ID: 1085640738

View in Genome Browser
Species Human (GRCh38)
Location 11:78191118-78191140
Sequence CAGCCCCACTGCCACGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 381}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085640738_1085640742 21 Left 1085640738 11:78191118-78191140 CCCAGGGCGTGGCAGTGGGGCTG 0: 1
1: 0
2: 4
3: 37
4: 381
Right 1085640742 11:78191162-78191184 CACATACACACACACACACAGGG 0: 18
1: 1885
2: 2273
3: 3370
4: 5959
1085640738_1085640743 29 Left 1085640738 11:78191118-78191140 CCCAGGGCGTGGCAGTGGGGCTG 0: 1
1: 0
2: 4
3: 37
4: 381
Right 1085640743 11:78191170-78191192 CACACACACACAGGGTGCTTTGG 0: 1
1: 0
2: 11
3: 108
4: 654
1085640738_1085640741 20 Left 1085640738 11:78191118-78191140 CCCAGGGCGTGGCAGTGGGGCTG 0: 1
1: 0
2: 4
3: 37
4: 381
Right 1085640741 11:78191161-78191183 ACACATACACACACACACACAGG 0: 23
1: 1617
2: 2898
3: 4547
4: 7775
1085640738_1085640744 30 Left 1085640738 11:78191118-78191140 CCCAGGGCGTGGCAGTGGGGCTG 0: 1
1: 0
2: 4
3: 37
4: 381
Right 1085640744 11:78191171-78191193 ACACACACACAGGGTGCTTTGGG 0: 1
1: 0
2: 3
3: 51
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085640738 Original CRISPR CAGCCCCACTGCCACGCCCT GGG (reversed) Intronic
900228451 1:1543767-1543789 CACCCCCTCTGTCACGGCCTCGG + Intronic
900431428 1:2604894-2604916 CAGCCCCACTGCTCCACCTTTGG + Intronic
900581707 1:3412814-3412836 CAGCCTCACTGGCTCTCCCTGGG + Intronic
900780454 1:4614379-4614401 CGTCCCCACTTCCACCCCCTTGG - Intergenic
901124145 1:6917464-6917486 CAGCTCCATTGCCACACTCTGGG - Intronic
901195273 1:7436769-7436791 CAGCCCCACTGCCGTTCCCAGGG - Intronic
901199673 1:7459571-7459593 GAGCCCCACAGCCCTGCCCTTGG + Intronic
903674304 1:25054693-25054715 CAGCTCCAGGGCCACGCCTTTGG - Intergenic
903681255 1:25098776-25098798 CAGCCCCTCTGCAGTGCCCTGGG + Intergenic
903928505 1:26848863-26848885 CAGACCCCCTGCCCAGCCCTGGG - Intronic
904288533 1:29469287-29469309 CAGCCCCACTGCCGTGACCCTGG - Intergenic
904541945 1:31239416-31239438 CAACCCCACCCGCACGCCCTGGG + Intronic
904614735 1:31743585-31743607 CAGCACCACTGGCATGGCCTAGG + Intronic
906214315 1:44030353-44030375 CCGCCCCACGGCCCCGCCCCCGG + Intronic
906674136 1:47681116-47681138 CAGGCCCCCTGCCCTGCCCTGGG + Intergenic
907366322 1:53963648-53963670 AAGCACTGCTGCCACGCCCTAGG - Intronic
907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG + Intronic
912800176 1:112715303-112715325 CTGCCTCCCTGCCCCGCCCTCGG + Exonic
912948142 1:114101756-114101778 CACCCCCACTGCTTCACCCTTGG + Intronic
915637332 1:157195833-157195855 CAGGCCCACAGCCACAACCTGGG - Intergenic
915912731 1:159924602-159924624 CACCCCCACGACCACACCCTGGG + Intronic
917924617 1:179778803-179778825 CAGCCCCACTACAAGCCCCTTGG - Intronic
918299079 1:183186021-183186043 CAGCCTCTGTGCCACACCCTTGG + Intergenic
918487494 1:185045320-185045342 CCGCGCCACCGCCCCGCCCTGGG - Intergenic
919499279 1:198315604-198315626 CATCTCCACTGCCACACTCTTGG - Intronic
921667301 1:217888205-217888227 CAGCCCCACTCCAAAGCCTTGGG + Intergenic
923062498 1:230488575-230488597 TGGCCCCACTGCCACCCACTAGG - Intergenic
923923858 1:238601245-238601267 CATCCCCACTTCCATGCCTTTGG - Intergenic
924787056 1:247208780-247208802 CATTCCCACAGCTACGCCCTGGG + Intergenic
1063142201 10:3265229-3265251 CACCCCCACTGCCACCCCTCAGG - Intergenic
1064176473 10:13079762-13079784 CATTCCCACTGCCACTCCCTAGG + Intronic
1067561910 10:47310243-47310265 CAGCGTCACTGCCACGCTGTTGG - Exonic
1068030590 10:51699828-51699850 CAGCCCCACTACGACACGCTTGG + Intronic
1069569503 10:69485814-69485836 CAGGCCCACTGCCTCCACCTTGG - Intronic
1072623195 10:97094230-97094252 CAGGGCCACTGCCAGGCCATAGG + Intronic
1072768406 10:98115353-98115375 CAGCCCGATTGCCACATCCTTGG - Intergenic
1073006238 10:100327204-100327226 CAGCCCCGCTGACACTCCCCAGG + Intronic
1075742583 10:124704892-124704914 CAGCCCCGCTGCCACCACCCTGG - Intronic
