ID: 1085655419

View in Genome Browser
Species Human (GRCh38)
Location 11:78310144-78310166
Sequence CTGAGAAATGTGGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 532}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085655410_1085655419 2 Left 1085655410 11:78310119-78310141 CCACCTACAATTTCAATACACGC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG 0: 1
1: 0
2: 3
3: 58
4: 532
1085655409_1085655419 3 Left 1085655409 11:78310118-78310140 CCCACCTACAATTTCAATACACG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG 0: 1
1: 0
2: 3
3: 58
4: 532
1085655411_1085655419 -1 Left 1085655411 11:78310122-78310144 CCTACAATTTCAATACACGCCTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG 0: 1
1: 0
2: 3
3: 58
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085655419 Original CRISPR CTGAGAAATGTGGGGGTGGA GGG Intronic
900825342 1:4921655-4921677 TTGAGATATGTGAGTGTGGATGG - Intergenic
901232782 1:7650522-7650544 CTGGAAAAGGCGGGGGTGGAGGG - Intronic
901335296 1:8443978-8444000 AGGGGAAATGTGGGGTTGGAGGG + Intronic
902237845 1:15068988-15069010 CTGAGAACTGCTGGGGTAGATGG - Intronic
902639395 1:17756888-17756910 GTGAGAACTGTGGGGTGGGATGG + Intronic
902876212 1:19342379-19342401 CTGAAGCATGGGGGGGTGGACGG + Intronic
903117470 1:21190026-21190048 CTGAGAAATATGGGAGAAGAAGG + Intergenic
903305172 1:22408196-22408218 CTGAGAATAGAGGGGGTGGAGGG + Intergenic
903602346 1:24551919-24551941 CTGTGAAATGACGGGTTGGACGG - Intergenic
903739769 1:25552063-25552085 CAGAGAAATGTGGGTGTACAAGG + Intronic
903796076 1:25929851-25929873 CTGTGGAATGTGGGGTTGGGGGG - Intergenic
904983747 1:34527622-34527644 CGCAGAAAGGTGGGAGTGGAAGG - Intergenic
905334523 1:37235249-37235271 AAGAGGAATGTGGGAGTGGAGGG + Intergenic
905399865 1:37693207-37693229 ATGAAAAATGGGGGGGTGGTTGG + Intronic
907311420 1:53541110-53541132 CTGAGAGAGTTGGGGGTGGGAGG + Intronic
907523137 1:55038191-55038213 CTGAGGGAGGTGGGGGAGGAAGG - Intergenic
909481479 1:76132135-76132157 CTGTGCCCTGTGGGGGTGGACGG - Intronic
909905557 1:81190409-81190431 CTGGGAAATGTGGGTGAGTATGG + Intergenic
910197633 1:84660290-84660312 CTGAGTAATGGGGGTGAGGAGGG + Intronic
910263685 1:85315905-85315927 CTTAGAAATGAGGGTTTGGAGGG + Intergenic
911189782 1:94936301-94936323 GTGAGAGTTCTGGGGGTGGAAGG + Intergenic
911509649 1:98795654-98795676 CTGAGGAAGATGGGGGTTGAGGG + Intergenic
912404719 1:109426972-109426994 TTGAGAAAAGTGGGGGGCGAGGG + Intergenic
912435884 1:109660695-109660717 CTGAGGGATTTGGGGGAGGATGG + Intronic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912839350 1:113025336-113025358 CTGGAAAATGTGGGGCTGGTGGG + Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
915591835 1:156875281-156875303 CTGGGCTCTGTGGGGGTGGAGGG + Intronic
915998620 1:160591681-160591703 CTGGGGATTGTGGGGGTTGATGG - Intergenic
917067064 1:171108291-171108313 ATATGAAATGTGGGGGAGGAGGG + Intronic
917148167 1:171914908-171914930 TAGAGACATGTGGGGGTGGGGGG + Intronic
917278927 1:173360767-173360789 GTGAGAAATTAGGGGGTGGAAGG + Intergenic
919672615 1:200351487-200351509 CTGAGAAAGGTAGGAGGGGAGGG - Intergenic
919794421 1:201312654-201312676 CTCAGAAAAGTGGAGGAGGATGG - Intronic
920217015 1:204368055-204368077 ATGAGAGATATGGGAGTGGACGG + Intronic
920406592 1:205718313-205718335 CCGAGAAATCTGGGGATGAAGGG - Exonic
920707684 1:208266505-208266527 CTGGGAAAGGTGGGAGAGGAGGG - Intergenic
921728722 1:218553122-218553144 CAGAGAAATGTGGGTGTCTAAGG - Intergenic
921991678 1:221373391-221373413 GTGAGAAATGTGTTGGAGGAAGG + Intergenic
922251217 1:223850246-223850268 CTGAGGAATGAGGGGAGGGAGGG + Intergenic
922455690 1:225771803-225771825 CTGAGAACAGTGGGGAGGGAAGG - Intergenic
922819238 1:228472510-228472532 CTAAGAATTGATGGGGTGGAGGG + Intergenic
923000298 1:230001640-230001662 CTGAGAAATGGGGGTGTGAGGGG - Intergenic
923042188 1:230327340-230327362 GTGAGAGTTGTGGGGGTGGGAGG - Intronic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923960535 1:239077759-239077781 CTGAGAATTGTGGTGGTGGTAGG + Intergenic
924808197 1:247378487-247378509 CTGACAGATTTGGAGGTGGAGGG + Intergenic
924824645 1:247526584-247526606 CTGAGAAATGTGGAGAGTGAAGG - Intronic
1062821942 10:541468-541490 AGGAGAGATATGGGGGTGGAGGG - Intronic
1063602338 10:7493730-7493752 TAGAGCAATGTGGGAGTGGACGG - Intergenic
1065719413 10:28611648-28611670 CTGGGTAATATGGGGGTGGGGGG + Intronic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1066498881 10:35970945-35970967 CTCAGACGTGTGGGGGTGGGGGG - Intergenic
1067104979 10:43360638-43360660 CTGAGTAATATTTGGGTGGATGG - Intergenic
1067920199 10:50447926-50447948 CTGTGGAATTTGGGGGTGAAGGG - Intronic
1069158454 10:65058040-65058062 CTGAGAAATGTGAGTGGGGGAGG - Intergenic
1070121421 10:73581022-73581044 CTGAGAAATGTGGTGTTAGGTGG - Intronic
1070682224 10:78456651-78456673 CAAAAAAATGGGGGGGTGGATGG + Intergenic
1070935305 10:80289602-80289624 CTGAGAAGGGAGGGAGTGGATGG + Exonic
1070984225 10:80674208-80674230 TTGTGAAATGTGGAGGTGGGAGG - Intergenic
1071630001 10:87212115-87212137 CTTTGGAATGTGGGGGTGGCTGG + Intergenic
1071987529 10:91067428-91067450 CTGAGAGAGGTGGTGGTGGCAGG + Intergenic
1072220763 10:93325826-93325848 CTGGGAAATGTTGGGCTGGAAGG + Exonic
1072917160 10:99545098-99545120 CTCAGAAGAGTGGGGGAGGATGG - Intergenic
