAAAAGGGAGGCAGGAAGG - Intergenic
1054852529 9:69863208-69863230 GGGCAGAGTGAGAGTCAAGAAGG + Intronic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055606767 9:77978427-77978449 AGGCAGGAAAAGAGGCAGGAGGG - Intronic
1056285093 9:85079547-85079569 AGGCAGTAGGGGAGGGAGGATGG - Intergenic
1056379663 9:86045819-86045841 AGGGAAAAGGACAGTCATGAGGG + Intronic
1056463057 9:86826647-86826669 GGGCAGAAGAAGAGAGAGGAAGG - Intergenic
1056617038 9:88177650-88177672 AGCCAGAAGGGAAGTTAGGAGGG + Intergenic
1056766554 9:89447754-89447776 GGGCTGAGGCAGAGTCAGGAAGG - Intronic
1056842205 9:90007423-90007445 AAGCAGAAGGAAAATCAGGCAGG - Intergenic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1057181550 9:93033364-93033386 AGGCGGAGGGAGAGGAAGGAGGG - Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057439523 9:95072970-95072992 AGGCAGAAGTGGAGTCTGGCTGG + Intronic
1057903346 9:98966090-98966112 TCCCAGAAGAAGAGTCAGGAGGG - Intronic
1058388029 9:104461470-104461492 AGGAAGGAAGAGAGGCAGGAAGG + Intergenic
1058863894 9:109144126-109144148 AGGCAGCAGGAGAAACAGCAGGG - Intronic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059694317 9:116716237-116716259 AGGAAGACGGAGAGTGGGGATGG + Intronic
1059743039 9:117171681-117171703 AGGCAGTAGGAGAGAGAAGAAGG - Intronic
1059889370 9:118784441-118784463 GGACAGAAGTAGAGTCAGGGAGG + Intergenic
1059948498 9:119437768-119437790 AGGCAGAAGAAAACTAAGGATGG - Intergenic
1060010671 9:120040612-120040634 AGGCATAAGGAAAGTGAGGCTGG - Intergenic
1060278284 9:122198526-122198548 AGGAAGGTGGAGAGGCAGGAAGG + Intronic
1060396134 9:123318294-123318316 AGGCAGAGGGAGATTTAGGGAGG - Intergenic
1060437613 9:123607870-123607892 AGGCAGGAGGAGAGGCAAGCGGG + Intronic
1060484004 9:124035743-124035765 AGGCAGAGAGAGAGGCAGAAAGG + Intergenic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1061524703 9:131149777-131149799 GGGCAGGGGTAGAGTCAGGAAGG - Intronic
1061590826 9:131596546-131596568 AAGCACAAGGTGAGTCTGGAGGG - Intronic
1061698412 9:132395821-132395843 GGACAGAAGGAGAAGCAGGAAGG - Intronic
1061743961 9:132726294-132726316 AGGAAGAAGAAGAGAAAGGAAGG - Intronic
1061777946 9:132978221-132978243 AGGAAGAAGGAAAATAAGGAAGG + Intronic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1062033426 9:134372219-134372241 AGGGAGAGGGAGAGCCAGGTAGG + Intronic
1062097950 9:134712377-134712399 AGGGATAACGAGAGACAGGAAGG - Intronic
1062122177 9:134839684-134839706 AGGCCGGAGGAGAGGCAGGCAGG + Intronic
1062276223 9:135732803-135732825 AGGAAGAAGGAAAGGAAGGAAGG - Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062721102 9:138044629-138044651 AGGCAGAGGGAGAGGCAGACAGG + Intronic
1185449548 X:275191-275213 AGGAAGAAGGAGGGAGAGGATGG + Intergenic
1185456574 X:313778-313800 AGGCAGAAGGAGCCCCTGGAGGG + Intronic
1185463150 X:341518-341540 AGGCAGGAGGAGGGGCAGGAGGG - Intronic
1185683942 X:1911475-1911497 AGGGAGGAAGAGAGACAGGAAGG - Intergenic
1185772190 X:2773278-2773300 AGGAAGAAGGAGAGGAATGAAGG + Intronic
1185972595 X:4681867-4681889 AGGAAGAAGGAGAGGAGGGAAGG + Intergenic
1185979569 X:4761830-4761852 AGGCAGAGAGAGAGAAAGGAGGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186201054 X:7155296-7155318 AGGCAGAATGTAAGTCAGAATGG - Intergenic
1186250489 X:7660588-7660610 AGACAAGAGGAGGGTCAGGAAGG + Intergenic
1186269205 X:7866541-7866563 AGGAAGAAAGACAGTCAGGCAGG - Intergenic
1186342321 X:8657833-8657855 AGGAAGAAGGGGAGTGAGGCAGG + Intronic
1186808942 X:13167954-13167976 ATGCAGAAGGACATTCAGAACGG - Intergenic
1187599764 X:20815056-20815078 AGGCAGAAATAGGGTCAGAAAGG + Intergenic
1187740551 X:22350774-22350796 AGGCAGAAGGTGAGGCACAATGG - Intergenic
1187793618 X:22977717-22977739 AGGCAGAAAGAAAGGCAGGCAGG + Intergenic
1187829960 X:23370996-23371018 GGGGAGGAGGAGAGGCAGGAGGG + Intronic
1188138247 X:26516343-26516365 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189237833 X:39501872-39501894 AGGCAGAAGGGGAGTGTGGTGGG + Intergenic
1190165218 X:48068090-48068112 AGGCAGGAGGGAAGGCAGGAAGG + Intronic
1190506841 X:51134905-51134927 AGTCAGAAGGGAAGTCAGTAGGG + Intergenic
1190642270 X:52492375-52492397 AGGCAGGAAGGGAGGCAGGAAGG - Intergenic
1190645403 X:52520492-52520514 AGGCAGGAAGGGAGGCAGGAAGG + Intronic
1190711290 X:53072579-53072601 AGACAGACGGAGACACAGGAGGG - Intronic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1190902069 X:54685540-54685562 AGGAAGAAGGAAAGAAAGGAAGG - Intergenic
1191731373 X:64339285-64339307 AGGTAAAAAGAGAGCCAGGAGGG + Intronic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192495506 X:71614353-71614375 AGGCAGCAGGGGAGTCAGAGAGG - Intergenic
1192499268 X:71638653-71638675 AGGCTGAATGAGAGTCAAGATGG - Intergenic
1193158568 X:78202131-78202153 AGGCAGAAAGAAATTCTGGAAGG + Intergenic
1193206879 X:78759717-78759739 TGACTGAAGGAGGGTCAGGATGG + Intergenic
1193245442 X:79223344-79223366 AGAAAGAAGGAAAGACAGGAAGG + Intergenic
1193448037 X:81629295-81629317 AGAAAGAAAGAGAGTGAGGAAGG - Intergenic
1193482887 X:82048868-82048890 AGGCAGAATGAGTGCCAGCAGGG - Intergenic
1196428966 X:115601927-115601949 AGGGAGAAGGAAAGTCAGTGAGG - Intronic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1196906754 X:120444541-120444563 CGGCTGGAGGAGAGTCAGGAAGG - Intronic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197974384 X:132150615-132150637 AGACAGAAGGAGAGGCGAGATGG + Intergenic
1198338035 X:135687697-135687719 AAGCAGAAGGAGAGGAATGATGG + Intergenic
1198421408 X:136473216-136473238 AGGGAGAGAGAGAGGCAGGAAGG + Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199745891 X:150771768-150771790 AAGCAAAAGGAAAGTGAGGAAGG + Intronic