1076246018 10:128948578-128948600 CAGCCTCACAGCAAGGCCCTGGG + Intergenic
1076826944 10:132973915-132973937 CAGCCCCACAGGGACGCCCAAGG + Intergenic
1076839018 10:133036181-133036203 CAGCCCCCCTGCCCGCCCCTGGG - Intergenic
1076943324 10:133625186-133625208 CAGCCACACTGCCAGGTCCTGGG - Exonic
1077266336 11:1652627-1652649 TAACCCCACTGCCAGGCCCACGG - Intergenic
1077404460 11:2377045-2377067 CGGCCCTGCTGCCACCCCCTTGG + Intronic
1077603029 11:3586991-3587013 CATCCTCACTGCCACAGCCTTGG - Intergenic
1078568985 11:12441162-12441184 CAGCCCCACCTCCACCCCCAAGG - Intronic
1078645062 11:13134473-13134495 CACCTCCACTGCCACCACCTAGG + Intergenic
1079946334 11:26746524-26746546 AATCCCCACTGCCACTCCCAAGG - Intergenic
1080457022 11:32427446-32427468 CAGCGCCCCTGCTACGCTCTGGG - Intronic
1080641613 11:34161672-34161694 CAGCCCCACTGACACATGCTGGG - Intronic
1080715931 11:34799877-34799899 CAGCCCCAGTGCTAGGCCCTTGG + Intergenic
1082987665 11:59182213-59182235 TACCCCCACTGCCAGGCTCTGGG + Exonic
1083330876 11:61897829-61897851 CACCCCAGCTGCCAAGCCCTGGG - Exonic
1083755221 11:64788581-64788603 CTGCCTCAGTGCCAGGCCCTGGG - Intergenic
1084014233 11:66369269-66369291 CAGCCCTACTGCCCAGCCCCAGG - Intronic
1084237576 11:67797897-67797919 CGGCGCCACTGCCAAGCTCTAGG + Intergenic
1084258909 11:67961529-67961551 CATCCTCACTGCCACAGCCTTGG - Intergenic
1084492434 11:69486177-69486199 CAGCCCCACTGCCGGGCCTGGGG + Intergenic
1084813840 11:71633649-71633671 CATCCTCACTGCCACAGCCTTGG + Intergenic
1084834828 11:71794931-71794953 CAGCACCACTGCCAAGCTCTAGG - Intronic
1085065759 11:73494323-73494345 CAGCCTCACTGCCACTCTTTTGG - Intronic
1085322265 11:75582539-75582561 CAGCCCCTCTCCCTCTCCCTAGG - Intergenic
1085351283 11:75799429-75799451 CATCTCCACTGCTACTCCCTTGG - Intronic
1085640738 11:78191118-78191140 CAGCCCCACTGCCACGCCCTGGG - Intronic
1085766967 11:79291638-79291660 CTTCCCCACTTCCACCCCCTCGG - Intronic
1087917772 11:103830806-103830828 CAATGCCACTGCCATGCCCTTGG + Intergenic
1089017837 11:115181619-115181641 CACCCCCACTCCCACCTCCTGGG + Intronic
1089163951 11:116460474-116460496 CAGCCCCAAGGCCACTCCCAAGG - Intergenic
1089656026 11:119947659-119947681 AAGCCCCACTGCCATGCCCAGGG + Intergenic
1089773396 11:120819216-120819238 CCGCCCCACTTCCTCTCCCTGGG + Intronic
1089781273 11:120874826-120874848 CAGCCCCTCCTCCAGGCCCTTGG - Intronic
1089794671 11:120970627-120970649 CAGCCCCATTGGCAAGCTCTGGG + Intronic
1090434833 11:126677927-126677949 CAGCCTCAGTGTCAGGCCCTGGG + Intronic
1091369697 11:135047729-135047751 CAGCCCCACAGGCACCCCCAGGG - Intergenic
1091651319 12:2312309-2312331 CTGCCCCACTGCCACGCTGCAGG - Intronic
1091722765 12:2825388-2825410 CAGGCCCAATGGCAAGCCCTCGG - Exonic
1092430234 12:8402537-8402559 CATCCTCACTGCCACAGCCTTGG - Intergenic
1094832033 12:34304708-34304730 CAGCCCCTGTGCCAGGCCCCGGG + Intergenic
1095097833 12:38157623-38157645 CAGCCCCTTTGCCAGGCCCGAGG + Intergenic
1095891124 12:47235829-47235851 CTGCCCCACCGCCACCCCGTGGG + Exonic
1096212155 12:49775108-49775130 CATCCCCTCTGCCACTGCCTAGG + Intergenic
1096504896 12:52086603-52086625 CAGCCGCACGCCCACGCCCACGG + Intergenic
1096625891 12:52895883-52895905 CAGCCCCAGGGCCAGGCCCAGGG - Intergenic
1097237045 12:57547242-57547264 CAGCCCTGCTGCCACACCCCTGG + Intronic
1098006067 12:65998297-65998319 CAGCCCCACAGCCACCACTTTGG + Intergenic
1101126703 12:101642679-101642701 CAGCCCCACTCCCAACCCCGCGG - Intronic
1101746367 12:107544575-107544597 CAGTCACACTGCCTCTCCCTGGG - Intronic
1101857067 12:108452595-108452617 AAGCCCCACTCCTACACCCTTGG - Intergenic
1102028931 12:109728946-109728968 TAACCCCACTGCCTTGCCCTGGG - Intronic
1103175874 12:118862621-118862643 CAGCCTCCATCCCACGCCCTTGG - Intergenic
1103330668 12:120151648-120151670 CTGCCCCACTGCCCAGGCCTAGG - Intronic
1103439686 12:120954038-120954060 GTGCCCCACTGCCCCGCCCTTGG + Intergenic
