ID: 1085639044

View in Genome Browser
Species Human (GRCh38)
Location 11:78179750-78179772
Sequence GGTCTAGGGACAGCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085639044_1085639055 22 Left 1085639044 11:78179750-78179772 CCTGCCTTTGCTGTCCCTAGACC 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1085639055 11:78179795-78179817 CTCTCTGCTGTCTACCTTTCAGG 0: 1
1: 0
2: 0
3: 33
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085639044 Original CRISPR GGTCTAGGGACAGCAAAGGC AGG (reversed) Intronic
900106553 1:983930-983952 GGGCTTGGGACAGGAGAGGCAGG + Intergenic
900869629 1:5292842-5292864 GGTCCAGGGACATCAAATTCAGG - Intergenic
901230061 1:7636783-7636805 GGTCTAGGGAGGGCACAAGCAGG + Intronic
901865989 1:12107026-12107048 GGTCCAGGGGCAGCAAAGGGAGG - Intronic
905730898 1:40299030-40299052 GTTAGAGGGACAGCATAGGCTGG + Intergenic
906344719 1:45008004-45008026 GGGCTATTGACAGCACAGGCAGG - Intronic
906796709 1:48702121-48702143 GGTTTAGGGACAGGACATGCAGG - Intronic
908176191 1:61557433-61557455 GGTTTAGAGAGAGCAAAGGGAGG - Intergenic
914928587 1:151909666-151909688 GGTCTTCGGAAAGAAAAGGCCGG - Exonic
915080482 1:153348666-153348688 GGGCTAGGGAGAGTGAAGGCTGG - Intronic
918703807 1:187637284-187637306 GGCCTAGGGTCAGCAGAGGTAGG - Intergenic
920301702 1:204992828-204992850 AGTAGAGGGACAGCACAGGCCGG - Intronic
922621906 1:226995064-226995086 GGTCTGGGGCCTGCAAAGGATGG - Intronic
922819269 1:228472787-228472809 GGGATAGGGGTAGCAAAGGCTGG - Intergenic
923273874 1:232380080-232380102 GGTGTGGGGACAGGAAAGGCTGG + Intergenic
924345965 1:243073465-243073487 GGTATGGGGACAGCTGAGGCGGG - Intergenic
1064160438 10:12940878-12940900 TGTCCAGGGACAGGAAAGGGAGG + Intronic
1066688988 10:38008162-38008184 TGTCTGTGCACAGCAAAGGCAGG - Intergenic
1067699529 10:48558824-48558846 AGTCTAGGGACACTAAAGGAAGG + Intronic
1067761911 10:49054793-49054815 GGCCCAGGGACATTAAAGGCAGG - Intronic
1067807450 10:49403032-49403054 GGACTGGGAACAGCAGAGGCAGG + Intergenic
1069798691 10:71069250-71069272 GGTTTAGGGAGTGCAAAGGGAGG - Intergenic
1069925230 10:71845568-71845590 GGCCTGGGGACAGCAGTGGCAGG + Intronic
1070153882 10:73821591-73821613 GTTCTGGGGACAGAAAAGGCAGG + Intronic
1070567595 10:77615445-77615467 GGTGTAGGGGCAGAACAGGCAGG + Intronic
1070930375 10:80256729-80256751 GGTGAGGGGACAGCAAAGGCAGG + Intergenic
1071499005 10:86190383-86190405 GGCCCAGGGGCAGCAAAGGGAGG - Intronic
1073070187 10:100788391-100788413 GGGCTGGGGTCAGTAAAGGCAGG + Intronic
1075031749 10:119029151-119029173 GGCCTAGGGCCATTAAAGGCTGG + Intergenic
1075713133 10:124541451-124541473 GGTCTGGGGCTAGCAGAGGCTGG - Intronic
1076013094 10:127006273-127006295 GGCCCAGGGCCAGCACAGGCAGG - Intronic
1077153723 11:1082419-1082441 GGGCTGGGCACAGCAGAGGCTGG + Intergenic
1077336874 11:2009267-2009289 GCTGTAGGGTCAGCAGAGGCTGG - Intergenic
1077846074 11:6026314-6026336 GGTCAAAGGAAAGCAAAGGCTGG + Intergenic