1073476285 10:103756128-103756150 CTGGGAACTGTGGAGGTGAAGGG + Intronic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1073679169 10:105683297-105683319 GTGAGAAATCCTGGGGTGGAGGG - Intergenic
1074552173 10:114454469-114454491 ATGAGAAAGGAGGGTGTGGAAGG + Intronic
1075538688 10:123294342-123294364 CTGAGGAAGATGGGGGTGGGGGG - Intergenic
1075749100 10:124750672-124750694 CTAAGAAATGTGGGTATGGTGGG - Intronic
1075850635 10:125583936-125583958 CTGACAGATTTGGGGGTGGTGGG - Intronic
1076209374 10:128628067-128628089 CTCAGAAATGTGGGCCTGGTGGG - Intergenic
1076355710 10:129851345-129851367 CTGACAGATGTGAGGGTGGGGGG - Intronic
1076815402 10:132912126-132912148 GAGAGAGATGTGGGGGTGGGGGG - Intronic
1076910320 10:133384716-133384738 ATGAGTGATGTGGGGATGGAGGG + Intronic
1077283156 11:1754489-1754511 CAGAGGGATGTGGGGATGGAGGG + Intronic
1078055240 11:8003827-8003849 GTGAGAAATGGTGGGGTGGTGGG - Intergenic
1078325713 11:10379105-10379127 CTGGGGAATGTGGTGGTGGTAGG + Intronic
1078426991 11:11260046-11260068 ATGGGAAAGATGGGGGTGGAAGG - Intergenic
1079015077 11:16861993-16862015 CTGAGAAGAGGGGGTGTGGAGGG - Intronic
1079354428 11:19718047-19718069 CTGGGAAGGGTGGGGGTGGGTGG - Intronic
1080395300 11:31884627-31884649 CTGAGATATTTGTGGGTTGAGGG - Intronic
1080633710 11:34105209-34105231 ATCAGTACTGTGGGGGTGGAGGG + Intergenic
1080696439 11:34606733-34606755 CTTAGAAATTTGAGGGTGGAAGG - Intergenic
1081542835 11:44048730-44048752 GGGAGGGATGTGGGGGTGGATGG - Intronic
1082132114 11:48503604-48503626 CTGAAAAAGCTGGGGGTAGAAGG + Intergenic
1082819739 11:57537037-57537059 CTGAGAGATTTGGAGGGGGAGGG - Intergenic
1083257308 11:61504560-61504582 CTGAGAAATGTGTGGGGGGTGGG - Intergenic
1083619155 11:64040470-64040492 CTGAGAGAGCTGGGGATGGATGG - Intronic
1083735219 11:64676288-64676310 CTGAGAAGTGAGGGAGGGGATGG + Intronic
1083961532 11:66017405-66017427 CTGACAAATGGGTGGGTGGAGGG - Intronic
1083968289 11:66056686-66056708 CCTGGAAGTGTGGGGGTGGAGGG + Intronic
1084302657 11:68261635-68261657 CTCAGAAATGTGAGGGGGGCGGG - Exonic
1084567444 11:69939494-69939516 CTGGGAAATGTGTGTGTTGAGGG - Intergenic
1084873241 11:72111806-72111828 CAGCCAAATGTCGGGGTGGAGGG + Intronic
1084937345 11:72594178-72594200 CTGATGGATGAGGGGGTGGATGG + Intronic
1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG + Intronic
1086398355 11:86440554-86440576 CAGAGAAATGTGGGTGGGGAGGG - Intergenic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1088121734 11:106378205-106378227 CTGTTAAATGAAGGGGTGGAGGG - Intergenic
1088706175 11:112466473-112466495 CTGAGAGAAGTGGGGGTGCAGGG + Intergenic
1088751754 11:112847944-112847966 CCTAGCAAGGTGGGGGTGGAGGG - Intergenic
1089576466 11:119447858-119447880 CAGAGAAAGGTGGGTGGGGAAGG - Intergenic
1090076707 11:123584366-123584388 CTGAGAAATGGGAGGGGGAATGG + Intronic
1091155864 11:133372014-133372036 CTGAGAAGGGTGTGGGGGGAGGG + Intronic
1091206679 11:133826045-133826067 CTGAGAAAGATTGGGGTGCATGG - Intergenic
1091238608 11:134037577-134037599 TTGTGAAATGAGGGGGCGGAGGG - Intergenic
1091781221 12:3215702-3215724 CTGGGAAGTGTGGGGGTGGGAGG + Intronic
1092163560 12:6329244-6329266 CAGAAAAAAGTGGGGTTGGAAGG + Exonic
1092241885 12:6840663-6840685 CTGAGAGAGGAGGGGGTGAAGGG - Intronic
1092686334 12:11051249-11051271 CTGAAAAATCTGGGGTTGGCAGG + Intronic
1092728495 12:11507297-11507319 CTGAGCAAAGTGGGGGAGGGTGG - Intergenic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1095954301 12:47797605-47797627 CTGGGCAATGTGGGGCTGGTAGG + Intronic
1097369267 12:58757001-58757023 CTGGGAGATGTGGAGGTGGCAGG + Intronic
1097691071 12:62735122-62735144 CTGTGAAATGTTTGGGCGGAGGG + Intronic
1097902286 12:64885244-64885266 CTCAGTAATGTGGGGGTAGGAGG - Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1100016762 12:90020610-90020632 AAGAGAGGTGTGGGGGTGGAGGG + Intergenic
1100540578 12:95553386-95553408 TGTAGAGATGTGGGGGTGGAGGG + Intergenic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102676634 12:114664019-114664041 CTGACGTATGTGGAGGTGGAAGG + Intergenic
1102683967 12:114709920-114709942 ATGAGCAATCTGGGGGTGGAGGG + Intergenic
1102962325 12:117100664-117100686 ATGATAAATGTTGGGGAGGAAGG + Intergenic
1104292227 12:127481313-127481335 CTGAGAAGTGAGGTGGTTGATGG + Intergenic
1104620994 12:130312844-130312866 ATGAGAGATGTGGGGGGGGGGGG - Intergenic
1104979108 12:132565279-132565301 CTGGGAATGGCGGGGGTGGAGGG - Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106369648 13:29118859-29118881 CTGGGAAGTGAGGGAGTGGACGG + Intronic
1106443467 13:29801482-29801504 CTGAAAAATGCGGGGGTTGAGGG - Intronic
1107646010 13:42495209-42495231 CTGAGAAATATGCTGGAGGAAGG - Intergenic
1107826327 13:44332010-44332032 CTGACAAAGGAGGTGGTGGAGGG - Intergenic
1107851209 13:44575481-44575503 CTGAGGAAGGTGGGGCTGGTTGG + Exonic
1107860394 13:44655098-44655120 CTGAGAAATGTAGGCTTGGGTGG - Intergenic
1108633777 13:52312514-52312536 TTGAGAGAAGTGGGGATGGATGG + Intergenic
1108634192 13:52316214-52316236 TTGAGAGAAGTGGGGATGGATGG + Intergenic
1108728478 13:53206945-53206967 CTGGGAAATGTGAGGGTAAAGGG - Intergenic
1108747813 13:53413027-53413049 CTGAGAGTTTTGGGGGTGGGAGG - Intergenic
1110415799 13:75250923-75250945 CTGGGAACTGTGGTGGAGGATGG - Intergenic