1103566282 12:121817433-121817455 CCGCCGCACACCCACGCCCTTGG - Exonic
1103926882 12:124428101-124428123 CAGCCCAGGTGCCACACCCTTGG + Intronic
1104805334 12:131586165-131586187 CAGCCCCAGCTCCACGCCCTGGG - Intergenic
1104847369 12:131853210-131853232 CAGCCCCCCTGCCCCGCCTACGG - Intergenic
1104973662 12:132542559-132542581 CAGCCCCTCTCCCACCCACTGGG + Intronic
1105053940 12:133080394-133080416 CCGCCCCACTGCAACTCCCAGGG - Exonic
1105968295 13:25404542-25404564 CACCCTCACTGCCACTCCCCTGG - Intronic
1107277582 13:38693661-38693683 CACCCCCACTGGGATGCCCTGGG - Intronic
1111427900 13:88112979-88113001 CAGCCCCACTGCCACCATTTGGG - Intergenic
1112331626 13:98481418-98481440 CAGCCCCACCTCCACACCCTGGG + Intronic
1112360097 13:98709508-98709530 CAGCCCATCTGCAAAGCCCTGGG + Intronic
1113314047 13:109159836-109159858 CAGCCCCCCTTACACGCCTTAGG - Intronic
1113489621 13:110680903-110680925 CAGCCTCTCTGCCCTGCCCTGGG - Intronic
1114525622 14:23365644-23365666 CAGCCCCACGGCCACGCTCTCGG - Intronic
1115143528 14:30200619-30200641 CACCTCCACTGCCACCACCTTGG + Intergenic
1115241099 14:31251715-31251737 CAAAGCCACTGCCACACCCTGGG - Intergenic
1117895918 14:60486067-60486089 CAGCCCCGCCCCCACGCCCCTGG + Exonic
1118089547 14:62458067-62458089 GAGCCACACTGCCAGGCCCCAGG - Intergenic
1118364527 14:65083064-65083086 CAGACCCTCTGCCACACCCTGGG - Intronic
1118714448 14:68549028-68549050 CAGCCTCACAGTCACTCCCTGGG - Intronic
1118745776 14:68771981-68772003 CAGCCACTCTGCCTTGCCCTTGG + Intergenic
1119497035 14:75088926-75088948 CAGCCTCACTGACACTTCCTTGG - Intronic
1121988782 14:98534038-98534060 CAGCACCACTGCCTCCCTCTGGG + Intergenic
1122154297 14:99741270-99741292 CAGTCCCACTGCCCTGCTCTGGG + Intronic
1122863312 14:104592095-104592117 CAGCCCCTCTGCCCCTCCCATGG - Intronic
1123476158 15:20593627-20593649 CAGCCCCAAAGCCACCCCCAAGG - Intergenic
1123641854 15:22406737-22406759 CAGCCCCAAAGCCACCCCCAAGG + Intergenic
1125125111 15:36210946-36210968 CATCCCCATTGCCACAGCCTTGG - Intergenic
1126929794 15:53634809-53634831 CAGCCCTACTGGCACCACCTTGG - Intronic
1128687692 15:69699070-69699092 CAGCACCAGTGCCTCGCTCTTGG - Intergenic
1128751689 15:70154706-70154728 ACGCCTCACTGCCATGCCCTTGG + Intergenic
1129174943 15:73833075-73833097 CAGTCACACAGCCAAGCCCTGGG - Intergenic
1129387246 15:75202651-75202673 CAGCCCCACACCGACGCCCGCGG - Intronic
1129801457 15:78418137-78418159 CAGCACCACTGCCTCCCACTAGG - Intergenic
1129847369 15:78774101-78774123 CAGCCCCACTGGCAGGCCCCAGG - Intronic
1130011646 15:80157085-80157107 CAGCCCCACTGCCAACTCCCTGG - Intronic
1130254535 15:82319811-82319833 CAGCCCCACTGGCGGGCCCCAGG + Intergenic
1130600430 15:85270159-85270181 CAGCCCCACTGGCGGGCCCCAGG - Intergenic
1131260288 15:90884347-90884369 CAGCCCCCCTGCTCCGCGCTGGG - Intronic
1131311613 15:91295818-91295840 CAGTCTCTCTGCCAAGCCCTGGG + Exonic
1131343808 15:91627642-91627664 GAGCCCCACTGCCAGGCCCGGGG - Intergenic
1133349203 16:5090321-5090343 CAGCACCACTGCCAAGCTCTAGG + Exonic
1133365953 16:5210336-5210358 CATCCTCACTGCCACAGCCTTGG + Intergenic
1134041729 16:11073770-11073792 CAGGCCCTGTGCCAGGCCCTAGG - Intronic
1134223969 16:12377364-12377386 CTGCCCCTCTGCCACAACCTGGG - Intronic
1134322877 16:13179641-13179663 CAGCCCCACTGTCATTCCCAGGG - Intronic
1135817956 16:25653118-25653140 CACCCCCACTCCCACTCCCCAGG + Intergenic
1135889565 16:26345070-26345092 CAGCTCCACTGTCACTCTCTCGG - Intergenic
1136149495 16:28337764-28337786 CAGTCCAACTTCCACCCCCTGGG - Intergenic
1136543525 16:30942432-30942454 CAGCCCCACTGCCAGCCCTGCGG + Exonic
1137026172 16:35477929-35477951 CAGCCACATTGCCTGGCCCTGGG - Intergenic
1137479158 16:48836972-48836994 CTGCAACACTGCCAGGCCCTTGG + Intergenic
1137861429 16:51850616-51850638 CTGCCCCTCTGCCACTCCCAGGG + Intergenic
1137941976 16:52696743-52696765 CATCCCCACTGCCCTGCCCTTGG - Intergenic
1141606384 16:85156195-85156217 CACCCAGACTGCCACGCACTGGG - Intergenic
