ID: 1085649061

View in Genome Browser
Species Human (GRCh38)
Location 11:78250750-78250772
Sequence CTCTTTGGTGGCGCCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085649053_1085649061 25 Left 1085649053 11:78250702-78250724 CCTCAGGCAAGGTCTGCCTCTAG 0: 1
1: 0
2: 0
3: 16
4: 152
Right 1085649061 11:78250750-78250772 CTCTTTGGTGGCGCCTGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 146
1085649054_1085649061 9 Left 1085649054 11:78250718-78250740 CCTCTAGAGTAATGAGTACGACC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1085649061 11:78250750-78250772 CTCTTTGGTGGCGCCTGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 146
1085649052_1085649061 26 Left 1085649052 11:78250701-78250723 CCCTCAGGCAAGGTCTGCCTCTA 0: 1
1: 0
2: 1
3: 6
4: 147
Right 1085649061 11:78250750-78250772 CTCTTTGGTGGCGCCTGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085649061 Original CRISPR CTCTTTGGTGGCGCCTGCTG TGG Intronic
900138275 1:1127980-1128002 GGCTTTGGTGGCCCGTGCTGTGG + Intergenic
900266418 1:1759533-1759555 CCCTGTGGGGGCGCCTGGTGAGG - Intronic
902681819 1:18049087-18049109 CTTTTGGGTGGTGTCTGCTGGGG - Intergenic
903071395 1:20728582-20728604 CTCTTTGATGGCGCCCTCTCAGG - Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
903666776 1:25012875-25012897 CTCTTTCCTGGGGCCTGCTCTGG + Intergenic
907515074 1:54988589-54988611 GTCTCTGGTGGTGCCCGCTGTGG + Intronic
912513670 1:110204917-110204939 CTGTCTGGTGGTGACTGCTGGGG - Intergenic
915227690 1:154422898-154422920 CTCTTTGGTAGGGCCTACTTAGG + Intronic
916536611 1:165709488-165709510 CTCAGTGGTGGCTCATGCTGAGG - Intergenic
917698569 1:177555895-177555917 CTCCTTGGTTGCCCCAGCTGTGG - Intergenic
919281616 1:195496396-195496418 TTCTTGGGTGGGGCTTGCTGTGG + Intergenic
923264681 1:232302827-232302849 CTCTTGTCTGGCCCCTGCTGGGG + Intergenic
1063392368 10:5658959-5658981 CTCTGTGGTGGTGGGTGCTGGGG - Intronic
1063609675 10:7552162-7552184 CTCTTTGGCGGGGCCTGCTAGGG - Intergenic
1066068050 10:31776735-31776757 CTCTGTGGAGGCCTCTGCTGAGG - Intergenic
1069862705 10:71481434-71481456 CTCTTTGGTGGGGCCATGTGGGG - Intronic
1074538548 10:114346046-114346068 CTCTTGGGTGCTGTCTGCTGAGG + Intronic
1075729474 10:124627733-124627755 CTCTTTGGTGGCTAGAGCTGAGG - Intronic
1076212174 10:128657604-128657626 CTCCATGGTGGGGCCTGCTGAGG + Intergenic
1079766173 11:24395984-24396006 CTCATGGGTGGCACCTTCTGTGG + Intergenic
1083203443 11:61133436-61133458 CCCTTTGGTGGACCCTGCTGTGG - Intronic
1084147413 11:67272451-67272473 CTCTTAGGTGTCTCCTGCTCGGG - Intronic
1084797491 11:71518588-71518610 CTGCTTGGCGGCGCCTCCTGCGG + Intronic
1084968901 11:72758778-72758800 CTCTTTTCTGGCTCCAGCTGTGG - Intronic
1085649061 11:78250750-78250772 CTCTTTGGTGGCGCCTGCTGTGG + Intronic
1085772042 11:79334368-79334390 CTCTTTGGTATCTCTTGCTGTGG - Intronic
1088580225 11:111308373-111308395 ATCACTGGTGGCGGCTGCTGAGG - Exonic
1089599092 11:119602615-119602637 CTCTTTGGCGGAGCTAGCTGAGG + Intergenic
1089615037 11:119690536-119690558 CCCTTTGGTGGGGGCTCCTGAGG - Intronic
