ID: 1085637418

View in Genome Browser
Species Human (GRCh38)
Location 11:78169266-78169288
Sequence AGAGACTGCAATTCAGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085637403_1085637418 30 Left 1085637403 11:78169213-78169235 CCCATCAGCCCAGAGCCCCCTGG No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637412_1085637418 13 Left 1085637412 11:78169230-78169252 CCCTGGGACACAGGCAGACGTAG No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637411_1085637418 14 Left 1085637411 11:78169229-78169251 CCCCTGGGACACAGGCAGACGTA No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637413_1085637418 12 Left 1085637413 11:78169231-78169253 CCTGGGACACAGGCAGACGTAGG No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637407_1085637418 22 Left 1085637407 11:78169221-78169243 CCCAGAGCCCCCTGGGACACAGG No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637410_1085637418 15 Left 1085637410 11:78169228-78169250 CCCCCTGGGACACAGGCAGACGT No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637405_1085637418 29 Left 1085637405 11:78169214-78169236 CCATCAGCCCAGAGCCCCCTGGG No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data
1085637409_1085637418 21 Left 1085637409 11:78169222-78169244 CCAGAGCCCCCTGGGACACAGGC No data
Right 1085637418 11:78169266-78169288 AGAGACTGCAATTCAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085637418 Original CRISPR AGAGACTGCAATTCAGGAAA GGG Intergenic