1110981956 13:81911526-81911548 CTGAGGAATGAAGGGCTGGAAGG - Intergenic
1111128966 13:83949630-83949652 CAGAGACATGTGTGGGTGGGTGG + Intergenic
1111842857 13:93472553-93472575 CTGGAAAATGTGGGGGTGCCCGG + Intronic
1112207360 13:97337916-97337938 CTGAGAAACAGGGGAGTGGATGG - Intronic
1112927728 13:104697116-104697138 CAGAAAAATATGGGGGTGGGAGG - Intergenic
1113642380 13:111967102-111967124 GTGACAAGTGTGGGGGTGGCAGG + Intergenic
1114454236 14:22845080-22845102 CGGCGGAAGGTGGGGGTGGAAGG - Intronic
1114553975 14:23551071-23551093 AAGAGAGATGCGGGGGTGGAGGG - Intronic
1114787605 14:25619041-25619063 ATGAGAAATGAGGCGGTGGTGGG + Intergenic
1114989737 14:28272235-28272257 AAGAGAAATGTGGGGTTGGTGGG - Intergenic
1115300609 14:31881130-31881152 CTGAGAAAAGTTGAGCTGGAAGG + Intergenic
1116001062 14:39243294-39243316 ATGAGAAATGTGGGGATAAAAGG - Intronic
1116950102 14:50871711-50871733 GTGAGGATTTTGGGGGTGGATGG + Intronic
1117320433 14:54617481-54617503 CAGAGAAAAGTGGGGGAGCAAGG + Intronic
1117566739 14:57001366-57001388 CCGGGGATTGTGGGGGTGGAGGG - Intergenic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1119686887 14:76640200-76640222 CTGAGAAATATGTCAGTGGAAGG - Intergenic
1120255915 14:82119377-82119399 CTTAGAAAGGTGGGCTTGGAGGG - Intergenic
1120902854 14:89590783-89590805 CACAGAAAGGTGGGGATGGAGGG - Intronic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121902327 14:97705078-97705100 ATGAAAAAAGTGGGGGTGGGAGG - Intergenic
1122145375 14:99685426-99685448 CTGAGAAGTCTGGGGCTGGGTGG - Intronic
1122595093 14:102885049-102885071 CTGAGAAAGAAGGGAGTGGAGGG - Intronic
1122921123 14:104880608-104880630 GTGAGGAATGTGGGTGTGCAAGG - Intronic
1124804179 15:32864409-32864431 CTGAGAAATGTGGGCTTTGAAGG - Intronic
1126157866 15:45582206-45582228 CTGAAATCTGTGGGGGTAGAGGG + Intergenic
1126271179 15:46818560-46818582 ATGAGAAATGTGGCAATGGATGG - Intergenic
1128646221 15:69380634-69380656 CTGAGAAAGGTGGGGGATGAAGG + Intronic
1128744770 15:70105876-70105898 CTGAAAGATGTCAGGGTGGAAGG + Intergenic
1129535934 15:76313712-76313734 CTGAGACCTATGGGAGTGGAAGG + Intergenic
1130794797 15:87196730-87196752 CTGAGAAATGTGTGGGTCCTGGG + Intergenic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1132347311 15:101116132-101116154 CTGAGAACAGTGGTGGGGGAAGG - Intergenic
1133357630 16:5148253-5148275 CTGTGAGGTGTGGGGGTGCAGGG - Intergenic
1133429709 16:5725946-5725968 CTCAGAAATGTGGGTTTGTATGG - Intergenic
1133970543 16:10564689-10564711 CTGAGAATGGTGGTGGTGGATGG - Intronic
1134270843 16:12731674-12731696 CTGACAAATGCGGGGGAGGGAGG - Intronic
1134502437 16:14779737-14779759 CTGAGAACTGTGGTGGCAGAGGG - Intronic
1134578125 16:15349157-15349179 CTGAGAACTGTGGTGGCAGAGGG + Intergenic
1135379153 16:21979379-21979401 CTGAGAAATGTGGTGTTAGGTGG + Intronic
1135575198 16:23580329-23580351 CTGAGAGATGAGGTGGTCGAAGG - Intergenic
1135923461 16:26671916-26671938 CTGAGAAAGGTGGTGGGGGGGGG - Intergenic
1136279262 16:29198409-29198431 CAGATGAATGTGTGGGTGGATGG + Intergenic
1137458116 16:48633809-48633831 CTGAGGAATGTTGTGGGGGATGG + Intergenic
1137592672 16:49703420-49703442 CTGAAAAATGTAGGGCTGGGTGG - Intronic
1138020034 16:53470464-53470486 CTGAGCACTGAGGGGCTGGATGG - Exonic
1139626611 16:68194768-68194790 TTGAGAGATTTGGGGGTAGAGGG + Intronic
1140576360 16:76174544-76174566 CTGAGGGATCTGGGGGAGGAAGG + Intergenic
1141167368 16:81669467-81669489 GTGAGAGAGGTGGGTGTGGAAGG - Intronic
1141793562 16:86252996-86253018 CTCTGAAGGGTGGGGGTGGAGGG - Intergenic
1142083650 16:88164510-88164532 CAGATGAATGTGTGGGTGGATGG + Intergenic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1142697337 17:1640686-1640708 GTGGGAACAGTGGGGGTGGATGG + Intronic
1143090971 17:4448971-4448993 CTCAGAAATGTTGGGGAGGCTGG + Intronic
1143093377 17:4462885-4462907 CTGAGAAGTGAAGGGATGGATGG - Intronic
1143633863 17:8153280-8153302 CAGAGAAATGTGGGGTGGCAAGG + Intronic
1143674535 17:8422298-8422320 CAAAAAAAGGTGGGGGTGGAGGG - Intronic
1143962024 17:10729338-10729360 TTGAGACTGGTGGGGGTGGAGGG - Intronic
1144270259 17:13608446-13608468 TTGAGAAACGTGGGGCAGGAGGG + Intergenic
1144379577 17:14681041-14681063 CTGAGAAACGTGGGGAGGGAGGG - Intergenic
1145972287 17:28963447-28963469 CTGAGACATGTGGCAATGGAAGG - Intronic
1146097661 17:29947408-29947430 CTCAGAAGTGGGAGGGTGGAAGG + Intronic
1146791464 17:35753035-35753057 CTGAGGAATGTGGGGGGGCAGGG - Intronic
1147794707 17:43034159-43034181 CTGAGGAAGGTGTGGGGGGAGGG + Intergenic
1147934167 17:44001991-44002013 CTGAGAAGTGTGTGTGTGGCCGG + Intronic
1147978774 17:44262276-44262298 CTGAGAAATGAGGGGCTTGTGGG - Intronic
1147980808 17:44272844-44272866 CTGAGCAGTCTGGGGGTGGATGG + Intergenic
1148326450 17:46786063-46786085 CTGTGAAATGAAGGGGTGGGGGG - Intronic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148549466 17:48542004-48542026 CTGAGAAATGTGGCGCTGCCGGG - Intronic
1148588722 17:48799513-48799535 ATGTGAAATGAGGGGATGGAGGG - Intronic
1148765242 17:50035070-50035092 CTTCTAAATGTGAGGGTGGAAGG + Intergenic
1149128568 17:53266671-53266693 ATGAGAAAAGTGTGGGTGGAAGG - Intergenic
1150829270 17:68504685-68504707 CTGGGAAGTGTAGCGGTGGAGGG + Intergenic
1151149837 17:72075646-72075668 CTGTGAAATGAGGGGCTGGTTGG - Intergenic
