ID: 1085637419

View in Genome Browser
Species Human (GRCh38)
Location 11:78169271-78169293
Sequence CTGCAATTCAGGAAAGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085637411_1085637419 19 Left 1085637411 11:78169229-78169251 CCCCTGGGACACAGGCAGACGTA No data
Right 1085637419 11:78169271-78169293 CTGCAATTCAGGAAAGGGATAGG No data
1085637407_1085637419 27 Left 1085637407 11:78169221-78169243 CCCAGAGCCCCCTGGGACACAGG No data
Right 1085637419 11:78169271-78169293 CTGCAATTCAGGAAAGGGATAGG No data
1085637412_1085637419 18 Left 1085637412 11:78169230-78169252 CCCTGGGACACAGGCAGACGTAG No data
Right 1085637419 11:78169271-78169293 CTGCAATTCAGGAAAGGGATAGG No data
1085637410_1085637419 20 Left 1085637410 11:78169228-78169250 CCCCCTGGGACACAGGCAGACGT No data
Right 1085637419 11:78169271-78169293 CTGCAATTCAGGAAAGGGATAGG No data
1085637413_1085637419 17 Left 1085637413 11:78169231-78169253 CCTGGGACACAGGCAGACGTAGG No data
Right 1085637419 11:78169271-78169293 CTGCAATTCAGGAAAGGGATAGG No data
1085637409_1085637419 26 Left 1085637409 11:78169222-78169244 CCAGAGCCCCCTGGGACACAGGC No data
Right 1085637419 11:78169271-78169293 CTGCAATTCAGGAAAGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085637419 Original CRISPR CTGCAATTCAGGAAAGGGAT AGG Intergenic