1141658890 16:85430987-85431009 CAGCCCCGCCGCAAGGCCCTGGG + Intergenic
1142621167 17:1166494-1166516 TGGCCCCACTGCCACACCCCCGG - Intronic
1142941889 17:3386531-3386553 CAACACCACGGCCAGGCCCTCGG - Intergenic
1142982389 17:3679736-3679758 CAGCCCCGATGCCTCGTCCTCGG + Exonic
1143021493 17:3919176-3919198 CAGCCCTGCTGCCAAGCACTCGG + Intergenic
1143478129 17:7214516-7214538 CGGCCACACTGCCCCGCCCCCGG + Intronic
1143839230 17:9718459-9718481 CAGCCCAAATGCCACACGCTGGG - Intronic
1144144904 17:12388006-12388028 CACTCCCACTGCCACCACCTTGG - Intergenic
1144726923 17:17506801-17506823 CAACCCCATGGCCACGCCCTGGG + Intronic
1144872638 17:18380519-18380541 CAGCCCAACTGCCCCTCCCAGGG + Intronic
1146006875 17:29166131-29166153 CAGCCCCAGGGCCAGGTCCTTGG + Exonic
1147159093 17:38560295-38560317 CAACACCACTGCCAGGGCCTAGG - Intronic
1147597071 17:41724269-41724291 CAGCCACCCTCCCACGGCCTGGG - Exonic
1147673595 17:42190676-42190698 CTGCCCCACTGCCCGGCCCAGGG + Exonic
1148441742 17:47715063-47715085 CAGCCCCACAGCAGGGCCCTGGG + Intergenic
1148749196 17:49935040-49935062 CAGCCCCATTCCCAGGACCTTGG - Intergenic
1150822497 17:68446712-68446734 CAGCCCCACACCCAATCCCTGGG + Intronic
1151214773 17:72569881-72569903 CAGCCCCAAACCCAAGCCCTTGG - Intergenic
1151300679 17:73222902-73222924 CAGCCCAACAACCACACCCTGGG + Intronic
1151529867 17:74697325-74697347 CAGCCCCACATCCCTGCCCTAGG + Intronic
1151678592 17:75612700-75612722 CAGCCCCTCTGCCTCTCCCGAGG + Intergenic
1152587486 17:81195515-81195537 CTGCCCCACTGCCAGGTCCTTGG - Intronic
1156228085 18:35128889-35128911 CAGCCCCACTTCCCCTCCTTGGG + Intronic
1156466279 18:37349590-37349612 CAGCCCCTGTGCCAAGCGCTAGG + Intronic
1157412346 18:47473647-47473669 CAGCCCCACTGCCTTTGCCTGGG + Intergenic
1159915602 18:74184957-74184979 CAGCCCCACTTTGAGGCCCTTGG - Intergenic
1160335141 18:78031833-78031855 CAGCCCCAGCCCCACTCCCTGGG + Intergenic
1160726342 19:619387-619409 CTGCCCCCCTGCTAGGCCCTAGG - Intronic
1160975045 19:1789098-1789120 CAGCCCCACGCCCACGTCCGCGG + Exonic
1161028065 19:2045773-2045795 CAGCCCTTCGGCCACACCCTGGG + Intronic
1161070215 19:2256190-2256212 CTCCCCCACTGCCACGCAATAGG - Intronic
1161282604 19:3453980-3454002 CAGCCCCACTGCCAGGTCAGAGG + Intronic
1161487588 19:4544076-4544098 CACCCGCACCCCCACGCCCTGGG - Exonic
1161668621 19:5591718-5591740 GAGCCCCGATGCCAAGCCCTGGG - Intronic
1161806955 19:6449931-6449953 CAACCCCCATGCCCCGCCCTGGG + Intronic
1161971363 19:7582691-7582713 CGGCCCCAAAGCCACACCCTGGG + Intergenic
1162059719 19:8087166-8087188 CAGCAGGACTGCCACGCCCGGGG - Exonic
1162342937 19:10102721-10102743 CAGCTCCACTCCCAGGCTCTGGG - Exonic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1162822458 19:13231362-13231384 CAACCCCACCCCCACCCCCTGGG + Intronic
1162890647 19:13730761-13730783 CAGCCCCATTCTCATGCCCTCGG + Intergenic
1162933430 19:13968626-13968648 CTGCCCCACCGCCACGCCGTTGG + Exonic
1163437252 19:17303059-17303081 CAGCCCCGCTTCCCCGCCCCCGG + Intronic
1163579140 19:18128018-18128040 CTGCCCCTCTGCCAAGGCCTGGG + Intronic
1163666850 19:18607319-18607341 CACCCCCAGCCCCACGCCCTCGG + Intronic
1163993723 19:21023311-21023333 CATCAGCACTGCCACTCCCTGGG + Intronic
1164502146 19:28828978-28829000 CAGCCCCTCAGCCCCACCCTAGG - Intergenic
1164630399 19:29758084-29758106 CAGCCCCTCTGCCACCCCTGGGG - Intergenic
1165156562 19:33792347-33792369 CCGCCCCACTCCCACCCCCAGGG + Intergenic
1165258890 19:34596790-34596812 CAGCCCCACTGCGGCCCTCTTGG - Intronic
1165407567 19:35640124-35640146 CAGTCCCACTCCCACTCCATGGG + Intergenic
1165803536 19:38566984-38567006 CAGCCCCAAGGCCACTCACTCGG - Exonic
1165996230 19:39846061-39846083 CACCCCCAATGCCAGGCCCACGG + Intronic
1166217915 19:41348215-41348237 CCGACCCACAGCCACCCCCTTGG + Intronic
1166549345 19:43654861-43654883 CTGCTCCACTGCCACCACCTGGG - Intronic