1151554044 17:74837671-74837693 TTGGGCAATGTGGGGTTGGATGG + Exonic
1151912401 17:77092495-77092517 CTGAGTAATATGTGGCTGGAGGG + Intronic
1152045285 17:77930975-77930997 CTGAGAACTGGGGGAGAGGAAGG + Intergenic
1152091103 17:78248358-78248380 CTGAGTGTTGTGGGGGTGAAGGG + Intergenic
1152095946 17:78271669-78271691 CTGAGATATGTGGAGGGGAAGGG + Intergenic
1152577992 17:81151322-81151344 CTGGGGGATGTGGGGGAGGAGGG - Intronic
1152983224 18:298406-298428 GAGAGAAATGAAGGGGTGGAGGG - Intergenic
1154344261 18:13529179-13529201 CTGCCAAATGAGGGGGTGGCTGG - Intronic
1155160503 18:23191532-23191554 TTGGGAACTGTGGGGGTGGAAGG + Intronic
1155929310 18:31689313-31689335 CAGAAAACTATGGGGGTGGAAGG + Intergenic
1155974574 18:32115236-32115258 CTAAGAAATAAGGGGGAGGAAGG - Intronic
1156794632 18:41028709-41028731 CTGAGAAATGCAGAGGTGCAGGG - Intergenic
1157137957 18:45076050-45076072 CTGAGAAATGTGGTAGAGTAGGG - Intergenic
1157505515 18:48223393-48223415 CTGAGAAAGATGGGGTTGGGGGG - Intronic
1157554391 18:48603556-48603578 TGGATAAATGGGGGGGTGGATGG + Intronic
1157556300 18:48615271-48615293 CTGAGAGCTGTGGAGGTGGACGG + Intronic
1157619333 18:49007061-49007083 CTGAGAGAGGAGTGGGTGGAAGG - Intergenic
1157690625 18:49678927-49678949 CTTAGAAACGTGGGAGAGGAAGG + Intergenic
1158267552 18:55677012-55677034 CTGAGAAATGTGGTGGTGGGGGG + Intergenic
1158392277 18:57053216-57053238 CTGAGAGAAGTGGGGATGGCTGG - Intergenic
1159598497 18:70406224-70406246 GTGAGAAATGGGGAGATGGAGGG + Intergenic
1159882894 18:73876359-73876381 CTCAGAAAAGTGATGGTGGAGGG - Intergenic
1161249115 19:3270921-3270943 CAGAACAAGGTGGGGGTGGAGGG + Intronic
1161681957 19:5684608-5684630 CTGAGAAGGGTGGAGGGGGAGGG + Intronic
1161754510 19:6122204-6122226 CAGAGAAATGTGGCAGCGGATGG - Intronic
1161805412 19:6440607-6440629 CTGTGAAGTGTGGGGATGCAGGG + Exonic
1161814236 19:6489548-6489570 CTGGGAAATGTAGGGGTTGGAGG - Intergenic
1161899219 19:7105310-7105332 CAGACAAATGGGTGGGTGGATGG + Intergenic
1162103077 19:8352447-8352469 ATTAGGAATGTGGGGGAGGAGGG - Intronic
1162214398 19:9121228-9121250 ATAAGAAATGTGGTGGTGGTCGG + Intergenic
1162733586 19:12733586-12733608 TTGCCAAATGTGGGGGTGGAGGG + Intronic
1162974957 19:14203312-14203334 GGGAGAAAGGAGGGGGTGGAGGG + Intronic
1162997950 19:14348433-14348455 CTGAGAAGAGTGGGGGTGGTGGG - Intergenic
1163177029 19:15571634-15571656 CTGAGAAGTTTGGGGGTGTGTGG + Intergenic
1163518077 19:17776732-17776754 CGGAGACATGGGGAGGTGGAGGG - Intronic
1163765145 19:19159628-19159650 CTGAGCGATGTGGGGGTGAGGGG + Intronic
1164704444 19:30309935-30309957 ATGAGAAAAGTGGGTGGGGAGGG + Intronic
1165333668 19:35154909-35154931 CAGAGAGATGTGGGCGTGGATGG - Exonic
1165354282 19:35294020-35294042 CAGAGAACTGTGGGGAGGGAAGG - Intronic
1166706547 19:44911195-44911217 CTGAGAACTGAGGGGGTGGGAGG - Intergenic
1166824896 19:45602419-45602441 CTGATAAATTTGGGGGTGTGTGG - Intergenic
1167092082 19:47351447-47351469 CTGAGAAGTGGGGGGTTGAAGGG + Intronic
1167203624 19:48085398-48085420 CTGAGAAACGTTGGCATGGAAGG - Intronic
1167250171 19:48395153-48395175 CAGAGAAATGGGGGCGTGAAAGG - Intronic
1167315316 19:48759487-48759509 CTGAGAAAAAAGGGGCTGGAGGG + Intergenic
1167642515 19:50689293-50689315 AGGAGAAATGGGGGGGTGGTGGG + Intronic
1167669024 19:50839066-50839088 CTGAGAGAGGTGGGGCTGGGGGG + Intergenic
1167736686 19:51298925-51298947 CTGAGACATGTCGCTGTGGAAGG - Intergenic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
925455861 2:4016087-4016109 CTGAGAACTGGGGGAGTGGATGG + Intergenic
925557076 2:5143441-5143463 CTGCCAAATGTGGGGCTGAAGGG + Intergenic
926124660 2:10264752-10264774 CTCAGGAATGTGCGGGTGGAAGG - Intergenic
926727403 2:16009258-16009280 TTGACAAATGAGGGAGTGGAGGG - Intergenic
926894029 2:17664749-17664771 CTGGGAAAACTGGGAGTGGAGGG - Exonic
927245214 2:20952168-20952190 CTGATAGATATGGGGGTGGAGGG - Intergenic
927397640 2:22672269-22672291 AAAAGAAATGTGGGTGTGGAGGG + Intergenic
927476421 2:23417702-23417724 CAGAGAAAAGTGAGGCTGGAGGG - Intronic
927855282 2:26523835-26523857 CTGGGCCATGTGGGGGTTGAGGG + Intronic
928145549 2:28771369-28771391 CTCACAAGTTTGGGGGTGGAGGG + Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930087482 2:47508069-47508091 CTGTGAAATGTTGGGGTGTTTGG + Intronic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
931409656 2:62017322-62017344 CTAAGAAGTGTGTGTGTGGACGG - Intronic
931710928 2:64988944-64988966 CTGAGGACTGTGGGAGGGGAGGG - Intronic
932606720 2:73170331-73170353 CTCAGGGAAGTGGGGGTGGAAGG - Intergenic
933264533 2:80168203-80168225 CTGAGAGCTGTGAGGCTGGAGGG - Intronic
933697873 2:85233697-85233719 CAGGGAAATTTGGGGGTGGGTGG - Intronic
933925704 2:87090104-87090126 CTCAGGGAAGTGGGGGTGGAAGG + Intergenic
935625517 2:105169291-105169313 CTAAGCACTGTGGGGGTTGATGG + Intergenic
936140123 2:109932230-109932252 CTTACAAAGGTGGGGGTGGGGGG - Intergenic
936176812 2:110230175-110230197 CTTACAAAGGTGGGGGTGGGGGG - Intergenic
936204573 2:110439256-110439278 CTTACAAAGGTGGGGGTGGGGGG + Intronic
936336282 2:111593473-111593495 CTGAGAAAGATGGGGGAAGAAGG - Intergenic
936418596 2:112343183-112343205 CTGAGGAATGAGGTGGAGGATGG + Intergenic
937565375 2:123279765-123279787 CAGTGAGATGTGGGGCTGGAGGG - Intergenic
937996352 2:127697642-127697664 CTCAAAAATGAGGGGGTGGTTGG + Intergenic
