ID: 1085637400

View in Genome Browser
Species Human (GRCh38)
Location 11:78169208-78169230
Sequence GGGCTCTGGGCTGATGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085637400_1085637414 0 Left 1085637400 11:78169208-78169230 CCACCCCCATCAGCCCAGAGCCC No data
Right 1085637414 11:78169231-78169253 CCTGGGACACAGGCAGACGTAGG No data
1085637400_1085637408 -10 Left 1085637400 11:78169208-78169230 CCACCCCCATCAGCCCAGAGCCC No data
Right 1085637408 11:78169221-78169243 CCCAGAGCCCCCTGGGACACAGG No data
1085637400_1085637416 29 Left 1085637400 11:78169208-78169230 CCACCCCCATCAGCCCAGAGCCC No data
Right 1085637416 11:78169260-78169282 GTTTGGAGAGACTGCAATTCAGG No data
1085637400_1085637415 12 Left 1085637400 11:78169208-78169230 CCACCCCCATCAGCCCAGAGCCC No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085637400 Original CRISPR GGGCTCTGGGCTGATGGGGG TGG (reversed) Intergenic