1078896096 11:15598488-15598510 GGTCTAGAGACAGGAAAGCAAGG + Intergenic
1081247090 11:40780859-40780881 GGTCTAGGGAGTGGAAAGGGAGG + Intronic
1083454886 11:62771916-62771938 GGTCTAGGGTCACCAAGGGGTGG + Intronic
1083768580 11:64854011-64854033 GCTCCAGCCACAGCAAAGGCCGG + Exonic
1084286697 11:68136193-68136215 GATCTAAGGACCCCAAAGGCAGG - Intergenic
1084445696 11:69202344-69202366 GGACCAGGGACACCAGAGGCAGG - Intergenic
1084482535 11:69430203-69430225 GGTCTCGGGACAGCACAGCAAGG - Intergenic
1085639044 11:78179750-78179772 GGTCTAGGGACAGCAAAGGCAGG - Intronic
1085711693 11:78834888-78834910 CCTCCAGGTACAGCAAAGGCAGG - Intronic
1089180864 11:116581976-116581998 AGTCTGGGGACAGCAAACCCAGG - Intergenic
1090443076 11:126740446-126740468 GACCTAGTGACACCAAAGGCTGG - Intronic
1090650688 11:128803419-128803441 GGTCTAGAGACAGCCATGGGAGG - Intronic
1091145314 11:133274399-133274421 GGTCCTGGGACAACAGAGGCAGG + Intronic
1091164716 11:133464962-133464984 GGGCTAGACACAGTAAAGGCTGG + Intronic
1091348035 11:134868419-134868441 GGTGTGGGGACAGGAGAGGCAGG + Intergenic
1202819858 11_KI270721v1_random:64449-64471 GCTGTAGGGTCAGCAGAGGCTGG - Intergenic
1094088566 12:26622299-26622321 GGGCTCCAGACAGCAAAGGCGGG + Exonic
1099336884 12:81372868-81372890 GGTTCAGGGACAGTAAAGGGAGG + Intronic
1102452556 12:113052728-113052750 GGTCTAGGTACAGGAGAGTCTGG - Intergenic
1104544059 12:129695218-129695240 GATCCAGGGACAGCCAAGGGGGG + Intronic
1106431790 13:29687824-29687846 GCTCCAGGGCCAGCAAAAGCAGG + Intergenic
1108499219 13:51054132-51054154 GGTCGAGGGAGATCAAACGCTGG + Intergenic
1108503812 13:51091481-51091503 GGTCAAGGGGCAGGGAAGGCAGG - Intergenic
1110705737 13:78601231-78601253 GGCTAGGGGACAGCAAAGGCAGG + Exonic
1113142500 13:107169878-107169900 GGGCGAGGGAAAGGAAAGGCCGG + Exonic
1113498703 13:110755662-110755684 TGTCTAGGAAGAGCAAAGACAGG - Intergenic
1113712594 13:112478323-112478345 GGTTAAATGACAGCAAAGGCTGG + Intergenic
1114240020 14:20858149-20858171 GGTCTCTGGATAGAAAAGGCTGG - Intergenic
1115201142 14:30855640-30855662 GGACAAGGGACAGCCAAGGCAGG - Intergenic
1117515162 14:56493348-56493370 CCTCTAAGCACAGCAAAGGCTGG - Intronic
1119475114 14:74922734-74922756 GGACCTGGGAGAGCAAAGGCGGG - Intronic
1121278183 14:92681710-92681732 GGACTTGGGGCAGCAAGGGCTGG + Intronic
1122770370 14:104095103-104095125 GGTCAAGGCACAGCCATGGCCGG - Intronic
1124373213 15:29115155-29115177 GGTCTGGGGACAGCAGCAGCAGG + Intronic
1127676472 15:61243988-61244010 GTTCTAGGGACAGAAAAACCTGG + Intergenic
1129244145 15:74269578-74269600 GGCCTGGGGACAGCAAGGCCAGG - Intronic
1129909353 15:79213192-79213214 GAGCAAGGGACAGCAAAGCCAGG + Intergenic
1131968195 15:97867397-97867419 AGTCTGGGGACAGGAAAGGCTGG - Intergenic
1135721315 16:24820874-24820896 GGTGTGGAGACAGCACAGGCAGG - Intronic
1139375679 16:66495052-66495074 GTTTCAGGGAGAGCAAAGGCAGG - Intronic