939009774 2:136832342-136832364 CTGAGAACCAGGGGGGTGGATGG + Intronic
939544418 2:143535098-143535120 CTTAGAAATTTGGGGGAGAAGGG - Intronic
941662098 2:168205569-168205591 CTGAGGAAGGTGGGGAGGGACGG + Intronic
942575990 2:177363965-177363987 CTGAGAAATGTGGCTATGCAGGG - Intronic
943329933 2:186547001-186547023 CTGAGGAATGAGTGGGTGGTAGG - Intergenic
944364350 2:198899087-198899109 CCCAGAAATGGGTGGGTGGATGG + Intergenic
944499816 2:200347675-200347697 CTAGGAGAAGTGGGGGTGGATGG + Intronic
945412362 2:209526358-209526380 CTGAGAATTCTGGAAGTGGAGGG + Intronic
946188627 2:217995772-217995794 TTGAGAGAGGTGGGGGTTGAGGG - Intronic
946497746 2:220213027-220213049 CAGCTAAATGTGGGGATGGAGGG + Intergenic
947952234 2:234158242-234158264 CTCAGAAATATGGGGGTAGGAGG + Intergenic
948733160 2:239979973-239979995 GTGAGGGATGTGGGGGTGTAGGG - Intronic
948733174 2:239980015-239980037 CTGAGGGATGTGGGGGTGTAGGG - Intronic
1169743121 20:8916621-8916643 CTGAGAAATGGGGTAGTGGATGG - Intronic
1169969108 20:11249416-11249438 CTGAGAATTCAGTGGGTGGAGGG - Intergenic
1170874242 20:20235523-20235545 ATGAGAAAAGTGGGGATGGGAGG - Intronic
1171141402 20:22746936-22746958 CTGAGAAATGTGGGAACAGAAGG - Intergenic
1171151098 20:22827034-22827056 CTGTCCAATGTGGGAGTGGATGG - Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1172226593 20:33309552-33309574 CTTAGAAGGGTCGGGGTGGAGGG - Intronic
1173074146 20:39800798-39800820 CTGACAGATGTGGCAGTGGAGGG - Intergenic
1173972762 20:47165397-47165419 CTGGGAAGTGGGGGAGTGGAAGG - Intronic
1175655839 20:60769707-60769729 ATGAGAAATGAGAGAGTGGAGGG - Intergenic
1178423576 21:32461111-32461133 CTGAGAACTGCAGGGATGGAGGG + Intronic
1178585422 21:33867094-33867116 CTGAGAGACCTGGGGTTGGAAGG - Intronic
1179197796 21:39182586-39182608 CTGAAAAATGTAGAGGTGAAAGG + Intronic
1179614266 21:42571664-42571686 GTGGGCAATGTCGGGGTGGAAGG - Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1180022570 21:45137738-45137760 GTGAGGAAAGTGGGGATGGAAGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180729372 22:17970161-17970183 CTGAGAAAAGTGGGTGTTGAAGG - Intronic
1181004053 22:20001276-20001298 CTGAGACAGGTGGGAGTGGCTGG + Intronic
1181767618 22:25103106-25103128 CAGAGAAATGAGGTGGTGAAAGG + Intronic
1182062015 22:27405157-27405179 CTGCAAACTGTGGAGGTGGAAGG - Intergenic
1183350536 22:37332292-37332314 CTTAGAAATGAGGAAGTGGAGGG + Intergenic
1183395853 22:37570406-37570428 CTGTGAACTGTGGGGAGGGAGGG + Exonic
1183967092 22:41448284-41448306 CAGAGAAATGCCGGGCTGGAGGG + Intergenic
1184014616 22:41776583-41776605 GTGAGAAATCTGGAGGAGGATGG + Intronic
1184345660 22:43911128-43911150 CTGAGAAAGGAGGGAGGGGAGGG - Intergenic
1184596797 22:45518832-45518854 TAGAGAAAAGTGGGGGAGGAAGG + Intronic
1184670272 22:46008521-46008543 CTGAGAGGGGTGGGGGTGGCAGG + Intergenic
1184760156 22:46539154-46539176 TTGGGAAATGTGTGTGTGGAGGG + Intergenic
1184835769 22:47020032-47020054 CTGAGACATGGGTGGGGGGATGG - Intronic
1185015171 22:48338775-48338797 CGGAGACATTTGTGGGTGGACGG - Intergenic
949580836 3:5386036-5386058 CTCTGAAATGGGGGTGTGGAGGG + Intergenic
949940111 3:9148273-9148295 CAGAGAAATGCTGGGGTTGATGG - Intronic
950334378 3:12181962-12181984 CTGTGACTTGTGGGGGTTGAGGG + Intronic
950427090 3:12930341-12930363 CTAAGAGATGTGGAAGTGGATGG + Intronic
951640026 3:24826695-24826717 CTCAGAAATTTGGGGGAGGTGGG - Intergenic
951696282 3:25448884-25448906 CTGGGGATTGCGGGGGTGGAGGG - Intronic
952173857 3:30840009-30840031 CAGACAAATGTGGGGGTGAGGGG + Intronic
954198358 3:49009319-49009341 CTGGGAAATGTTGGGGCGGGGGG - Intronic
954500011 3:51003970-51003992 CTGAGAAAGGTGGGTGTGTTAGG + Intronic
954704032 3:52469263-52469285 CTGTGGGATGTGGGGGTGGGGGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955579267 3:60401491-60401513 ATGGGAGTTGTGGGGGTGGAGGG - Intronic
955960987 3:64341383-64341405 TAGAGAAAGGTGGGGGTGGTTGG - Intronic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
956187552 3:66576877-66576899 CTCAGAAAAGAGTGGGTGGAAGG + Intergenic
956830065 3:73038057-73038079 CTGACACATGTGGGGGTGAAGGG + Intronic
957315979 3:78577432-78577454 CAGAGAAATGGGGCAGTGGAAGG + Intergenic
957348510 3:78993191-78993213 ATCAGACATGTGTGGGTGGATGG + Intronic
957925954 3:86811583-86811605 CTGGGAAAGGTAGGGGTGGGGGG + Intergenic
958897518 3:99845478-99845500 ATGAAATATGTGGGGGTGGAGGG - Intronic
959195839 3:103180563-103180585 CTGAGAAAGGTAGGGTTGGTGGG + Intergenic
960497655 3:118394741-118394763 CTGTGAAGTGTGGGGATGCAGGG + Intergenic
960541561 3:118867456-118867478 TTGGGAAATGGGGTGGTGGAGGG + Intergenic
960620509 3:119632410-119632432 GTGAGCAAAGTGGGTGTGGAAGG - Intergenic
961827730 3:129607431-129607453 CTGAGAAAGGTGGTGGAGGGAGG - Intergenic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962627186 3:137237453-137237475 ATGAGGGAAGTGGGGGTGGATGG + Intergenic
962739999 3:138356719-138356741 CTGAGGAATGTGGGTGGAGAGGG - Intronic
962754275 3:138456353-138456375 TTCAGAAATGGAGGGGTGGAGGG + Intronic
963358491 3:144240068-144240090 CTGGGAACTGTAGGGGTGAAGGG - Intergenic
963460047 3:145600509-145600531 CAGAGAAATGTGGTGGTAGCTGG - Intergenic
966934135 3:184694771-184694793 CTTAGAAATGGGGCGGAGGAGGG - Intergenic
