ID: 1085643501

View in Genome Browser
Species Human (GRCh38)
Location 11:78208113-78208135
Sequence CAGCAGCCACAAATGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085643501_1085643509 22 Left 1085643501 11:78208113-78208135 CCTGTCTCCATTTGTGGCTGCTG 0: 1
1: 0
2: 2
3: 27
4: 220
Right 1085643509 11:78208158-78208180 AAGGAAATAATACATTCCTGAGG 0: 1
1: 0
2: 4
3: 60
4: 625
1085643501_1085643506 -9 Left 1085643501 11:78208113-78208135 CCTGTCTCCATTTGTGGCTGCTG 0: 1
1: 0
2: 2
3: 27
4: 220
Right 1085643506 11:78208127-78208149 TGGCTGCTGGGGAAAGCAAACGG 0: 1
1: 0
2: 4
3: 48
4: 357
1085643501_1085643507 3 Left 1085643501 11:78208113-78208135 CCTGTCTCCATTTGTGGCTGCTG 0: 1
1: 0
2: 2
3: 27
4: 220
Right 1085643507 11:78208139-78208161 AAAGCAAACGGCCTGTGATAAGG 0: 1
1: 0
2: 1
3: 12
4: 102
1085643501_1085643510 23 Left 1085643501 11:78208113-78208135 CCTGTCTCCATTTGTGGCTGCTG 0: 1
1: 0
2: 2
3: 27
4: 220
Right 1085643510 11:78208159-78208181 AGGAAATAATACATTCCTGAGGG 0: 1
1: 0
2: 3
3: 48
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085643501 Original CRISPR CAGCAGCCACAAATGGAGAC AGG (reversed) Intronic
900370584 1:2330316-2330338 CAGCAGCCACCACTGGTGCCTGG - Intronic
900469730 1:2847838-2847860 CCGCAGCCACAGAAGAAGACGGG - Intergenic
902364461 1:15962404-15962426 CAGCAGCCATGAAGGGAGTCAGG + Intronic
904026722 1:27508504-27508526 CAGCTGCCACATCTGGAGAATGG + Intergenic
905254279 1:36670065-36670087 CAGCCACCAAAAATGGAGAGAGG - Intergenic
905664010 1:39751072-39751094 CAGCAGTTAGAAATGCAGACGGG + Intronic
907141916 1:52194320-52194342 CAGAAGCCAAAAATGAAGATTGG + Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
910006330 1:82401412-82401434 GAGAAGCCACAAATGGAAAGAGG - Intergenic
910495910 1:87826830-87826852 GAGCAGCCTCAATTGGAAACAGG + Intergenic
911435091 1:97845896-97845918 CTGCAGCCTCACATGGAGCCGGG + Intronic
912452990 1:109778787-109778809 CAGAGGAGACAAATGGAGACTGG - Intergenic
912828161 1:112925199-112925221 CTCCAGCCACAGAGGGAGACTGG - Intronic
914847463 1:151290960-151290982 CATCAGCCACAAGAAGAGACGGG + Exonic
915879044 1:159645699-159645721 CAGCAGCCACAAATACACACAGG - Intergenic
916654146 1:166858661-166858683 CAACAGGCAAAAATGGAGAGTGG + Intronic
917649867 1:177065705-177065727 CAGCAGCAAAAAATGCAGATTGG + Intronic
920127499 1:203705036-203705058 CAGCAGCCACATGTGGTGAGTGG - Intronic
920415409 1:205796101-205796123 AAGCAGCCAGCAAGGGAGACTGG - Intronic
924103806 1:240630950-240630972 CAGAAGCAACCAATGGAGAGAGG + Intergenic
924816815 1:247449745-247449767 GAGCAGCACCAACTGGAGACTGG + Intergenic
1062854848 10:774841-774863 GTGCAGCCACACCTGGAGACGGG + Intergenic
1063964755 10:11338360-11338382 CAGCAGCCACACCTAAAGACAGG + Intergenic
1064562493 10:16606870-16606892 CAACAGCCACAAATAGGGAGAGG - Intronic
1064637770 10:17386741-17386763 CATCAGCCCCAAATGAGGACGGG + Intronic
1064974764 10:21101958-21101980 TAGAAGCCACAAAGGTAGACAGG + Intronic
1065591015 10:27261306-27261328 CAGCAGCCCCAAATGCAGACTGG + Intergenic