1141412564 16:83845435-83845457 GGCCTAGGGCCAGCAAAGGCAGG - Intergenic
1143162616 17:4881377-4881399 GGTCCAGGGACAGGGGAGGCTGG - Intronic
1147911641 17:43859585-43859607 GGTCCAGGGTCAGCAGTGGCTGG + Intronic
1149063206 17:52448667-52448689 GATCTAGGGGCAGCCAAGGAGGG - Intergenic
1149339851 17:55674123-55674145 GGAAGAGTGACAGCAAAGGCAGG - Intergenic
1150329567 17:64284008-64284030 GATTTAGGGACAGCCAAGGCTGG + Intergenic
1152376815 17:79922815-79922837 GGGCCTGGGAGAGCAAAGGCTGG - Intergenic
1159743806 18:72207637-72207659 GCTCTAGGGACAGCACAGTGAGG - Intergenic
1160527436 18:79545863-79545885 GAACTAGTGACAGCAAAGGGAGG + Intergenic
1161452466 19:4354183-4354205 GGTCTTGGGGTAGCAAGGGCAGG + Intronic
1161794085 19:6376415-6376437 GGCCTGGGGACAGCCAAGGGTGG + Intronic
1163560737 19:18017899-18017921 GGCCTAGGGAGCCCAAAGGCAGG + Intergenic
1166001454 19:39879890-39879912 GGTCTGGGGACAGAAGAGGGAGG + Exonic
1166004237 19:39896141-39896163 GGTCTGGGGACAGAAGAGGGAGG + Exonic
1168405336 19:56107661-56107683 GGCCTAGGGGCAGAAAAGGGAGG + Intronic
1168702651 19:58450946-58450968 GGTCTAAGGACAAGCAAGGCTGG + Intergenic
925025348 2:602696-602718 GTTCAAAGAACAGCAAAGGCTGG + Intergenic
925718992 2:6810254-6810276 GGCCATTGGACAGCAAAGGCAGG - Intergenic
926055825 2:9773395-9773417 GGTCTGGGGACAGCCAAGTGGGG - Intergenic
928512076 2:32011032-32011054 GGTTTAGCGGCAGCAGAGGCTGG + Intronic
929389360 2:41451397-41451419 GGTCCAGGCAAAGCAAAAGCAGG + Intergenic
930266550 2:49206927-49206949 GGTTTAGTGACAGCCAAGGATGG + Intergenic
930659411 2:54039056-54039078 GTTCAAGGAACAGCAAAGGGTGG + Intronic
932623660 2:73282350-73282372 GATCTAGGGAATTCAAAGGCAGG + Intronic
934541135 2:95176042-95176064 GGTCTAAGTAAAGCAAAGCCAGG - Intronic
937040217 2:118814992-118815014 GGTCTGGGGACATCAAGGGTAGG - Intergenic
939513155 2:143132306-143132328 AGTCTAAGGATAGCAAAGTCAGG + Intronic
941573066 2:167195751-167195773 GGTATAGGGACAAGAAAGGTTGG + Intronic
941921095 2:170851584-170851606 GCTCTAGGGAGAGCAGAGGCAGG + Intronic
942121305 2:172780350-172780372 TGTCTAGGGACAGCAAATTGTGG + Intronic
944334847 2:198520366-198520388 GGACTATGGACACCAAAAGCAGG - Intronic
946286758 2:218710039-218710061 GGTCTACGGACATCTGAGGCAGG + Intergenic
946520458 2:220458742-220458764 GATCAAGGGAGGGCAAAGGCAGG - Intergenic
947968197 2:234300007-234300029 AGTCGAGGGACATCAAATGCTGG - Intergenic
948614521 2:239190112-239190134 GGCCCAGGGACAGCAAAGGGCGG - Intronic
1170032402 20:11956821-11956843 GTTCGTGGGACAGCAGAGGCAGG - Intergenic
1170533712 20:17319636-17319658 GGTCTAGGGCCAGTATGGGCAGG + Intronic
1171896894 20:30816075-30816097 GGTCAAGGGGGAGCAGAGGCGGG + Intergenic
1172073704 20:32277853-32277875 GCTCGCGGGACAGCAAAGCCAGG - Intronic
1173554792 20:43958443-43958465 GGTCCAGAGTGAGCAAAGGCTGG - Intronic
1174118087 20:48241692-48241714 GTTCTAGGGACACCTGAGGCTGG - Intergenic
1175806832 20:61834245-61834267 GGGCAAGGGGCAGCAAAGGAGGG - Intronic