967229642 3:187325264-187325286 CAGAGAAAAGAGGGGGTGGAAGG + Intergenic
967261747 3:187649319-187649341 CTGAGAAATGTGTGTGTCAATGG - Intergenic
967263698 3:187671146-187671168 CTGAGAAATTTAGAGCTGGAAGG + Intergenic
967598252 3:191353399-191353421 TTGAGAAATGGGAGGGTGAAAGG + Intronic
968006571 3:195247244-195247266 CTGTGAAATCTGAGGGTGGTCGG + Intronic
968015574 3:195329403-195329425 CTGAGGTTTGTGGGAGTGGAAGG - Intronic
968594721 4:1476458-1476480 ATGATAAATGGGTGGGTGGATGG + Intergenic
969183493 4:5459283-5459305 CTTAGAAAGGTGGGGGGGGGGGG - Intronic
969326513 4:6447421-6447443 CGGATAAATGTGAGGGAGGAAGG + Intronic
969511465 4:7620436-7620458 CTGATGGATGTGGGGGTGAATGG - Intronic
971601388 4:28596057-28596079 AAGGGAAATGTGGGGTTGGAGGG + Intergenic
971681245 4:29703873-29703895 CTGAGAAATGTGGCAGAAGACGG + Intergenic
972167633 4:36307059-36307081 CTGACCAATGTGGGGATGTAAGG - Intronic
972283281 4:37623652-37623674 ATCTGAAATGTGGAGGTGGAGGG - Intronic
974098481 4:57391057-57391079 CTGAAAAATGTGCAGGTGAATGG - Intergenic
975265181 4:72355345-72355367 CAAAACAATGTGGGGGTGGAGGG + Intronic
976465273 4:85360806-85360828 CTGAGCAGGGTGGTGGTGGAAGG + Intergenic
976607157 4:86994824-86994846 TAGAGAACTGTGGGGCTGGAGGG + Intronic
976798105 4:88957353-88957375 GTGAGAGATGTGGGGTGGGAGGG - Intronic
978995087 4:115140768-115140790 TTCAGAAATGCGGAGGTGGAAGG - Intergenic
979719486 4:123882288-123882310 GAGAGAAATGTGAGGATGGATGG + Intergenic
980295894 4:130916215-130916237 CTGAGAAATGTGGCACTGAATGG - Intergenic
980680366 4:136152391-136152413 ATGGTAAATGTGGGGGTGGGGGG - Intergenic
981247055 4:142553160-142553182 CTGAGAAATCTGGGCATTGAAGG - Intronic
982207342 4:153006470-153006492 CTGAGAAAAATGAGGCTGGAAGG + Intergenic
983432498 4:167669450-167669472 TGGAGAAATATGGGGGTGGTAGG - Intergenic
983646754 4:169999303-169999325 CTCAGGAAGGTGGGGATGGAAGG + Intronic
984145302 4:176053148-176053170 ATGAGAAGGGTGGGGGTGGGGGG + Intergenic
984990389 4:185375033-185375055 CTGATGGATTTGGGGGTGGAGGG - Intronic
985422169 4:189795270-189795292 CTGAGCTATGTGGGGTTGGTAGG + Intergenic
985544738 5:503969-503991 GTGAGGAAGGTGGGGGTGGGTGG - Intronic
985628015 5:1000121-1000143 CTGAGAGACCTGGGGATGGAGGG + Intergenic
985919323 5:2957205-2957227 CTCAGAAATGTGGAGATGCAGGG + Intergenic
986437335 5:7747162-7747184 CTGGGCAATGTGGGGGTAGCAGG - Intronic
986788145 5:11134111-11134133 CTGAGAGATGTGGCTGAGGAGGG + Intronic
987870795 5:23614406-23614428 AGGGGAAATGTGGGGTTGGAGGG + Intergenic
990450725 5:55929676-55929698 CTATGAAATGTGGGGAGGGAGGG - Intergenic
990972993 5:61530011-61530033 TTGAGAAATGGGGGAGTAGAAGG - Intronic
992310973 5:75498771-75498793 GTGAGGATTGTGGGGGTGGGGGG - Intronic
993057322 5:82996976-82996998 CTCAGAGATGTGTGTGTGGAAGG - Intergenic
993097348 5:83494852-83494874 GAGAGAAGTGTGGGGGTGGGGGG + Intronic
993313871 5:86374615-86374637 CTGTGAAATCTAGGGGTTGAGGG + Intergenic
993483137 5:88449629-88449651 CTGAAAAGTGTAGGGGTAGAGGG + Intergenic
994389939 5:99180480-99180502 CTGAGAAAGGTGGGGATGGGAGG - Intergenic
995011055 5:107257700-107257722 GGGAGAAATTTGGGGGTAGAAGG + Intergenic
995219329 5:109630373-109630395 CAGAGAATTGTGGGGAAGGAAGG + Intergenic
995341481 5:111065868-111065890 CAGACACATGTGGGGGTGGAGGG - Intergenic
996065087 5:119071106-119071128 CGGAGGACTGTGGGGGTGGCGGG + Intronic
996734027 5:126742432-126742454 ATTAAAAATTTGGGGGTGGAGGG - Intergenic
997589515 5:135064242-135064264 CAGACAAATGTGGGGGTGAAGGG - Intronic
998498531 5:142612050-142612072 ATGAGAAAAGTGAGGGTGAAAGG + Intronic
999149610 5:149418033-149418055 CTGAGAAATGAAGGGTAGGATGG + Intergenic
999439243 5:151588860-151588882 GTGAGAAATGAGGGGGTGCATGG - Intergenic
999455228 5:151709730-151709752 CTGGGAAGAGTGGGGGTGGCGGG + Intergenic
1000285929 5:159826236-159826258 CTGAGAAATGGGAGACTGGAGGG - Intergenic
1000848042 5:166305623-166305645 CTGAGAAAGGGTGGGGAGGATGG - Intergenic
1001317904 5:170657351-170657373 CTGGGAAATGAGGGTGAGGAGGG + Intronic
1001765903 5:174246810-174246832 CTGATAATTGTGGGGGTTGGGGG - Intergenic
1001890751 5:175336160-175336182 CTGAGAAATGTGGGGACTGATGG + Intergenic
1001964753 5:175902340-175902362 TTGAGAAAGACGGGGGTGGAGGG + Intergenic
1002047342 5:176549450-176549472 CAGAGAAATGTGGGGGTTGGGGG + Intronic
1002663673 5:180807615-180807637 CTGATTAAAGAGGGGGTGGAAGG - Intronic
1002759967 6:193784-193806 CTGAGAGCTCTGGGGGTGGAAGG + Intergenic
1003605393 6:7555452-7555474 CTGAAATATTTGGGGGTAGAAGG + Intronic
1004201059 6:13548524-13548546 TTGATTAATGTGGGGGTGGGGGG - Intergenic
1005400852 6:25432730-25432752 CAGAAATATGTGGTGGTGGATGG - Intronic
1005527768 6:26667967-26667989 CTGAGACATGTGGGGGTTGTCGG + Intergenic
1005849662 6:29812029-29812051 CGGGGAGATGTGGGGGAGGAGGG + Intergenic
1006095801 6:31656051-31656073 CTGACAACTCTGGGCGTGGATGG + Exonic
1006177036 6:32128658-32128680 CTGTGAGATTTGGGGGTGGGGGG - Intergenic
1006256465 6:32836493-32836515 CTGAGAAATGTGTCGTTAGATGG + Intronic
1006431594 6:34000578-34000600 CTGGGAGAAGTGGGGATGGAAGG - Intergenic
1006603032 6:35238383-35238405 CTGAGGAATGTGGGGTAAGAAGG - Intronic
1006604005 6:35243547-35243569 GTGGGAAATGCGGGGGTGGGTGG + Intronic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1007285688 6:40745875-40745897 CTGGGAAATGTGAGGTTGCAGGG - Intergenic