1167116522 19:47492173-47492195 CAGAGCCACTGCCAGGCACTGGG + Intronic
1167295449 19:48646573-48646595 CAGCCCCCCTTCCCCGCCCCAGG + Intergenic
1167569278 19:50276845-50276867 CAGCGCCACGGCCAGGCCCTGGG + Exonic
1167687594 19:50966372-50966394 CATCCCCACTGCGACCGCCTGGG + Intronic
1168209782 19:54882004-54882026 CAGCCCCTCTGCCACTGCCATGG - Intronic
925323168 2:2992818-2992840 AAGCCCCACTGCCTTGTCCTAGG + Intergenic
925640495 2:5981886-5981908 CAGCCCCAGCGCCTCTCCCTAGG - Intergenic
926957448 2:18317069-18317091 CACCCCCACTGTCAGCCCCTTGG + Intronic
927518893 2:23687631-23687653 CTCCCCCACAGCCAGGCCCTTGG - Intronic
927971208 2:27307192-27307214 CGGCACCACCGCCCCGCCCTCGG - Exonic
929442365 2:41974051-41974073 CAGCCCCTCTGGCCCTCCCTGGG - Intergenic
929510213 2:42560618-42560640 GAGCCACCGTGCCACGCCCTGGG - Intronic
929608075 2:43249026-43249048 CATCCCCACTGCCACTTCCTTGG + Intronic
931356750 2:61543779-61543801 AAGCCCCAGTGCCCAGCCCTGGG + Intergenic
932417778 2:71584140-71584162 CAGCCCCAGGGCCAGGCCCAGGG - Intronic
932832535 2:75004983-75005005 CAGCCCCATTGCCACTGCCTTGG - Intergenic
933954403 2:87354265-87354287 CAGGGCCACGGCCACGGCCTGGG - Intergenic
934554930 2:95282088-95282110 CAGCCCCCCCGCCACCCCCAAGG + Intronic
934857614 2:97738931-97738953 CAGACCCACTGCCATGCTCCAGG + Intronic
935812437 2:106811948-106811970 CAGTCCCTGTGCCACTCCCTGGG - Intronic
936243646 2:110808483-110808505 CAGCCCCCTTGTCACTCCCTGGG + Intronic
936585751 2:113756439-113756461 CAGCGCCACGGCCGCGGCCTCGG + Exonic
937134913 2:119544372-119544394 CAGCCCGGCTCCCCCGCCCTGGG + Intergenic
937394199 2:121520373-121520395 CAGCCCCACAGCCAGTGCCTTGG + Intronic
939014513 2:136886407-136886429 CACCTCCACTGCCATGGCCTTGG - Intronic
939129425 2:138216684-138216706 CAGCTCCAATGCCACTTCCTTGG - Intergenic
941006612 2:160254023-160254045 CAGCCACACTGCCATCCACTAGG - Intronic
941874338 2:170417996-170418018 CAGCCCCACTCCCTCCTCCTTGG - Intronic
947195720 2:227565122-227565144 CAGCCCCACTTCCCTGCCCTTGG - Intergenic
947705676 2:232273643-232273665 CAGAAGCACTGCCAGGCCCTGGG - Intronic
947875428 2:233464579-233464601 CAGCCCCACAGCCTCCCCCGAGG + Intronic
947901016 2:233721843-233721865 CAGCCCCACTGCTCGGCCCTGGG + Intronic
948822635 2:240557758-240557780 CAGCCCCTCGGCCCCTCCCTGGG + Intronic
948868397 2:240786544-240786566 CAGCCCCACTCCCTCGCCTCAGG - Intronic
949023210 2:241752867-241752889 CAGCCCCCATGCCACCCCCAGGG + Intronic
1169008860 20:2232956-2232978 TAGCCCTACTGCCACTTCCTTGG + Intergenic
1169131130 20:3166929-3166951 TGGCCCCACTGCCACTGCCTCGG + Exonic
1171780701 20:29415349-29415371 CAGCCACACTGCCTGGTCCTGGG - Intergenic
1174447149 20:50597862-50597884 CACGCCCAGTGCCACGCCTTGGG - Intronic
1176550528 21:8219046-8219068 CACCCCCACCACCACGCCCGCGG - Intergenic
1176569458 21:8402085-8402107 CACCCCCACCACCACGCCCGCGG - Intergenic
1176577370 21:8446316-8446338 CACCCCCACCACCACGCCCGCGG - Intergenic
1176592142 21:8656858-8656880 CAGGGCCACGGCCACGGCCTGGG - Intergenic
1176862501 21:14019173-14019195 CAGCCACACTGCCTGGTCCTAGG - Intergenic
1179479811 21:41670016-41670038 CAGCCCCATTCCAAGGCCCTGGG + Intergenic
1179511846 21:41878893-41878915 CAGCCCCGCGGCCCCGCGCTGGG + Intronic
1180274993 22:10633987-10634009 CAGGGCCACGGCCACGGCCTGGG - Intergenic
1180841839 22:18962511-18962533 CAGCCCCAGTCCCTCACCCTAGG - Intergenic
1180850815 22:19019204-19019226 GAGCCCTACTGGCAGGCCCTTGG + Intergenic
1181059665 22:20276353-20276375 CAGCCCCAGTCCCTCACCCTAGG + Intronic
1181636766 22:24178207-24178229 CAGCCCCACCGCCACGCCCCAGG + Exonic
1183378956 22:37481184-37481206 CAGACCCACGGCCACACCATGGG + Intronic
1183454192 22:37912527-37912549 CATCCCCAGGGCCACCCCCTGGG - Intronic
1183547297 22:38461359-38461381 CAGCCCCAGTGCCTGGCACTTGG + Intergenic
1183587758 22:38762785-38762807 CAGCCCCACGGCCAAGTCCATGG + Intronic
1183901046 22:41006340-41006362 CACCACCACTGCTACCCCCTTGG + Intergenic
