ID: 1085637403

View in Genome Browser
Species Human (GRCh38)
Location 11:78169213-78169235
Sequence CCAGGGGGCTCTGGGCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085637403_1085637414 -5 Left 1085637403 11:78169213-78169235 CCCATCAGCCCAGAGCCCCCTGG No data
Right 1085637414 11:78169231-78169253 CCTGGGACACAGGCAGACGTAGG No data
1085637403_1085637418 30 Left 1085637403 11:78169213-78169235 CCCATCAGCCCAGAGCCCCCTGG No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637403_1085637417 29 Left 1085637403 11:78169213-78169235 CCCATCAGCCCAGAGCCCCCTGG No data
Right 1085637417 11:78169265-78169287 GAGAGACTGCAATTCAGGAAAGG No data
1085637403_1085637416 24 Left 1085637403 11:78169213-78169235 CCCATCAGCCCAGAGCCCCCTGG No data
Right 1085637416 11:78169260-78169282 GTTTGGAGAGACTGCAATTCAGG No data
1085637403_1085637415 7 Left 1085637403 11:78169213-78169235 CCCATCAGCCCAGAGCCCCCTGG No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085637403 Original CRISPR CCAGGGGGCTCTGGGCTGAT GGG (reversed) Intergenic