1091452324 12:580686-580708 CTCTTCTGTGGCACCTTCTGGGG + Intronic
1091583294 12:1801452-1801474 CTCTTTGGGGGCACCCACTGTGG + Intronic
1091603220 12:1930231-1930253 CTCTCTGGTGGGGCCTCCTTGGG + Intergenic
1091685201 12:2556447-2556469 CTCTTGGGTGGGGGCTGTTGTGG + Intronic
1092204369 12:6606622-6606644 CTCCGTGGGGGCGCCTGCCGGGG - Intronic
1095390684 12:41702721-41702743 CTCTTTGCTGTCTCTTGCTGTGG + Intergenic
1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG + Intronic
1096648044 12:53048772-53048794 CTCTGGGGTGAGGCCTGCTGTGG - Intronic
1098500601 12:71187530-71187552 TTCTTGGGTGGGGCTTGCTGTGG - Intronic
1102962619 12:117102460-117102482 CTCTGTGGGGGCCCCTGCAGTGG + Intergenic
1109502163 13:63252176-63252198 CTCTTTGTTAGCACCTTCTGTGG + Intergenic
1109654756 13:65374893-65374915 ATCTTTTGTGGCGCCTGCTTGGG + Intergenic
1112355717 13:98673400-98673422 CTGTTTGGTGGCTTCTGCTGGGG + Intergenic
1113735061 13:112672579-112672601 CCTCTTGGTGGGGCCTGCTGGGG - Intronic
1113823695 13:113233502-113233524 CTCTTTTGTGGCACCTGGTGTGG - Intronic
1113951545 13:114074416-114074438 CTCCAGGGTGGCCCCTGCTGTGG + Intronic
1114623874 14:24115772-24115794 CACTGTGGTAGCACCTGCTGGGG - Intronic
1119899400 14:78247096-78247118 CTTGTTGGAGGCGCCTTCTGTGG + Intronic
1122066138 14:99175559-99175581 CTCTTGGCTGGCGGCTGCGGGGG + Exonic
1122925148 14:104896010-104896032 CTCTGCCGTGGCCCCTGCTGGGG + Exonic
1122930636 14:104931666-104931688 CTCTTAGGTGGTGCATGGTGGGG + Intronic
1125519312 15:40339347-40339369 CTCTTTGGTGGGGACAGCAGTGG + Intronic
1127089989 15:55457389-55457411 CCCTTGGGTGGGGCTTGCTGTGG - Intronic
1133390747 16:5408016-5408038 CTCCTGTGTGGCCCCTGCTGAGG + Intergenic
1140566539 16:76049221-76049243 CTGTTTGCTGGCGTCTCCTGGGG - Intergenic
1140658480 16:77164695-77164717 GTCTTTGGTGGGGCCAGGTGTGG + Intergenic
1141062877 16:80890944-80890966 CTCTTTGATGGCTTCAGCTGTGG - Intergenic
1141995983 16:87636565-87636587 CGCTTTGGTGCCCTCTGCTGTGG + Intronic
1142401494 16:89860983-89861005 GTCTCTGCTGCCGCCTGCTGGGG + Intronic
1142487811 17:258204-258226 CTGTTTGGTGGAGCCTGGTGGGG - Intronic
1143473110 17:7188482-7188504 ACCTTTGGGGGCACCTGCTGGGG - Intergenic
1146468142 17:33103525-33103547 CTCTTTGGTGGCTCATTCAGGGG + Intronic
1146530115 17:33601424-33601446 CTCTTTGGTTGCCCCAGCTGTGG + Intronic
1147559639 17:41500939-41500961 TTCTTAGGTGGCCCCTGCTAGGG - Intergenic
1148847122 17:50535947-50535969 CTCTTAGGTGGGGCTTCCTGGGG + Intronic
1149154543 17:53610858-53610880 CTGTTTGGTGTGGTCTGCTGGGG - Intergenic
1149290416 17:55213091-55213113 CTCTCTGCTGGAGGCTGCTGTGG - Intergenic
1150249376 17:63697789-63697811 CTCTATTGTGTGGCCTGCTGGGG - Exonic
1151465412 17:74281801-74281823 CTCCATGGTGCCGGCTGCTGGGG - Exonic
1151542731 17:74772978-74773000 CTCTTCGGTGGCGCCTGGCTGGG + Exonic
1155059968 18:22219723-22219745 CTCTTTGGCGGGGCCTGGAGAGG + Intergenic
1155312400 18:24536659-24536681 CTCTCTGGTGGTGCCTCCTAAGG - Intergenic
1158691394 18:59664314-59664336 CTCTTTGGAGGCCTTTGCTGTGG - Intronic
1161112573 19:2478419-2478441 GTCGGTGGCGGCGCCTGCTGCGG - Intergenic
