ID: 1085656281

View in Genome Browser
Species Human (GRCh38)
Location 11:78318204-78318226
Sequence GGGATCAGGAGTGAATCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085656271_1085656281 28 Left 1085656271 11:78318153-78318175 CCATCAGAGAGTTGATAATTGAG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 1085656281 11:78318204-78318226 GGGATCAGGAGTGAATCTGGTGG 0: 1
1: 0
2: 0
3: 16
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085656281 Original CRISPR GGGATCAGGAGTGAATCTGG TGG Intronic
900102991 1:970780-970802 TGGGTCAGGAGTGCCTCTGGGGG - Intronic
902625322 1:17673103-17673125 TGGAGCAGGAGGGAACCTGGAGG + Intronic
903539074 1:24086628-24086650 GGCATCAGGAGGGTACCTGGCGG + Exonic
904886528 1:33742662-33742684 GGGCCCAGGATTGAAACTGGAGG + Intronic
905631721 1:39522528-39522550 TAGATCAGAAGTGAATCTGCAGG + Intronic
905666033 1:39763644-39763666 TAGATCAGAAGTGAATCTGCAGG - Intronic
905692976 1:39956157-39956179 GGGATCAGGCCTGAACCTGGAGG + Intronic
905795874 1:40816376-40816398 GGCATGAGGAGAGAAACTGGTGG - Intronic
906082972 1:43106510-43106532 TGGCTCAGGAGTGAAGCTGCAGG + Intergenic
906108651 1:43309170-43309192 GGGATCAGCTGTGAAGCAGGCGG - Intronic
909317886 1:74247341-74247363 GGCTTCAGGAGTGAAGCTGCAGG + Intronic
910582139 1:88840194-88840216 GGGATGAGGAGACAATCTGCTGG + Intergenic
910859778 1:91732142-91732164 GAGAGCAGGAATGAACCTGGGGG + Intronic
912733734 1:112132067-112132089 GGTACCAGGAGTGATTCTAGAGG - Intergenic
912932862 1:113980297-113980319 GGGATCAGGAGGGAGGCTGCAGG - Intronic
914250744 1:145919447-145919469 TGGATCAGGAGTGGAGGTGGAGG + Intergenic
915649744 1:157301135-157301157 GGGATGAAGGGAGAATCTGGTGG - Intergenic
916407222 1:164509508-164509530 GGTATCAGGAGTGGTTCTAGGGG - Intergenic
918041612 1:180917133-180917155 GGGAGCAGGAGGGAATCCAGAGG + Intronic
918188069 1:182145115-182145137 AGGATCAGGAGGGCAGCTGGTGG + Intergenic
919467475 1:197939741-197939763 GGGAACATGATTGGATCTGGAGG - Intergenic
919795605 1:201319763-201319785 TGGATCAGAAGTGGATCTGGGGG - Intronic
922552624 1:226507209-226507231 GGGCTCAGGAGTGAGACAGGTGG - Intergenic
924847596 1:247788776-247788798 GGTACCAGGAGTGATTCTAGTGG - Intergenic
924920990 1:248628884-248628906 ACGATCAGGAGTGGATCAGGAGG - Intergenic
1062770902 10:99923-99945 GGTATCAGGAGTGGTTCTAGAGG - Intergenic
1063148768 10:3318958-3318980 TGGATGAGGAGTGAAGCTGCGGG + Intergenic
1064212896 10:13375551-13375573 GGGATCAGGAGAGACACTTGCGG + Intergenic
1068218229 10:54010450-54010472 AGGCTCAGGAGGGAATGTGGTGG + Intronic
1070492093 10:76986844-76986866 GGGCTCTGTAGTGGATCTGGGGG - Intronic
1073907827 10:108304482-108304504 GGGTCCAGAAGTGAAACTGGAGG + Intergenic
1074421089 10:113309399-113309421 AGGATGGAGAGTGAATCTGGAGG + Intergenic
1075481979 10:122789773-122789795 GGGATCAGGGGTGCATTTTGTGG + Intergenic
1075578259 10:123596655-123596677 GGGATAAAGAGTGAACCTGTAGG - Intergenic
1079802447 11:24887299-24887321 GGGATGTGCAATGAATCTGGAGG + Intronic
1081546739 11:44077272-44077294 GGGATCAGGAAAGCCTCTGGGGG - Exonic
1083771208 11:64868652-64868674 GGGACCAGGAGTGACTATGAGGG + Intronic