1066332321 10:34438101-34438123 CAGCAGACACCACTGGATACAGG + Intronic
1066564785 10:36710293-36710315 CAGCAGCCATAAATGAGAACAGG + Intergenic
1067668532 10:48299497-48299519 CTGCAACCCCAAAGGGAGACTGG - Intergenic
1067746889 10:48942791-48942813 GAACAGTCACAAATGGAGACAGG - Intronic
1068698992 10:60000269-60000291 TAGCATCCACCAAGGGAGACAGG - Intergenic
1068717018 10:60199714-60199736 CAACAGCCACAAAAGGAAAATGG - Intronic
1069378306 10:67816996-67817018 CAGCACCCACATCTGGAGAGGGG + Intronic
1071087056 10:81876069-81876091 CAGCATCCTGAAAGGGAGACAGG - Exonic
1074254394 10:111785640-111785662 CAGCAACCAGAAAAGAAGACTGG + Intergenic
1076078173 10:127554262-127554284 CAGAAGCCAGAGATGCAGACAGG + Intergenic
1076610305 10:131722231-131722253 CAGCGGCCACAGATGCAGAGAGG + Intergenic
1076722605 10:132399234-132399256 CAGCACCCACACTTGGGGACTGG - Intronic
1078275556 11:9841852-9841874 CAGCAACTGAAAATGGAGACCGG + Intronic
1080268614 11:30426781-30426803 CAGCAGTTCCAAATGCAGACAGG + Intronic
1080786056 11:35476198-35476220 CAGGAGCCCCAAGTGGAAACTGG - Intronic
1083098933 11:60282914-60282936 CCAAAGCCACAAATGGACACAGG + Intronic
1083301587 11:61742487-61742509 CCGCAGCCGGAAATGGACACTGG - Intronic
1084858301 11:72002705-72002727 CAGAGGCCACTAATGGAGAGTGG + Intronic
1085643501 11:78208113-78208135 CAGCAGCCACAAATGGAGACAGG - Intronic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1089102418 11:115974672-115974694 CAACAGCAACAAAAGGAAACTGG - Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1090730499 11:129569481-129569503 AAGGGGCCACAATTGGAGACTGG + Intergenic
1091141409 11:133238259-133238281 CAACAGCCACCTATGGAGAGTGG - Intronic
1091747961 12:3004508-3004530 CAGTAGCCACAGATGGGCACTGG + Intronic
1091848189 12:3673874-3673896 CAGCAGTCACTGATGGAGTCAGG + Intronic
1092864242 12:12745960-12745982 CAGCCACAAAAAATGGAGACAGG - Intronic
1093398594 12:18714736-18714758 CGGCTGCCACAACTGGAGATAGG + Intronic
1095192718 12:39276179-39276201 CAGCAGCCACACATGGCTAGAGG - Intergenic
1095801400 12:46272935-46272957 CTGCAGCCTCAAATGGAATCAGG + Intergenic
1095971108 12:47902582-47902604 CAGCAGGGACAAATGGAAGCTGG + Intronic
1096121162 12:49090281-49090303 CCACAGCCACAAATGAAGCCCGG + Exonic
1096571365 12:52525279-52525301 CAGTAGCCACAACTGGGAACGGG + Intergenic
1097788027 12:63782661-63782683 CAGAAGCCAGAAATGGAGATGGG - Intronic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1103791681 12:123476646-123476668 CAGCCACCAGAAATGGAGAGAGG + Intronic
1104745755 12:131209446-131209468 CAACAACCACAAATGGAGAGTGG + Intergenic
1104788546 12:131467334-131467356 CAACACCCACAAATGGAGAGTGG - Intergenic
1110107575 13:71696942-71696964 CAGCAACAGCAAGTGGAGACAGG - Intronic
1116856057 14:49953293-49953315 CAGCAGCCACCAATCCAGTCTGG - Intergenic
1117765279 14:59075690-59075712 AAGCAGCCATAAATCGATACGGG + Intergenic
1118106436 14:62665481-62665503 CAGCAGTCTGAACTGGAGACAGG - Intergenic
1119598277 14:75956633-75956655 CAGCAGACACAAATACGGACAGG - Intronic
1120000205 14:79294368-79294390 CATCAACCACAAAGGGAAACTGG - Intronic