1185326538 22:50228370-50228392 CAGCCCCTTTGCCATGCCCCTGG - Intronic
1203255425 22_KI270733v1_random:135387-135409 CACCCCCACCACCACGCCCGCGG - Intergenic
950089666 3:10286742-10286764 CAGCAGCACAGCCAGGCCCTGGG - Exonic
950530534 3:13550143-13550165 CAGCCCCCCTGGCACTCCATGGG + Intronic
953682716 3:45051870-45051892 CAGCCCAGCTGCCCCACCCTTGG + Intergenic
954116533 3:48469690-48469712 CTGCCCCACTGTGACCCCCTGGG - Intronic
955782700 3:62502821-62502843 CAGCTCCCCTGCCACATCCTGGG - Intronic
955875194 3:63481849-63481871 CAGCCCCGCTGCCCGGCCATTGG - Intronic
956192443 3:66620692-66620714 CAGCCCAACTGCCAGGCCCTGGG - Intergenic
957053530 3:75427664-75427686 CGGCACCACTGCCAAGCTCTAGG + Intergenic
957084306 3:75665923-75665945 CAGCCACACTGCCTGGTCCTGGG + Exonic
961280224 3:125760671-125760693 CATCCTCACTGCCACAGCCTTGG + Intergenic
961301306 3:125923885-125923907 CAGCACCACTGCCAAGCTCTAGG - Intergenic
961365717 3:126398130-126398152 CAGCCCCTCTGCCAAGGCTTAGG - Intronic
961442436 3:126960945-126960967 CAGCCCCACTAACCCGCCCTGGG - Intergenic
961470028 3:127105736-127105758 CAGCCCCACTGCCTGGCTCCTGG - Intergenic
961717148 3:128865496-128865518 CTGGCCCACTGCCAGGCCGTTGG + Intergenic
961804751 3:129481458-129481480 CTGGCCCACTGCCAGGCCGTTGG - Intronic
961819919 3:129570798-129570820 CTGCCCCACGGCCGCGCCCAGGG + Exonic
961874181 3:130008876-130008898 CATCCTCACTGCCACAGCCTTGG - Intergenic
961887181 3:130103978-130104000 CGGCGCCACTGCCAAGCTCTAGG + Intronic
962385734 3:134930770-134930792 CAGCCCCACTGGGACGCTCCTGG + Intronic
963009795 3:140758604-140758626 CAGCCCCATTTCCTGGCCCTGGG - Intergenic
964619220 3:158704148-158704170 CAGCCCCATTGCCACCACCCTGG + Intronic
966882348 3:184357573-184357595 CAGCCCCACAACCCTGCCCTTGG - Intronic
967136359 3:186516020-186516042 GGGCCCCACTGCCCTGCCCTTGG + Intergenic
967405108 3:189106585-189106607 CAGCCTCTCTGCCAGGCACTGGG - Intronic
967626696 3:191694165-191694187 CAGTCCCACTGCCACACCCCTGG - Intergenic
968055006 3:195684420-195684442 CAACCCCCCTACCACACCCTCGG - Intergenic
968100882 3:195964729-195964751 CAACCCCCCTACCACACCCTCGG + Intergenic
968100907 3:195964856-195964878 CAACCCCCCTACCACACCCTCGG + Intergenic
968426868 4:529390-529412 CAGCCACACTGCCAGGCACATGG + Intronic
968503059 4:960105-960127 CAGCCTCACCTCCCCGCCCTGGG - Exonic
968640570 4:1712493-1712515 AAGCCCGACTGCCCGGCCCTCGG + Exonic
968651837 4:1763280-1763302 CAGCGCCTCTGCCTCGGCCTCGG + Intergenic
968914744 4:3492483-3492505 CAGCACCCCTGCCACTACCTTGG - Intronic
968916920 4:3500598-3500620 CAGTCCCCCAGCCAGGCCCTCGG - Intronic
969017447 4:4113359-4113381 CATCCTCACTGCCACAGCCTTGG - Intergenic
969170672 4:5360231-5360253 CAGACCCAGTGCCACGTTCTGGG + Intronic
969509245 4:7608222-7608244 CAGCCCCACTGCCATCTGCTAGG - Intronic
969605489 4:8200229-8200251 CAGCCCCGCTGCCTGGCGCTGGG - Intronic
969736498 4:8994946-8994968 CATCCTCACTGCCACAGCCTTGG + Intergenic
969757665 4:9160712-9160734 CAGCGCCACTGCCAAGCTCTAGG - Intergenic
969795691 4:9526509-9526531 CATCCTCACTGCCACAGCCTTGG + Intergenic
969841673 4:9887530-9887552 CCTCCCCACTGCCCCGCCCAGGG - Intronic
972341440 4:38155568-38155590 CACCCCCACCCCCACCCCCTAGG - Intergenic
972828304 4:42786690-42786712 CAGCCCCTCTGCCACTGCCATGG - Intergenic
979547062 4:121951230-121951252 CAGAGCCCCTGCCACGCACTCGG + Intronic
980639908 4:135564372-135564394 CAGCCCTACTTCCACTGCCTAGG - Intergenic
980922767 4:139103382-139103404 CAGCCCCACTCCCAACCTCTGGG + Intronic
983969663 4:173856411-173856433 CTGCCCCACTTCCCCGCCATGGG + Intergenic
985007541 4:185549121-185549143 CAGGCCCAGTGCCATGCCCTTGG + Intergenic
985049988 4:185980464-185980486 CAGCCCCACTGCAACTCAATGGG + Intergenic
985273717 4:188218431-188218453 CGGCCCCACCTCCACACCCTGGG - Intergenic
985446680 4:190025648-190025670 CAGCCACACTGCCAGGTCCTGGG - Exonic
