ID: 1085637413

View in Genome Browser
Species Human (GRCh38)
Location 11:78169231-78169253
Sequence CCTACGTCTGCCTGTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085637413_1085637418 12 Left 1085637413 11:78169231-78169253 CCTGGGACACAGGCAGACGTAGG No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637413_1085637419 17 Left 1085637413 11:78169231-78169253 CCTGGGACACAGGCAGACGTAGG No data
Right 1085637419 11:78169271-78169293 CTGCAATTCAGGAAAGGGATAGG No data
1085637413_1085637417 11 Left 1085637413 11:78169231-78169253 CCTGGGACACAGGCAGACGTAGG No data
Right 1085637417 11:78169265-78169287 GAGAGACTGCAATTCAGGAAAGG No data
1085637413_1085637416 6 Left 1085637413 11:78169231-78169253 CCTGGGACACAGGCAGACGTAGG No data
Right 1085637416 11:78169260-78169282 GTTTGGAGAGACTGCAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085637413 Original CRISPR CCTACGTCTGCCTGTGTCCC AGG (reversed) Intergenic