1120378158 14:83735842-83735864 GACCAGCAACAAATAGAGACTGG + Intergenic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1122650238 14:103221925-103221947 CAACAGCCAGAGCTGGAGACCGG - Intergenic
1122721603 14:103725451-103725473 CAGCAGCCCCAAATGGAGCGTGG - Intronic
1123910221 15:24958452-24958474 TAGCATCCAGAAATGGAGAGAGG - Intronic
1124046675 15:26156818-26156840 CTGGAGCCACAAGTGGAAACTGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1127041002 15:54976715-54976737 CAGAACCCAAAAATGCAGACAGG + Intergenic
1128719136 15:69933202-69933224 CAGCATCCACAATTTGAGAAGGG - Intergenic
1128947025 15:71831761-71831783 TAACAGGCACAAAAGGAGACAGG + Intronic
1130317136 15:82806149-82806171 CTGCAGCCACAAATAGCAACAGG + Intergenic
1130971776 15:88739414-88739436 CAGCAGCCCCACTTGGAGCCAGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133967892 16:10544962-10544984 CAGCAGCCACCAAAGCACACAGG - Intronic
1134694367 16:16212250-16212272 CAACAGACAAAAATGGAGAAGGG + Intronic
1134977466 16:18582380-18582402 CAACAGACAAAAATGGAGAAGGG - Intergenic
1136628217 16:31474473-31474495 GGGGAGCCACAAATGGACACTGG - Intronic
1137816672 16:51404696-51404718 AAGCAGAAACAAATGCAGACTGG + Intergenic
1139278725 16:65751320-65751342 AAGCAGACACACATGGAGACAGG + Intergenic
1143756495 17:9071688-9071710 CAGCAGCATCAAATGGAGGCTGG + Intronic
1148392009 17:47279495-47279517 CAGCAACCACAAAGGGAGGGAGG + Intronic
1148919319 17:51016403-51016425 CAGCAGTCTCAATTGGAGAATGG + Intronic
1152235146 17:79134793-79134815 CAGCAGCCACCGGTGGACACTGG + Intronic
1155060772 18:22226591-22226613 CAGCAGTAGCAAATGAAGACAGG + Intergenic
1155241886 18:23871702-23871724 CAGCAGCCAAAAACGGCCACAGG - Intronic
1155408995 18:25521322-25521344 CAGCAGCCAGGGAGGGAGACAGG + Intergenic
1157478323 18:48037224-48037246 CAGCAGCTTCAGCTGGAGACAGG + Intronic
1160352566 18:78196569-78196591 CAGCAACCTCAAATGTACACTGG + Intergenic
1160571086 18:79818146-79818168 CAGCAGCCACACATGGATCCAGG - Intergenic
1163128582 19:15257942-15257964 CAGCAGCCATGCATGGACACTGG + Intronic
1164060448 19:21668348-21668370 CAGCAGTCACAAAAGTAGAAAGG - Intergenic
1164373226 19:27659499-27659521 CAGCTCCCACCAATGGAGATAGG - Intergenic
1165484703 19:36088692-36088714 CAGCAGCGACCAGTGGAGACAGG - Intronic
1165772934 19:38388976-38388998 CAGACCCCACAAATGAAGACTGG - Intronic
1167415488 19:49369030-49369052 CAGCTCCAACCAATGGAGACAGG + Intronic
1167874722 19:52402256-52402278 CAGCAGACATGGATGGAGACGGG + Intronic
1168137961 19:54364368-54364390 CAGCAGCCCCGTAAGGAGACTGG - Intronic
926040370 2:9667880-9667902 CTGCAGGAACAAATGGACACAGG + Intergenic
926633759 2:15160029-15160051 AAGCAGCCACCAATCCAGACAGG + Intergenic
927535019 2:23849079-23849101 CAGCAGACACAAATAGAAAATGG + Intronic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
928103468 2:28452784-28452806 CAGCAGACGCAAAAAGAGACTGG + Intergenic
928149306 2:28811325-28811347 CGGCAGGCACACGTGGAGACGGG - Intronic
929344427 2:40863766-40863788 CAGCAGGCAAAAATTGAGAGAGG - Intergenic
