ID: 1085637410

View in Genome Browser
Species Human (GRCh38)
Location 11:78169228-78169250
Sequence ACGTCTGCCTGTGTCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085637410_1085637416 9 Left 1085637410 11:78169228-78169250 CCCCCTGGGACACAGGCAGACGT No data
Right 1085637416 11:78169260-78169282 GTTTGGAGAGACTGCAATTCAGG No data
1085637410_1085637418 15 Left 1085637410 11:78169228-78169250 CCCCCTGGGACACAGGCAGACGT No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637410_1085637417 14 Left 1085637410 11:78169228-78169250 CCCCCTGGGACACAGGCAGACGT No data
Right 1085637417 11:78169265-78169287 GAGAGACTGCAATTCAGGAAAGG No data
1085637410_1085637415 -8 Left 1085637410 11:78169228-78169250 CCCCCTGGGACACAGGCAGACGT No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637410_1085637419 20 Left 1085637410 11:78169228-78169250 CCCCCTGGGACACAGGCAGACGT No data
Right 1085637419 11:78169271-78169293 CTGCAATTCAGGAAAGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085637410 Original CRISPR ACGTCTGCCTGTGTCCCAGG GGG (reversed) Intergenic