ID: 1085633948

View in Genome Browser
Species Human (GRCh38)
Location 11:78143460-78143482
Sequence AGGTGCTGCAGAGAAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085633946_1085633948 -2 Left 1085633946 11:78143439-78143461 CCAAAGAATAAGGCTTTAATCAG No data
Right 1085633948 11:78143460-78143482 AGGTGCTGCAGAGAAACAGATGG No data
1085633944_1085633948 20 Left 1085633944 11:78143417-78143439 CCAATCACTGAGATGATTATTGC No data
Right 1085633948 11:78143460-78143482 AGGTGCTGCAGAGAAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085633948 Original CRISPR AGGTGCTGCAGAGAAACAGA TGG Intergenic
No off target data available for this crispr