929607341 2:43243525-43243547 CATCTGCCCCAAATAGAGACCGG - Intronic
935877902 2:107531839-107531861 CAGTAGCCACACAGGGAGAATGG - Intergenic
936109953 2:109656928-109656950 CAACAGCCCCCAATGGAGAAGGG + Intergenic
937152767 2:119697222-119697244 AAGCAGGCACATGTGGAGACGGG - Intergenic
937949434 2:127372339-127372361 CAGGAGCCACAAAAGTACACTGG + Intronic
938316764 2:130334974-130334996 CAGAAGCCAGAAATAGAGATGGG + Intergenic
938540106 2:132278643-132278665 GAGCAGCCACAAGTGGAGGTTGG + Intergenic
939753957 2:146086041-146086063 CAGGAGCCAAAAATAGAGAAGGG - Intergenic
940638067 2:156321421-156321443 CAGCGGGGACAAATGGAGAGGGG + Intergenic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
947551673 2:231050928-231050950 CTCCTGCCACAAATGCAGACCGG + Intergenic
1168994901 20:2125801-2125823 CAGGAGCCACATATGCAGCCAGG + Intronic
1169773077 20:9222552-9222574 CAGCAGCCTAAACTGGAGGCTGG + Intronic
1171072953 20:22092810-22092832 CTGCAGCCCCAAATAAAGACAGG - Intergenic
1171237044 20:23535439-23535461 CAGCAGCGGCACATGGAGAGTGG - Intergenic
1171869041 20:30511664-30511686 GAGCAGCCACAAGTGGAGGTTGG + Intergenic
1172132823 20:32667100-32667122 CAGCAGCCACAGATGGTCAGTGG + Intergenic
1172183961 20:33020044-33020066 CAGGGGCCACAAATGCAGAGAGG - Intronic
1172257679 20:33534005-33534027 CAGCAACAACAAATAGAGATGGG + Intronic
1175058484 20:56219937-56219959 CAGCTCCAACCAATGGAGACAGG - Intergenic
1175998129 20:62820404-62820426 CAGAAGCCACAAGGGGAGAAAGG - Intronic
1176189181 20:63799710-63799732 CAGCAGGCACACATGGACAGAGG + Intronic
1178122449 21:29482791-29482813 TAGCAGCCACAAATGGTCAAGGG - Intronic
1178748030 21:35272377-35272399 CAGCAGCCACAAGAGGAGTGGGG + Intronic
1181081943 22:20421607-20421629 CACCAGACAGAAATGCAGACAGG - Intergenic
1183601134 22:38841262-38841284 CAGCAGCCACAGACAGAGAAGGG - Intronic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1184178278 22:42802133-42802155 CAGCAGCCAAGACTGGAGGCAGG + Intronic
950024532 3:9811070-9811092 CAGCAGCCAAAGAGGGAGAAAGG - Intronic
950767931 3:15287537-15287559 CAGTAGCCACACGTGGAGGCTGG - Intronic
951447630 3:22801358-22801380 CAGAAGCCACAAATTGGGATAGG + Intergenic
952854497 3:37757935-37757957 CAGAAACCAGAAATGGAGAGCGG + Intronic
954228656 3:49199562-49199584 CAGCAGCCAGAGGTGGGGACAGG + Intronic
956152445 3:66257936-66257958 CAGAAGCCTCAAATGGAGACTGG - Intronic
956271934 3:67457159-67457181 CAGCACCCAAAAATGGAGATTGG - Intronic
956347319 3:68294932-68294954 CAGTAGCCACAAATGGCCAATGG + Intronic
959834862 3:110906303-110906325 CATCTGCAAGAAATGGAGACAGG - Intergenic
960248932 3:115430967-115430989 CAGTAGCCACAAATGGCTAATGG + Intergenic
961146411 3:124597635-124597657 CAGTAGCCACAAATGGCCAGTGG - Intronic
961166085 3:124764840-124764862 CAGCATCCTGCAATGGAGACTGG - Intronic
962713043 3:138103490-138103512 CAGCAGCTGCTAATGCAGACAGG - Exonic
963180316 3:142348645-142348667 CAGCACAGACAAATGGACACTGG + Intronic
963568988 3:146968305-146968327 CAGAAGCCAAAAATAGAGATGGG + Intergenic
964168946 3:153744000-153744022 AAGCAGCTATAAATGGAGAGGGG + Intergenic