1161246171 19:3253504-3253526 CTCTTTGGTTACGTGTGCTGGGG - Intronic
1161723191 19:5914835-5914857 CTGTTAAGAGGCGCCTGCTGGGG + Intronic
1163237095 19:16036195-16036217 CTCTGTGGTGGCACCAGCTGCGG + Intergenic
1168450178 19:56460339-56460361 CTCTCTGGTTGTGCCTGCTCTGG - Intronic
926117662 2:10223609-10223631 CTCTGTGGTGGGGGCTTCTGGGG + Intergenic
927859326 2:26550712-26550734 CTCTCTCATGGCGCCTGCTGAGG + Intronic
928317877 2:30259745-30259767 CTCAGCGGTGGAGCCTGCTGGGG + Exonic
930772295 2:55140493-55140515 CTAACTGGTGGCGGCTGCTGTGG + Intergenic
936998362 2:118438734-118438756 ATCAGTGGTGGCTCCTGCTGTGG + Intergenic
941994973 2:171593733-171593755 GTCTTCGGTGGCACCTGCGGGGG + Intergenic
948991648 2:241558799-241558821 CTCTTGGGGGGCTCCTGCCGCGG - Exonic
1171006461 20:21470490-21470512 CTCTTTGCTGGCGCCTTTTATGG - Intergenic
1171437852 20:25136873-25136895 CTCTTGGGTGACTCATGCTGGGG - Intergenic
1172762835 20:37334039-37334061 CCCTCTGGGGGCACCTGCTGGGG - Intergenic
1172975431 20:38902659-38902681 CTCTTGGGTGATGCCTGCAGTGG - Exonic
1175252227 20:57616602-57616624 CTCTTAGGGGGCATCTGCTGGGG - Intronic
1178891699 21:36525520-36525542 ATCTTTGGTGTCCCCTGTTGTGG - Intronic
1181082084 22:20422852-20422874 CCCTTTTGTGGCGCCTGCCCTGG + Intergenic
1181639577 22:24189580-24189602 CTCTTTGTCGGCGCTTCCTGTGG + Intergenic
949507625 3:4742007-4742029 GTCTCTGGGGACGCCTGCTGGGG - Intronic
960173651 3:114492068-114492090 CTTCTTGGTGGCTCCTTCTGAGG + Intronic
961530374 3:127536796-127536818 CTCTGTGGGGGTGTCTGCTGTGG + Intergenic
961624935 3:128255212-128255234 CTCTTTGGGGAGGCCTGCAGTGG + Intronic
961745562 3:129061774-129061796 GTCCTTGGTGGCCTCTGCTGTGG - Exonic
961978077 3:131047932-131047954 TTCTTGGGTGGGGCTTGCTGTGG + Intronic
963104497 3:141635184-141635206 CTCTTTGGTTTCGGCTTCTGAGG - Intergenic
965187396 3:165482725-165482747 CTTTCTGGTGGCCCCTGATGTGG + Intergenic
965925340 3:173972046-173972068 CTCTTTCTTGGGGCCTTCTGTGG - Intronic
969671296 4:8591816-8591838 CTCCTTGTTGTCCCCTGCTGTGG - Intronic
971472300 4:27040292-27040314 CCCTTGGGTGGGGCTTGCTGTGG + Intergenic
975005975 4:69286692-69286714 TTCTTTAGTAGTGCCTGCTGTGG + Intronic
975014391 4:69395633-69395655 TTCTTTAGTAGTGCCTGCTGTGG + Intronic
975492463 4:75003744-75003766 GTCTTTGGTGGGCTCTGCTGAGG - Intronic
977939123 4:102839380-102839402 CTCTTTGGTGGTGGTGGCTGAGG - Intronic
987899309 5:23990342-23990364 CTCTTTGGTGGCTGCCACTGTGG + Intronic
990308732 5:54518280-54518302 CTCGGAGGCGGCGCCTGCTGTGG - Exonic
992350864 5:75927890-75927912 GTCTTTGGTGGCTCCTGTAGAGG - Intergenic
994245569 5:97471851-97471873 CTCCTTGGGTGCACCTGCTGGGG - Intergenic
997410249 5:133685603-133685625 CTCCTGGGTGGGGCCTGCGGAGG - Intergenic
998211505 5:140202542-140202564 CTCCTTGTTGGCACCTACTGAGG + Intronic
1005368840 6:25108340-25108362 CTCTTTCTTGGCTCCTCCTGAGG + Intergenic
1006163229 6:32049922-32049944 CTCTTTGGTGATGACTGGTGGGG - Intronic
1006164479 6:32056509-32056531 CTCTTTGGTGATGACTGGTGGGG - Intronic