1084032701 11:66490464-66490486 GGGAGCTGGAGTGAAGTTGGGGG - Intronic
1085204057 11:74719823-74719845 GGGAGCAGGAGTGGATCAGTGGG - Intronic
1085656281 11:78318204-78318226 GGGATCAGGAGTGAATCTGGTGG + Intronic
1087096353 11:94322716-94322738 TAGATGAGGAGTGAATCTGTGGG - Intergenic
1087471589 11:98582597-98582619 GGCATCATGAATGAATCTGGGGG - Intergenic
1089244574 11:117109752-117109774 GGCTTCAGGAGTGAAGCTGCAGG + Intergenic
1089600820 11:119613694-119613716 GGGTTAAGGGGTGAAACTGGAGG + Intergenic
1091051325 11:132375486-132375508 GGTACCAGGAGTGATTCTAGAGG + Intergenic
1092471944 12:8788380-8788402 GGCTTCAGGAGTGAAGCTGCAGG - Intergenic
1092473139 12:8795839-8795861 GGCTTCAGGAGTGAAGCTGCAGG - Intergenic
1093580879 12:20783082-20783104 TGGCTCAGGAGTGAAGCTGCAGG + Intergenic
1093774416 12:23055834-23055856 GTGTTCAGGAGAGAATTTGGGGG + Intergenic
1094000325 12:25687592-25687614 GGCTTCAGGAGTGAAGCTGCAGG - Intergenic
1094401563 12:30066630-30066652 GGGATGATGAGAGAATCTGCTGG + Intergenic
1097357732 12:58621000-58621022 GGTCTCAGGAGTGATTGTGGGGG - Intronic
1097683762 12:62673135-62673157 GGGAGCAGGAATAAGTCTGGGGG + Intronic
1097718897 12:62999295-62999317 GAGGTCTGGACTGAATCTGGAGG + Intergenic
1099061127 12:77910618-77910640 GAGATCAGGAATGCTTCTGGTGG - Intronic
1099559483 12:84154568-84154590 TGGCTCAGGAGTGAAGCTGCAGG + Intergenic
1102625577 12:114233010-114233032 AGGATGAGGAGTGGATCTGGAGG - Intergenic
1103948648 12:124540476-124540498 GGGATGGGGAGTGGAGCTGGAGG + Intronic
1103949079 12:124541717-124541739 GGGATGGGGAGTGGAACTGGAGG + Intronic
1103952557 12:124558940-124558962 GGGCTGATGAGTGGATCTGGGGG - Intronic
1105876526 13:24559989-24560011 GGTTTCAGGAGTGAAGCTGCAGG + Intergenic
1109159715 13:58957548-58957570 GGCTTCAGGAGTGAAGCTGCGGG + Intergenic
1110355015 13:74557625-74557647 GGGATTAAGAGAGAATTTGGGGG + Intergenic
1114226630 14:20744637-20744659 GAGTTCAGGACTGAATCTTGAGG + Intronic
1114579691 14:23746232-23746254 GGGGGAAGGAGTGAATCAGGAGG - Intergenic
1115323249 14:32108379-32108401 GGGAATAGGAGTGATTCTGAAGG + Intronic
1115507217 14:34104037-34104059 GAGGTCTGGAGTGAGTCTGGAGG + Intronic
1115777799 14:36735532-36735554 GGGAGCTGGAGTGAAGCTTGGGG - Intronic
1115952980 14:38742333-38742355 GGCATCATGAATGAACCTGGAGG + Intergenic
1116183621 14:41568221-41568243 GGGATCATGGATGGATCTGGAGG + Intergenic
1118748883 14:68792660-68792682 GGGATTACATGTGAATCTGGAGG - Intronic
1118870494 14:69737211-69737233 GGGCTGAGGAGTGGGTCTGGAGG - Intronic
1118950966 14:70436349-70436371 GGTACCAGGAGTGATTCTAGAGG - Intergenic
1119738365 14:76998514-76998536 GGGTTCAGCAGGGGATCTGGAGG - Intergenic
1120082434 14:80230802-80230824 GGTACCAGGAGTGATTCTAGAGG - Intronic
1121694466 14:95901511-95901533 GGGCACAGGAGTTAATCTTGTGG + Intergenic
1121991564 14:98562660-98562682 GGAGTCAGGAGAGCATCTGGAGG - Intergenic
1124933840 15:34150903-34150925 GCAATCACGAGTGAACCTGGAGG - Intronic
1125001609 15:34776544-34776566 AGGATCAGGAGGAAATATGGGGG + Intergenic
1126658351 15:51005330-51005352 GGCAGCAAGTGTGAATCTGGGGG + Exonic
1131012555 15:89031065-89031087 GGTTTCAGGAGTGAAGCTGCAGG + Intergenic