964595219 3:158419358-158419380 TAGCATCCACAAATAGAGAGTGG + Intronic
967612724 3:191526885-191526907 TAGCAGGCAAAAATGGAGAGGGG - Intergenic
968963738 4:3759001-3759023 AAGGACCCACAGATGGAGACAGG + Intergenic
971297004 4:25403730-25403752 CAGCAGCCACAAATGGTTAGTGG + Intronic
971478970 4:27097658-27097680 CAGCAGCCACCAGAGGCGACGGG + Intergenic
972155862 4:36160993-36161015 AAGGAGCCAAAAATGGAGACAGG + Intronic
973750344 4:54011729-54011751 CAGAAGCCACACATAGAGACTGG + Intronic
974489635 4:62548270-62548292 CATCAGCCCCAAATGAGGACGGG + Intergenic
975249123 4:72156893-72156915 CAGAAGCCAAAAATGGAAATGGG + Intergenic
975290330 4:72670729-72670751 CAGCAGCCACAACCTGAGAAAGG - Intergenic
978771770 4:112464730-112464752 CAGTAGCCACACATGGAAACAGG + Intergenic
980006099 4:127544287-127544309 CCGCAGCCTTAAATGGAAACAGG + Intergenic
980812145 4:137895907-137895929 CAGCAGCAAGAAATGCACACAGG - Intergenic
981126956 4:141118261-141118283 CAGCAGCCTCAAATGCAGGTGGG - Intronic
983354519 4:166638338-166638360 CAAAAGCCAGGAATGGAGACTGG - Intergenic
984225797 4:177033309-177033331 CAGCAGCCACTAGTGGAGAGGGG + Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
984950376 4:185003585-185003607 GTGCAGACACAAGTGGAGACGGG + Intergenic
985566057 5:618114-618136 GAGCAGCCAGAAGTGGAGGCGGG + Intronic
985754166 5:1703364-1703386 CAGCAGTCACAGATGGTGACAGG - Intergenic
986394379 5:7314097-7314119 CAGCAGCCACAAATAGGACCAGG + Intergenic
987067071 5:14300319-14300341 CAATAGCCACACATGGTGACAGG - Intronic
987110848 5:14684985-14685007 CTGCAGCCAAACACGGAGACTGG - Intronic
987345633 5:16976364-16976386 CAGCAGCCAAAAAAGGAAAGAGG + Intergenic
987374148 5:17218256-17218278 CAGCAGCCAAAGATGGAGGGTGG + Intronic
992416052 5:76552252-76552274 CAGAAGCCAGGAATAGAGACGGG - Intronic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996766361 5:127037927-127037949 CTGCAGTCACAAAGGAAGACAGG - Intergenic
996919488 5:128750844-128750866 CAGCGTCCACAGATAGAGACTGG - Intronic
999348388 5:150844483-150844505 TAGCAGCCACAGATGAAGCCTGG + Intergenic
1001053758 5:168432859-168432881 CAGCTTCCAGAAATGGAGGCAGG - Intronic
1001142810 5:169159445-169159467 CAGCAGCAAAAAACAGAGACTGG + Intronic
1001782570 5:174382752-174382774 AAGCAGCCACAGAGGCAGACCGG + Intergenic
1002940924 6:1715088-1715110 CAGCAGAAACATAAGGAGACAGG + Intronic
1003095338 6:3138668-3138690 CAGCATCCACCCATGGAGACAGG + Intronic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1004662665 6:17723865-17723887 CAGCAGCCAGAAGTGGTGGCGGG + Intergenic
1006009770 6:31032527-31032549 CAGCAGCCACAACTGCAGCCAGG - Exonic
1008401180 6:51064906-51064928 CTGCAGCCACAAAGAGGGACTGG + Intergenic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1012168362 6:95987896-95987918 CATCAGCCAGAAATGGAGAATGG - Intergenic
1012505105 6:99936459-99936481 AAGGAGCCAAGAATGGAGACAGG - Intronic
1012967360 6:105688872-105688894 CAGCAGCCACTGATGGCCACAGG - Intergenic
1013485092 6:110589243-110589265 CAGCAGCCACATGTGGCTACTGG - Intergenic