1007640649 6:43336781-43336803 TTCTGAAATGTGGGGGAGGATGG - Exonic
1007988965 6:46234998-46235020 CAGAGAAATGTGTTGGTGGCTGG + Intronic
1008102196 6:47404011-47404033 GTGAGATATGAGGAGGTGGATGG - Intergenic
1008408999 6:51151081-51151103 CAAAGAAATGTGAGGGTGGTAGG - Intergenic
1009013845 6:57875881-57875903 CTGAGACATGTGGGGGTTGTTGG - Intergenic
1010116845 6:72322844-72322866 CTGGAAATTGTGAGGGTGGAAGG + Intronic
1010317404 6:74467016-74467038 CTTAGAAAAGTGGAAGTGGAAGG - Intergenic
1010416753 6:75620349-75620371 CTGAGAAATGTGAGGTTTAAAGG - Intronic
1010461175 6:76116233-76116255 CTGAGAAGATTTGGGGTGGAGGG + Intergenic
1010656086 6:78513649-78513671 ATGAGAATTGTGGTGCTGGAAGG - Intergenic
1011210097 6:84945992-84946014 CTGAGAACTGTGGGAGTGAGGGG + Intergenic
1011210129 6:84946272-84946294 CTGAGAACTGTGGGAGTGAGGGG - Intergenic
1011504027 6:88021713-88021735 CTAGGAAATGTGGACGTGGAAGG - Intergenic
1011646033 6:89458936-89458958 ATGTCAAATGTGGGGGTGGCAGG - Intronic
1011756402 6:90502509-90502531 ATGACAAATGTGGAGGTGGTTGG - Intergenic
1012162283 6:95900830-95900852 CTGAAACATGTGGGGATGAAAGG - Intergenic
1012896048 6:104950734-104950756 CTGCTAAAAGTGGGGGTGGGGGG - Intergenic
1013571953 6:111436623-111436645 CTGAGAAGGGTGGGGGTGCAGGG + Intronic
1014290469 6:119552177-119552199 CTGAGGAACTTGGGGGAGGAAGG + Intergenic
1014540017 6:122663913-122663935 CAGAGAAATATGGAGGTGGGTGG + Intronic
1014797153 6:125738672-125738694 CTGATAAACTTGGGGGTGGGGGG + Intergenic
1015236522 6:130977629-130977651 CTTAGAATTTTGGGGGAGGAGGG - Intronic
1015745596 6:136506404-136506426 AAGAGAAATGTGGGGAGGGAAGG + Intronic
1016297307 6:142587142-142587164 CTTAGAAAGGTGGGAGTGGGTGG - Intergenic
1016362921 6:143287130-143287152 CAGAGAAATGTGTGTGTGGGAGG - Intronic
1016671210 6:146710781-146710803 CTGAAAAATGAGGAGGTGTAGGG - Intronic
1017492729 6:154958563-154958585 GTCAGAACTGTAGGGGTGGAAGG - Intronic
1018297273 6:162362423-162362445 CTGAGATATTTGGGGGTGGGAGG + Intronic
1018656904 6:166045658-166045680 CTCAGAAACCTGGGGGAGGAGGG + Intergenic
1018853156 6:167655580-167655602 CAGATAGATGTGTGGGTGGATGG + Intergenic
1019518003 7:1448063-1448085 AAGAGGAATGTGGGGGTGGGGGG + Intronic
1019547327 7:1584815-1584837 CTGGGTACTGTGGGGGTGCATGG - Intergenic
1019612607 7:1944623-1944645 CTGGGAAATGTGAGGCTGAAGGG + Intronic
1020381478 7:7552113-7552135 ATGAGATATCTGGGGGTGAAGGG - Intergenic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1021342938 7:19487753-19487775 CCCAGAAGTGTGGGTGTGGAAGG + Intergenic
1021569726 7:22052589-22052611 TTAAGAAAGGTTGGGGTGGAGGG + Intergenic
1022063638 7:26827448-26827470 ATGAGAAATGTGGGATTAGAAGG + Intronic
1023073300 7:36458963-36458985 CTGTGTAAAGTGGGAGTGGAGGG + Intergenic
1023345291 7:39265367-39265389 CTGAGGGAAGTTGGGGTGGAGGG - Intronic
1023485937 7:40686947-40686969 CTGAGGAAGGTGGGTGTGCAGGG - Intronic
1023965470 7:44961443-44961465 CTGAGCACTGAGGGGGTTGAGGG + Intergenic
1023985157 7:45089637-45089659 CTGCCTAGTGTGGGGGTGGAGGG - Intergenic
1024330516 7:48150241-48150263 CTGAGAAATGTGGCTGGGCATGG - Intergenic
1025604477 7:63029453-63029475 CTGAGAAAGGTGGGTTTGGTGGG - Intergenic
1026273105 7:68853393-68853415 GGTGGAAATGTGGGGGTGGAGGG - Intergenic
1028290449 7:89058667-89058689 CTCAGAAATGTGGCAGTGAAGGG + Intronic
1028399622 7:90410696-90410718 ATAAGAATTGTGGGGGTGGAAGG + Intronic
1028809620 7:95069260-95069282 ATCAGAAATGTGGAGGGGGAGGG + Intronic
1028838537 7:95400681-95400703 TTGAGAAATGTTTAGGTGGAGGG + Intergenic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1029372670 7:100159176-100159198 CTGGGAGAAGTGGGGTTGGAAGG - Intergenic
1029998295 7:105031354-105031376 CTGAGGATTGGGGGGGTGGTGGG + Intronic
1030070875 7:105696467-105696489 TTAAAAAAAGTGGGGGTGGATGG - Intronic
1030613121 7:111710373-111710395 ATAAGAAAGGTGGGGGTGAATGG - Intergenic
1032163975 7:129531566-129531588 CTGAGAGAGGTGGCGGCGGAGGG + Intergenic
1032363930 7:131281960-131281982 CTCAGAAATGTGGCAGTGGCTGG - Intronic
1032534948 7:132655407-132655429 CAGAGAAAGAAGGGGGTGGAGGG - Intronic
1033277800 7:139985805-139985827 CTGAGGAATGAATGGGTGGACGG + Intronic
1033595224 7:142854520-142854542 CTGAGAAATCTGGGAGAGTACGG - Intergenic
1033773409 7:144579685-144579707 CTGGGACAGGTGGGGCTGGAGGG - Intronic
1034272919 7:149812045-149812067 CAGAGAGGTGTGGGGGTGGCTGG - Intergenic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035107177 7:156451039-156451061 CTGAGAAATGCAGGGGTGAGGGG - Intergenic
1035891733 8:3352140-3352162 CTGAGAAACATGGGTGGGGAAGG + Intronic
1036406935 8:8463319-8463341 CAGAGAATTGTGTGAGTGGAGGG - Intergenic
1036505010 8:9347308-9347330 CAGAGAAATATGGGGGCGGGCGG + Intergenic
1036563281 8:9915981-9916003 CCCATAAATCTGGGGGTGGAGGG + Intergenic
1036822210 8:11950212-11950234 CTGAGAGGTGTGGGAGAGGAGGG - Intergenic
1038888858 8:31695880-31695902 CTTAGAATTGTGGAGTTGGAAGG + Intronic
1038934204 8:32230401-32230423 CTGAGAAGTGCAGGGGTGGCAGG - Intronic
1039102970 8:33959961-33959983 CTGAAAAATGTTTGGGTGGTGGG + Intergenic
1039732471 8:40294583-40294605 GTGAGGAATGTGGGAGGGGAAGG + Intergenic
1040921417 8:52624009-52624031 CTGAGTATTGAGGGGTTGGAGGG + Intronic
1041347927 8:56920685-56920707 CAGAGAAAGGTGGGGATTGAAGG + Intergenic