993280667 5:85921000-85921022 CAGCCCCTCTGCCACTGCCATGG + Intergenic
995012587 5:107274559-107274581 TAGCCTCACTGTCAGGCCCTGGG + Intergenic
996999919 5:129747363-129747385 CAGCCTCACTCCCACCACCTTGG + Intergenic
997881868 5:137598956-137598978 CAGGCACAGTGCCAGGCCCTGGG - Intergenic
998005155 5:138651800-138651822 CAGCCACACAGCCACCACCTTGG + Intronic
999282096 5:150372638-150372660 CAGCCCCCCTGTCTTGCCCTTGG - Intronic
1002081956 5:176742698-176742720 CACCCCCACTGCTCCTCCCTGGG - Intergenic
1002099628 5:176850978-176851000 CAGCCCCACTGGGAAGTCCTGGG - Intronic
1002421474 5:179151490-179151512 CAGCCCCACTGAGACCACCTTGG - Intronic
1003517741 6:6831752-6831774 CAACCCCGCTGCCACTTCCTTGG - Intergenic
1003925383 6:10872889-10872911 CAGGCCCACTGCCATGCCCTGGG + Intronic
1006445002 6:34075100-34075122 CAGCCCCACTGCACTGCCCGCGG - Intronic
1006934144 6:37705668-37705690 GGGCCCTGCTGCCACGCCCTCGG + Intergenic
1007756603 6:44103620-44103642 CAGCCCCACTGCAACCCTCTAGG + Intergenic
1008795640 6:55299386-55299408 CAGCCCCATTGCCACTGCCTTGG - Intergenic
1010713195 6:79199022-79199044 CTGCCCCACTGCTACCCCTTTGG - Intergenic
1014014776 6:116517806-116517828 CAGCCCCACTCCCAGACCTTGGG + Exonic
1014567842 6:122972608-122972630 CAACTCCACTGCCATTCCCTTGG - Intergenic
1015585545 6:134772579-134772601 CAGCCCAACTGCCAGGCCCAGGG - Intergenic
1016472008 6:144384476-144384498 CTCCCCCACTGCCCCGCCCATGG + Intronic
1016985041 6:149888802-149888824 CAGCCACTCTACCAGGCCCTGGG + Intronic
1017744665 6:157435865-157435887 CTGCCACGCTGCCAGGCCCTTGG - Intronic
1017765445 6:157603423-157603445 CAGCCACACTGAGAGGCCCTTGG + Intronic
1019223046 6:170489994-170490016 CAGCCCCACTCCCAACCCCAGGG - Intergenic
1019224460 6:170498726-170498748 CAGCCTTACAGCCATGCCCTGGG - Intergenic
1019333543 7:471906-471928 CAGCCCCACTGTGAGCCCCTAGG - Intergenic
1019529744 7:1497403-1497425 GAGACCCACTGCAGCGCCCTCGG - Intronic
1019555169 7:1625679-1625701 CAGCCCCAGTGTCCAGCCCTTGG + Intergenic
1019578327 7:1748307-1748329 CAGGCCCACTCACACCCCCTCGG - Intergenic
1020015562 7:4829399-4829421 CATCCCCACTGCCCGGCCCAGGG - Intronic
1020320602 7:6936390-6936412 CGGCGCCACTGCCAAGCTCTAGG + Intergenic
1021423045 7:20466897-20466919 CTGCCCAACAGCCACACCCTAGG + Intergenic
1021597002 7:22328109-22328131 CAGGCACTCTGCCACGTCCTAGG - Intronic
1021815177 7:24439841-24439863 CAACCCCACTTCCATGCCTTTGG + Intergenic
1021859245 7:24889867-24889889 CAGCCTCACAGCCAGGCGCTGGG + Intronic
1022102173 7:27175131-27175153 CGGCCCCACTCCCACTCCCAAGG + Intronic
1023849507 7:44142207-44142229 CAGCCCCTCTGCTGTGCCCTCGG - Intergenic
1023865061 7:44234570-44234592 CAGCTTCACCCCCACGCCCTGGG - Intronic
1024093683 7:45967988-45968010 CAGCCTGACTCCCACTCCCTGGG + Intergenic
1024095652 7:45980428-45980450 CAGCCCCACTGACAAGCATTTGG + Intergenic
1027200542 7:76061372-76061394 GAGTCCCACTACCAGGCCCTCGG - Intronic
1027269051 7:76510416-76510438 CAGCCCCACTGCCAGGGCCAAGG - Intronic
1029075938 7:97934189-97934211 CATCCTCACTGCCACAGCCTTGG - Intergenic
1029548221 7:101222468-101222490 CATCCCCATTGCCAAGCCCTTGG - Intronic
1032145474 7:129375836-129375858 CAGCCCCACTGCCACCTCTGTGG - Intronic
1033228071 7:139576416-139576438 CAGCAGCACTGGCACCCCCTGGG - Intronic
1034274773 7:149819319-149819341 CAGCCCCACAGCCAGGGCCAGGG - Intergenic
1034535395 7:151722910-151722932 CAGCCCCACAACCACATCCTTGG + Intronic
1036241581 8:7086150-7086172 CATCCTCACTGCCACAGCCTTGG + Intergenic
1036260257 8:7233967-7233989 CATCCTCACTGCCACAGCCTTGG - Intergenic
1036306360 8:7605556-7605578 CATCCTCACTGCCACAGCCTTGG + Intergenic
1036312294 8:7692523-7692545 CATCCTCACTGCCACAGCCTTGG - Intergenic
1036357206 8:8053541-8053563 CATCCTCACTGCCACAGCCTTGG + Intergenic
1036803206 8:11808364-11808386 CAGCCCCGCAGCCCCGCCCCCGG - Intronic
1036831155 8:12020927-12020949 CATCCTCACTGCCACAGCCTTGG - Intergenic
1036848655 8:12186589-12186611 CGGCACCACTGCCAAGCTCTAGG + Exonic