1017239010 6:152146908-152146930 CAGAAGCCAGAAATGCAGATTGG - Intronic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1020921596 7:14271789-14271811 CAGCACACACAAAAGGATACTGG - Intronic
1022148403 7:27571641-27571663 TACCAGACACAAAGGGAGACAGG - Intronic
1022838798 7:34142930-34142952 CAGTAGCCAAATATGGAGAGTGG + Intronic
1023614932 7:42010272-42010294 CCGCAGCCTCACATGGAGAGAGG - Intronic
1025024142 7:55502483-55502505 CAGCATCCACAATGGGAGCCGGG - Intronic
1028741445 7:94280249-94280271 CAGTAGCCACAAATAGCTACTGG - Intergenic
1029789800 7:102830315-102830337 AAGCAGGCACAGATGGAGACTGG - Intronic
1031903709 7:127438391-127438413 CAGCAACCAGAAATAGAAACTGG + Intergenic
1032333204 7:130999522-130999544 GAGCAACCACAAATGGAGCGGGG + Intergenic
1034453140 7:151148602-151148624 CAGCACCAACAAATGGAGCAGGG - Exonic
1035557667 8:578832-578854 CAGCAGACACTAATGGAAATGGG + Intergenic
1037613259 8:20494618-20494640 CAGCACACCCAAATGGAGAAGGG + Intergenic
1040059628 8:43093360-43093382 CAGAAGCCAGACAGGGAGACTGG + Intergenic
1041101355 8:54399132-54399154 CAGCAGCCACCAAGGAAGATGGG + Intergenic
1042704956 8:71656326-71656348 TAGCAGCCACAAATTTGGACTGG - Intergenic
1042771522 8:72387757-72387779 CAGCAGCAGCAAAGGGACACAGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1045481244 8:102593862-102593884 CAGCAGCCCTAAATGAGGACAGG + Intergenic
1045862639 8:106830200-106830222 CAGCATTGACAAAGGGAGACTGG - Intergenic
1046796773 8:118381909-118381931 CAGCAGCCAGAAATGGGGAAAGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047421250 8:124710059-124710081 CAGCTGACACAAAAGGAGGCAGG + Intronic
1047825439 8:128568938-128568960 GGGCAGCCACAAATGAAGAAAGG + Intergenic
1047902184 8:129435329-129435351 CAGAAGCCAAAAATAGAGATTGG + Intergenic
1048285532 8:133138309-133138331 CATCTACCACAAATGGAGAAGGG - Intergenic
1050169415 9:2799806-2799828 CAGCAGACATAAAGGGAGAATGG + Intronic
1053014541 9:34654457-34654479 CAGCAGATGGAAATGGAGACAGG - Intronic
1053207999 9:36204244-36204266 CAGAAGCCAAAAACCGAGACTGG - Intronic
1059528850 9:115017588-115017610 CAGCAGTGACAAAGGCAGACTGG - Intergenic
1060244236 9:121930666-121930688 CAGCAGCCACCTAGGGAGTCAGG - Intronic
1060533650 9:124365294-124365316 AAGGAGCCACAGATGGACACGGG + Intronic
1062002544 9:134223990-134224012 CAGCAGCCACCATGGGGGACCGG + Intergenic
1062218601 9:135402521-135402543 CACCAGCCACAGGAGGAGACTGG - Intergenic
1062722580 9:138052061-138052083 GAGAAGCCACAGATGCAGACAGG - Intronic
1190180171 X:48185157-48185179 CAGCAGCCCCAGGTGGAGGCAGG - Intergenic
1190193186 X:48294376-48294398 CACCAGCCCCAGATGGAGGCAGG - Intergenic
1192216654 X:69164118-69164140 CAGCAGGCACAAATGGAAGCGGG + Intronic
1195410683 X:104565848-104565870 CAGCGGCTAGAACTGGAGACTGG + Intergenic
1196042374 X:111218808-111218830 CAACAGGAAAAAATGGAGACAGG + Intronic
1197260785 X:124315193-124315215 AATCAGCCACAAAGGAAGACAGG + Intronic
1201010825 Y:9547287-9547309 CAGCAGGCTCAAATGCGGACAGG + Intergenic
1201186708 Y:11412103-11412125 CAGCAGCAACAAATGCACGCTGG - Intergenic