1175891171 20:62316677-62316699 GCTCCAGGAACAGCAGAGGCTGG - Exonic
1176118597 20:63444145-63444167 GGTGGAGGGACAGCACAGTCTGG + Intronic
1176303909 21:5113678-5113700 GGTCTAGGCACAGGAGAGGAAGG + Intergenic
1178702216 21:34843585-34843607 AGTCAATGGACAGGAAAGGCTGG + Intronic
1179233732 21:39527324-39527346 GGGCTAGGATCAGCCAAGGCCGG - Intergenic
1179581831 21:42349225-42349247 AGTCTAGGGCTAGCATAGGCTGG - Intronic
1179853121 21:44148272-44148294 GGTCTAGGCACAGGAGAGGAAGG - Intergenic
1181639944 22:24191063-24191085 TCTCTAGAGACATCAAAGGCAGG + Intergenic
1183004976 22:34893741-34893763 GGTAAAGGGACAGAAAAGGATGG + Intergenic
1183303121 22:37068262-37068284 GGTCATGGCAAAGCAAAGGCTGG - Intronic
1184457884 22:44621790-44621812 GGGCTGGGGGCAGCAAAGCCGGG - Intergenic
1184922133 22:47613251-47613273 GCTCCAGGGACAGCCAGGGCTGG - Intergenic
1185216207 22:49601271-49601293 GGTCTGGGGGCAGCAGAGCCGGG + Intronic
951350534 3:21602071-21602093 GGTGAAGGGGGAGCAAAGGCAGG + Intronic
951509372 3:23484733-23484755 GGTGAAGGGGGAGCAAAGGCAGG + Intronic
955755712 3:62223123-62223145 AGTGTGGGGACAGCAAGGGCCGG + Intronic
960893512 3:122477267-122477289 GGGCTGGGGACAGGAAAGGCTGG + Intronic
963023934 3:140899963-140899985 GCTCTGAGGACAGCAAAGGAAGG + Intergenic
964474212 3:157084113-157084135 AATATAGGGTCAGCAAAGGCAGG + Intergenic
967251685 3:187546605-187546627 GGTGTAGGGGAAGCAAAGGAAGG - Intergenic
968600782 4:1508395-1508417 GGTTGAGGGGCAGCAGAGGCGGG + Intergenic
968979339 4:3838288-3838310 GGTCCAGTGACAGCAACTGCAGG - Intergenic
969153312 4:5188619-5188641 GGGTTAGGGACAGCCAAGGTAGG - Intronic
973096153 4:46202703-46202725 GGTGAAGGAAGAGCAAAGGCAGG + Intergenic
977138556 4:93337924-93337946 GGACTAGGGAAGGCAAAGGGTGG - Intronic
981843344 4:149137505-149137527 GGCCATGGGACAGCAAAGGTGGG + Intergenic
983775014 4:171595372-171595394 GGACTAGGAACAGCTACGGCTGG - Intergenic
985935490 5:3094390-3094412 GGCCGATGGCCAGCAAAGGCTGG - Intergenic
986646562 5:9921807-9921829 GGTCAAAGGGGAGCAAAGGCAGG - Intergenic
986720728 5:10559464-10559486 GGTCTGGGGTCAGCCAGGGCTGG - Intergenic
991006207 5:61830609-61830631 GGGCTAGGAACATAAAAGGCTGG - Intergenic
991975337 5:72179256-72179278 GGTCTGAGGGCAGCAAAAGCGGG - Intronic
992082972 5:73252558-73252580 GAACTAGGGACATGAAAGGCAGG - Intergenic
995230253 5:109753322-109753344 GGTCTATTGACAGTAAAGGTGGG + Intronic
999660819 5:153861025-153861047 GGGATAGGGACAGGAAGGGCAGG - Intergenic
1000148808 5:158480039-158480061 GGTAGAGGGAAAGTAAAGGCAGG - Intergenic
1004075606 6:12341724-12341746 GGTCTGGGGACAGAAATGGCAGG - Intergenic
1004714467 6:18204030-18204052 GGTCTAGGAGCAACAAAGACAGG + Intronic
1005149836 6:22736089-22736111 GCTCTAGTGACAGCATCGGCTGG - Intergenic
1006809460 6:36810573-36810595 GATCTGGGGACAGGAAAGGAGGG + Intronic
1009767965 6:68106584-68106606 GGTCCAGTGACAGCAAACACAGG + Intergenic