1036870016 8:12428870-12428892 CGGCACCACTGCCAAGCTCTAGG + Exonic
1036901363 8:12671712-12671734 CATCCTCACTGCCACAGCCTTGG - Intergenic
1037884042 8:22586978-22587000 CAGCCCCCCTTCCTCTCCCTGGG + Intronic
1037987585 8:23299467-23299489 CAGCCCCAGAGCCAGGCCCTCGG - Intronic
1039708818 8:40034942-40034964 CACCCCCACTGCACCGCACTTGG + Intergenic
1039762659 8:40594159-40594181 CAGCCCCACTGCCACTTTCATGG + Intronic
1040319793 8:46286747-46286769 CAGCCCCGCTGCCACCCGTTGGG + Intergenic
1040323100 8:46328327-46328349 CAGCCCCACTGCCACCCAAGGGG + Intergenic
1040632407 8:49230586-49230608 CAGCTCCCCTGCCACACCCTTGG - Intergenic
1040898026 8:52389132-52389154 GAGCCCCACAGCCAAGCCCCGGG - Intronic
1043305314 8:78786824-78786846 CAGCCCCAGTCCCAGCCCCTAGG + Intronic
1045936897 8:107690410-107690432 CATCACCACTGCCACTGCCTTGG + Intergenic
1048859503 8:138713709-138713731 CACCCCCACCGCCCCGCCGTAGG + Intronic
1049163921 8:141115334-141115356 CATCCCCACTGCCACAGCCTTGG - Intergenic
1049441256 8:142610812-142610834 CAGCCCCACTGCAGCCCACTAGG - Intergenic
1049570864 8:143369716-143369738 CAGTCCTCCTGCCAGGCCCTGGG + Intronic
1049599174 8:143499095-143499117 CAGGACCACTGCCAAGCCCAAGG + Intronic
1049686043 8:143939722-143939744 CTCCCCCACAGACACGCCCTCGG + Intronic
1052140902 9:24981869-24981891 CAGCCACACTGACACTTCCTGGG + Intergenic
1056033776 9:82582852-82582874 CAACTCCACTGCCACCACCTGGG - Intergenic
1058101262 9:100919954-100919976 CACTCCCACTGCCCTGCCCTGGG + Intergenic
1059020979 9:110576009-110576031 CAGCCCCAGTGTCAGGACCTGGG - Intronic
1059312413 9:113397441-113397463 CAGCCCTGCTGCCACACCCCTGG + Intronic
1061177618 9:129007167-129007189 CAGCCCCACTCCCAGGCGCCTGG - Intronic
1061185287 9:129049401-129049423 CAGCCCCACAGCCGCGTGCTCGG + Exonic
1061419044 9:130463447-130463469 CAGCACCACAGCCACCCCCTCGG - Intronic
1061539743 9:131271703-131271725 CTGGCCCACAGCCACGCCCATGG - Intronic
1061639957 9:131945589-131945611 CAACCCCCATGCCAAGCCCTTGG + Intronic
1061822175 9:133234881-133234903 GGGCCCCCCTGCCAAGCCCTGGG - Intergenic
1061909780 9:133716507-133716529 CAGCCCCACACCCGCCCCCTGGG + Intronic
1061909802 9:133716564-133716586 CAGCCCCACACCCGCCCCCTGGG + Intronic
1062237117 9:135515635-135515657 GGGCCCCCCTGCCATGCCCTGGG + Intergenic
1062341090 9:136094362-136094384 CAGCCCCTCTGCCAGGCTCTGGG - Intronic
1062380605 9:136284974-136284996 CAGCCCAACTCCCTCCCCCTGGG - Intronic
1203471823 Un_GL000220v1:118522-118544 CACCCCCACCACCACGCCCGCGG - Intergenic
1203622193 Un_KI270749v1:135705-135727 CAGGGCCACGGCCACGGCCTGGG - Intergenic
1186545565 X:10445623-10445645 AAGTCACACTGCCAAGCCCTCGG - Exonic
1188192863 X:27193786-27193808 CATCCCCACCCCCACACCCTGGG + Intergenic
1188482943 X:30653303-30653325 CACCCCCCCTGACACGCCCCTGG + Intergenic
1188791708 X:34413899-34413921 CAGCCCCTCTGCCACTGCCATGG + Intergenic
1190106316 X:47563340-47563362 CAGCCCCACGCCCACCCACTGGG + Intronic
1190310279 X:49112460-49112482 GAGCCCCAGTGCCATTCCCTGGG + Intergenic
1190363388 X:49669547-49669569 CAGCCCCACTGACACCATCTAGG + Intergenic
1190732482 X:53234709-53234731 CATCGCCACTTCCACGCCCATGG - Exonic
1191640457 X:63426033-63426055 CAGCCCCAAGGCCAAGCCCCTGG - Intergenic
1192177693 X:68896030-68896052 CAGGCTCAGTGCCAGGCCCTGGG + Intergenic
1192182764 X:68926737-68926759 TGGCCCCACTGTCAGGCCCTGGG + Intergenic
1193569836 X:83128391-83128413 CAGCCCCTCTGCCACTGCCAAGG + Intergenic
1196075362 X:111569666-111569688 CAGCCCCACAGCCACTCCGAAGG - Intergenic
1196409602 X:115401635-115401657 CAGCCACAATGCCACTCTCTAGG + Intergenic
1198410484 X:136362344-136362366 CAACCCCACTGCCACTACCCTGG + Intronic
1199695003 X:150337528-150337550 CACCCCCACTGCCACGAGCCCGG - Intergenic
1200745050 Y:6896891-6896913 CAGCCCCACTGCCCCTGCTTGGG - Intergenic
1201448947 Y:14089052-14089074 CAGCCCCAGTGCCACATCATGGG + Intergenic