1041554104 8:59133763-59133785 CAGAGAGATGTGGAGCTGGAAGG - Intergenic
1041573790 8:59369761-59369783 ATGAGAAATATGGGGGGGAAAGG + Intergenic
1043314331 8:78901593-78901615 CTGAGAAATATGGAGGGGAAGGG + Intergenic
1043567885 8:81568958-81568980 CTAAGAAGGGTGGTGGTGGATGG + Intergenic
1043858190 8:85286013-85286035 CTGTGCAATGTGTGGGTGAAAGG - Intergenic
1044005615 8:86933038-86933060 CGGAGAAAGGTCGGAGTGGAGGG + Intronic
1046326081 8:112648603-112648625 GTGAGAAACATGGGGTTGGATGG + Intronic
1046649685 8:116823854-116823876 CTGAAAAATGTGGAGGGGGATGG - Intronic
1047269223 8:123339039-123339061 AAAAAAAATGTGGGGGTGGAGGG + Intronic
1048504750 8:135010954-135010976 CTGAGAAGTGTATGGGTGGTGGG + Intergenic
1048632779 8:136262121-136262143 CTGGGAAGTGTGGGTGTGGGTGG + Intergenic
1049348174 8:142149967-142149989 TTGATAAATGTATGGGTGGATGG + Intergenic
1050718834 9:8561589-8561611 CTGAGCAAGGTGGGGGTGAGGGG + Intronic
1051431677 9:16985912-16985934 CTGGCAAATTTGGGAGTGGAAGG + Intergenic
1051789666 9:20786399-20786421 CTGAGAGATTTGGGAGTGGTTGG - Intronic
1051939325 9:22485951-22485973 CTGAGACAAGTGGGGATGGAAGG + Intergenic
1052079635 9:24188198-24188220 GTGAGAAATGTGGGGTTGTGGGG + Intergenic
1052351161 9:27459493-27459515 CTGAGAAGTGCTGGGTTGGAGGG + Intronic
1053505217 9:38637441-38637463 CTGAGATATTTGGGGCTGGGGGG + Intergenic
1053575932 9:39357531-39357553 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1053840448 9:42185468-42185490 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1054097501 9:60916222-60916244 GTGAGGACTGTGGGGGTGGGGGG + Intergenic
1054118904 9:61191852-61191874 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1054588848 9:66990710-66990732 GTGAGGACTGTGGGGGTGGGGGG - Intergenic
1055567187 9:77581156-77581178 CAGGGAGATGTGGGAGTGGAAGG + Intronic
1055903404 9:81266286-81266308 CAGAGACATGTGGTGGTGGGAGG + Intergenic
1055986858 9:82061872-82061894 GTGAGGACTGTGGGGGTGGAGGG - Intergenic
1056232297 9:84559127-84559149 CTGCTCAATGTGGGGGTGGAAGG - Intergenic
1056584532 9:87919692-87919714 GTGAGGACCGTGGGGGTGGAGGG + Intergenic
1056612334 9:88133228-88133250 GTGAGGACCGTGGGGGTGGAGGG - Intergenic
1057249886 9:93492658-93492680 CTGCGAAGTGGGGTGGTGGAGGG + Intronic
1057303555 9:93899931-93899953 CTGAGTGATGTGGGGCTGGTAGG - Intergenic
1057307544 9:93920990-93921012 CTGGGAAAAGTGGGGGCTGAAGG - Intergenic
1057845194 9:98517412-98517434 CTGACACATATGTGGGTGGAGGG - Intronic
1057972731 9:99573104-99573126 CTTAAAAAAGTGGGGGTGGAGGG - Intergenic
1058653004 9:107194810-107194832 CTGATAAATGTAGGGGTGATGGG - Intergenic
1059509699 9:114833144-114833166 ATCAGAAATTTGGGTGTGGAGGG + Intergenic
1059889555 9:118786215-118786237 CTGAGAAAAGAGTGTGTGGAGGG - Intergenic
1060882930 9:127131108-127131130 CTGTGGGCTGTGGGGGTGGAGGG + Intronic
1060990278 9:127845050-127845072 CTGAGGAATGTGCCGGGGGAAGG + Intronic
1061623647 9:131827728-131827750 GTGAAGAATGCGGGGGTGGAAGG + Intergenic
1061664525 9:132152738-132152760 CTGAGAAATGTGGGCGGGGAAGG + Intergenic
1061690165 9:132321144-132321166 CTGGGAAATGTAGGCGTGGCAGG - Intronic
1061714677 9:132511270-132511292 CAGAGAAACGTGGGGAGGGAGGG - Intronic
1062331086 9:136045234-136045256 CCCAGAGAGGTGGGGGTGGAGGG + Intronic
1062404446 9:136388414-136388436 CTGAGAGCCGTCGGGGTGGAGGG + Intronic
1062688210 9:137827314-137827336 CTGAGAAGTGAGAGGGTGCAGGG - Intronic
1185583364 X:1227375-1227397 CTGAGGAATGGGTGGATGGATGG + Intergenic
1186101301 X:6159570-6159592 CTGTGTAATATGTGGGTGGATGG - Intronic
1186812893 X:13207628-13207650 CTGGAAAGTGGGGGGGTGGATGG - Intergenic
1187156457 X:16724544-16724566 CCAAGAAATGTGGGGATGGGAGG + Intronic
1188020494 X:25151697-25151719 CCCAGAAAGGTGGGGGGGGAGGG + Intergenic
1188024269 X:25192593-25192615 GTGAGGAATGTGGGTGGGGAAGG + Intergenic
1188847880 X:35096254-35096276 CATATAAATTTGGGGGTGGAAGG - Intergenic
1189078383 X:37942489-37942511 CTTAGAGATAAGGGGGTGGAGGG - Intronic
1189246149 X:39565098-39565120 AAGATATATGTGGGGGTGGAGGG - Intergenic
1190136900 X:47806247-47806269 CTGGGAAAAGTGGGGAGGGAGGG - Intergenic
1190418886 X:50207917-50207939 CTGGGAGATATAGGGGTGGAGGG - Intronic
1190884622 X:54520706-54520728 CTGATACCTGTGGGGGTGCAGGG + Intergenic
1193523909 X:82565670-82565692 CTGGGACCTGTCGGGGTGGAGGG - Intergenic
1193573080 X:83168586-83168608 CTGGGAAATGTAGGGGTGTATGG - Intergenic
1194353066 X:92845343-92845365 GTGAGAAATGTGGGATTGGATGG - Intergenic
1194390604 X:93312947-93312969 CTGAGAAACGGCGGGGTGGGGGG + Intergenic
1194824007 X:98539651-98539673 CTGGGAAGTGTAGTGGTGGAGGG + Intergenic
1195766606 X:108302996-108303018 CTGCAAATTGGGGGGGTGGAGGG - Intronic
1195929526 X:110060346-110060368 CTGAGAAAGGTGGGGGATCAGGG + Intronic
1197701344 X:129602431-129602453 ATGAGAAATGTGATTGTGGAGGG - Intergenic
1198575846 X:138009490-138009512 CTGAAAAATGTGGTGGGGAAGGG + Intergenic
1199864276 X:151828881-151828903 CTGAGTAATTTGTGGGTGGGTGG - Intergenic
1200048269 X:153414028-153414050 CTCAGTAATCTTGGGGTGGAGGG + Intergenic
1200149990 X:153946678-153946700 CTGTGTCATGTGGGGGTGGGGGG - Intergenic
1200661420 Y:5962430-5962452 GTGAGAAATGTGGGATTGGATGG - Intergenic
1200949768 Y:8884958-8884980 GTGAGAAATTTGGTGATGGAAGG - Intergenic