1012398445 6:98825290-98825312 TTCCTAGGGACAGCAAATGCGGG - Intergenic
1015906630 6:138123632-138123654 GGGATGGGGACAGCACAGGCAGG - Intergenic
1016938301 6:149464809-149464831 GGTCTAGGGACCAGAAAGACAGG + Intronic
1016944650 6:149518368-149518390 GGTTGAGGGATAGGAAAGGCAGG - Intronic
1017919424 6:158858228-158858250 GGCCTGGAGACAGCAGAGGCGGG - Intergenic
1018984928 6:168629133-168629155 ACTCCAGGAACAGCAAAGGCAGG - Intronic
1024752455 7:52483497-52483519 TGTACAGGGACAACAAAGGCCGG + Intergenic
1028281017 7:88927929-88927951 GGTTCAGGGACAGAAAATGCAGG - Intronic
1029464505 7:100716764-100716786 GGTCCTGGGAGAGCAGAGGCTGG + Intergenic
1030547411 7:110914095-110914117 GGTCCAGGAAGAGCAAAAGCAGG - Intronic
1030737129 7:113062559-113062581 GGTCCAGGCAAAGCAAAAGCAGG + Intergenic
1032018310 7:128393302-128393324 GGTGGAGGGACAGCTCAGGCAGG + Intronic
1032529172 7:132605881-132605903 GGTCAAGAAACACCAAAGGCCGG + Intronic
1032720562 7:134547755-134547777 GCTGAAGGGACAGCACAGGCTGG - Intergenic
1035534403 8:380053-380075 AGTCCAGGGACAGCACAGCCCGG - Intergenic
1038646162 8:29364382-29364404 GTTCTAGAGTCAGCCAAGGCTGG + Intergenic
1045027102 8:98098095-98098117 GGTCTCTGGACATCAAAGCCAGG + Intergenic
1045401254 8:101820763-101820785 GGTCAAGGGACAGCATATCCTGG - Intronic
1047438615 8:124856965-124856987 CGTCTGGGAACAGCAAAGTCTGG + Intergenic
1048791819 8:138111238-138111260 GGTGTAGGGAGAGAAATGGCAGG - Intergenic
1049066754 8:140322230-140322252 GGTCTGGGCACAGAAAAGACTGG - Intronic
1052827552 9:33187990-33188012 GCCCTAGGGACAGGAAAAGCAGG + Intergenic
1055521388 9:77084472-77084494 AGTCTGGTGACATCAAAGGCAGG - Intergenic
1057504181 9:95618895-95618917 GGTCTGGGCACAGCCAGGGCTGG + Intergenic
1059135110 9:111798153-111798175 TGTCTAGTTGCAGCAAAGGCTGG + Intergenic
1059901308 9:118929097-118929119 GAGCAAGGGAGAGCAAAGGCAGG + Intergenic
1060404283 9:123365588-123365610 GGTCTTGGGAAAGCAATAGCCGG - Intronic
1062183288 9:135202629-135202651 GGAATAGGGTCAGCCAAGGCAGG + Intergenic
1062296854 9:135835201-135835223 TGCCAAGGGACAGCAAAGGAGGG + Intronic
1062326106 9:136013299-136013321 GGTGGAGGGACCGGAAAGGCAGG + Intronic
1062394545 9:136347503-136347525 GGCGTAGGGACAGCAGAGACAGG + Intronic
1062539566 9:137035583-137035605 GGTCGAGGGGCAGCACAGGGTGG + Exonic
1185755189 X:2647666-2647688 GGAGTAGGGACCCCAAAGGCTGG + Intergenic
1186495607 X:10010712-10010734 GGTTTAGGGGCATCAAAGGAAGG - Intergenic
1186502443 X:10062519-10062541 GGTCTAGGGACAGAAGAAGTGGG + Intronic
1186548107 X:10472564-10472586 TGTCCAGGGACAGAAAAGACTGG - Intronic
1188113988 X:26222255-26222277 GGGCTAAGGTCAGCAAAGGAAGG + Intergenic
1196503803 X:116416798-116416820 GGTATAAGGACAGAAAAGGAAGG - Intergenic
1200146463 X:153928687-153928709 GGACTAGGGACAGTAAATGATGG + Intronic
1200695228 Y:6352651-6352673 GGTATAGGGAAAGCAGAAGCTGG + Intergenic
1201040049 Y:9822059-9822081 GGTATAGGGAAAGCAGAAGCTGG - Intergenic