1006165483 6:32062080-32062102 CTCTTTGGTGATGACTGGTGGGG - Intronic
1006166435 6:32068313-32068335 CTCTTTGGTGATGACTGGTGGGG - Intronic
1010083427 6:71888320-71888342 CTCCTTGGTGTCCCCTGCTTAGG + Intronic
1010714097 6:79208063-79208085 CTATTTGGTGTCTCCTTCTGTGG - Intronic
1011366113 6:86584530-86584552 TTCTTGGGTGGGGCTTGCTGTGG + Intergenic
1012894018 6:104928422-104928444 CTCTTTAGTGACGCCTGAAGTGG + Intergenic
1014658882 6:124141691-124141713 CTCATTGCTGGCTTCTGCTGAGG + Intronic
1017159735 6:151353547-151353569 CTCTTTGGTTAAGCCTCCTGAGG - Exonic
1018652398 6:166003122-166003144 CTCCTGGGTGCAGCCTGCTGGGG - Intergenic
1019721447 7:2574727-2574749 CTCTTTGGTTACGGCTGCTCAGG + Intronic
1023275041 7:38509850-38509872 CTGTTCGGTGTCTCCTGCTGTGG + Intronic
1024056517 7:45662996-45663018 CCCTTTGATGGCTCCTGCAGTGG - Intronic
1024309021 7:47952261-47952283 CTCCTTGGTGCAGCCTGCTCTGG - Intronic
1024367297 7:48535664-48535686 TCCTTTGGTGGGGCTTGCTGTGG + Intronic
1024455776 7:49605054-49605076 CTCCTTGGTGGGGCTTGTTGTGG - Intergenic
1027241933 7:76336339-76336361 CCCTCTGGTGGGGGCTGCTGAGG + Intronic
1027266106 7:76496111-76496133 CGCTTTGGTGTCTCCTGCTGAGG + Intronic
1031775582 7:125905097-125905119 CACTGTGGTGGCCACTGCTGTGG + Intergenic
1032516819 7:132512639-132512661 CTCTGTGGTGGTTCCTGGTGGGG - Intronic
1036010480 8:4716177-4716199 CCATTGGGTGGCGCCTGCTCAGG - Intronic
1037992552 8:23331155-23331177 CTCTTTGTTGAGACCTGCTGTGG - Intronic
1038282399 8:26177906-26177928 CTCTTGGATGGCTCCTTCTGGGG - Intergenic
1040820143 8:51546985-51547007 TTCTTTGGTGGGGCTTGCTGCGG - Intronic
1043556755 8:81439248-81439270 TTCTTGGGTGGGGCTTGCTGTGG + Intergenic
1043876424 8:85491657-85491679 TTCTTGGGTGGGGCTTGCTGTGG + Intergenic
1049432770 8:142573018-142573040 CTCTTAAGTGGAGCCTTCTGTGG + Intergenic
1055187115 9:73470694-73470716 TCCTTTGGTGGGGCTTGCTGTGG + Intergenic
1055954794 9:81763529-81763551 CTCTTTTGTAGGGTCTGCTGAGG + Intergenic
1056942226 9:90965374-90965396 TTCTTAGGAGGCGCCTGCTGAGG - Intergenic
1059505226 9:114792617-114792639 GTCCTTGGTGGTGCTTGCTGCGG - Intronic
1061184491 9:129044425-129044447 CTATTTTGTGGCTGCTGCTGTGG + Intronic
1061720798 9:132550082-132550104 GTCTGTGGTGGGGCCTGCAGAGG + Intronic
1062462681 9:136668453-136668475 CTCCCTGGGGGCTCCTGCTGAGG + Intronic
1062494415 9:136825060-136825082 CTCTGTTGTGGGGCGTGCTGGGG - Intronic
1190789545 X:53686345-53686367 CTCTCCGCTGGCGCCTGCCGAGG + Intronic
1191669754 X:63738295-63738317 CTCATTGGTGGCCTCTGCAGAGG + Intronic
1192118853 X:68435896-68435918 CACTTTGGTGGGGGCTGCAGTGG - Intergenic
1192609653 X:72554711-72554733 TCCTTGGGTGGGGCCTGCTGTGG - Intronic
1193350479 X:80457852-80457874 CTCTGTGGTGCAGCCTGCTGAGG - Intergenic
1196193748 X:112819279-112819301 CTATTGGGTGGCACCTGCTCTGG - Intronic
1196617891 X:117788411-117788433 CTCTTTGGAGTAGCATGCTGTGG - Intergenic
1199161322 X:144615336-144615358 CTCTTTGGTACCTCCTGATGGGG + Intergenic
1200982203 Y:9272680-9272702 CTCTCAGGTGGGGCCTCCTGCGG - Intergenic
1201194249 Y:11476053-11476075 CTCATAGGTGGCTCCTTCTGAGG + Intergenic