ID: 1085637415

View in Genome Browser
Species Human (GRCh38)
Location 11:78169243-78169265
Sequence GCAGACGTAGGCAGTCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085637398_1085637415 20 Left 1085637398 11:78169200-78169222 CCAGCCAGCCACCCCCATCAGCC No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637400_1085637415 12 Left 1085637400 11:78169208-78169230 CCACCCCCATCAGCCCAGAGCCC No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637409_1085637415 -2 Left 1085637409 11:78169222-78169244 CCAGAGCCCCCTGGGACACAGGC No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637402_1085637415 8 Left 1085637402 11:78169212-78169234 CCCCATCAGCCCAGAGCCCCCTG No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637407_1085637415 -1 Left 1085637407 11:78169221-78169243 CCCAGAGCCCCCTGGGACACAGG No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637412_1085637415 -10 Left 1085637412 11:78169230-78169252 CCCTGGGACACAGGCAGACGTAG No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637396_1085637415 29 Left 1085637396 11:78169191-78169213 CCACGTTTCCCAGCCAGCCACCC No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637405_1085637415 6 Left 1085637405 11:78169214-78169236 CCATCAGCCCAGAGCCCCCTGGG No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637403_1085637415 7 Left 1085637403 11:78169213-78169235 CCCATCAGCCCAGAGCCCCCTGG No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637397_1085637415 21 Left 1085637397 11:78169199-78169221 CCCAGCCAGCCACCCCCATCAGC No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637411_1085637415 -9 Left 1085637411 11:78169229-78169251 CCCCTGGGACACAGGCAGACGTA No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637410_1085637415 -8 Left 1085637410 11:78169228-78169250 CCCCCTGGGACACAGGCAGACGT No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637401_1085637415 9 Left 1085637401 11:78169211-78169233 CCCCCATCAGCCCAGAGCCCCCT No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data
1085637399_1085637415 16 Left 1085637399 11:78169204-78169226 CCAGCCACCCCCATCAGCCCAGA No data
Right 1085637415 11:78169243-78169265 GCAGACGTAGGCAGTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085637415 Original CRISPR GCAGACGTAGGCAGTCAGTT TGG Intergenic