1131433851 15:92407576-92407598 GGGTTCCTGAGTGGATCTGGTGG + Intronic
1132310381 15:100853155-100853177 GGAAGCAAGAGTGACTCTGGGGG + Intergenic
1132521594 16:392697-392719 GGGCTTAGAAGTGAATCTGCAGG - Intergenic
1132892634 16:2211770-2211792 GGGCCCTGGAGTGAAGCTGGTGG - Exonic
1133221382 16:4320551-4320573 GGGGGCAGGAGTGGAGCTGGGGG - Intronic
1133477270 16:6135520-6135542 AGGGTCAGGTGTGAATATGGGGG + Intronic
1134868902 16:17633749-17633771 GGAATGAGGAGTGAGTCAGGAGG + Intergenic
1138413555 16:56858378-56858400 GGGCTCAGGGGTGCATATGGTGG - Intergenic
1138867995 16:60847519-60847541 GGTACCAGGAGTGATTCTAGAGG + Intergenic
1140121707 16:72089321-72089343 GGGGTTAGGAGGGAATCTTGGGG + Intronic
1140648517 16:77061860-77061882 GCAAACAGGAGTGAATCTGATGG + Intergenic
1140692681 16:77499417-77499439 GGGTTCTGGAAAGAATCTGGTGG - Intergenic
1142477285 17:196494-196516 GCTATGAGGAGTGAATGTGGTGG - Intergenic
1143153002 17:4818661-4818683 GGGATCAGGACAGAATCAGGAGG - Intronic
1143219638 17:5250540-5250562 GACACCAGGAATGAATCTGGAGG + Intergenic
1143479290 17:7219373-7219395 GGGAGGGGCAGTGAATCTGGGGG + Exonic
1144520680 17:15950609-15950631 GGGAGCAGGAGTCCAGCTGGGGG - Intronic
1145799717 17:27675150-27675172 GGGAGCAGGTGTCAATCAGGAGG - Intergenic
1145800103 17:27677162-27677184 GGGAGTAGGGGTGAATTTGGGGG - Intergenic
1147426142 17:40346769-40346791 GAGGTCAGGAGAGAATCTGCTGG + Intronic
1148559280 17:48596823-48596845 GAGACTAGGAGGGAATCTGGAGG - Intronic
1148991392 17:51669698-51669720 GGCTTCAGGAGTGAAGCTGCAGG - Intronic
1149392212 17:56203435-56203457 GAGATCAGGAATGAATATTGAGG - Intronic
1149572153 17:57679630-57679652 GGGATGGGGAGTGAGGCTGGTGG - Exonic
1152645053 17:81464992-81465014 GGGGTGAGGAGAGAATCTGGTGG - Exonic
1154068057 18:11127872-11127894 GGTATCAGGAGTGGTTCTAGAGG + Intronic
1154505791 18:15039605-15039627 GGTATCAGGAGTGGTTCTAGAGG + Intergenic
1157582072 18:48779467-48779489 TTGGTCAGGAGTGCATCTGGAGG + Intronic
1157845531 18:51000533-51000555 GGTATCAGGAGTGGTTCTAGAGG + Intronic
1157986380 18:52442877-52442899 GGGATCAGGGGTAAAGCAGGTGG + Intronic
1159077799 18:63701090-63701112 GGGAGCAGGAGTAAATTTGAGGG + Intronic
1163156472 19:15442564-15442586 GGGGACAGGAGGGAATCAGGAGG - Intronic
1164200522 19:23014258-23014280 GGTACCAGGAGTGATTCTAGAGG - Intergenic
1164783763 19:30913355-30913377 GTGATCAGGATGGGATCTGGGGG + Intergenic
1166502978 19:43354566-43354588 GGGATCGGGAGTGAGTGGGGAGG - Intronic
1166507476 19:43380168-43380190 GGGATCGGGAGTGAGTGGGGAGG + Intergenic
1167278777 19:48554304-48554326 GGGAGGAGGTGCGAATCTGGGGG - Intronic
1167722341 19:51187183-51187205 TGTATCAGGAGTGATGCTGGGGG + Intergenic
1168334849 19:55591934-55591956 GGGGTCACCAGTGACTCTGGTGG + Exonic
925124760 2:1446054-1446076 GGGCTTGGGGGTGAATCTGGAGG + Intronic
926778784 2:16448083-16448105 GTGATGAGGAGAGAAGCTGGCGG + Intergenic
927124004 2:19996618-19996640 GGAAGAAGCAGTGAATCTGGGGG + Intronic
927879285 2:26679414-26679436 GGGAAGAGGAGTGAGGCTGGTGG + Intergenic
928425309 2:31172777-31172799 GGGTATAGGAGAGAATCTGGAGG + Intergenic
929054330 2:37862907-37862929 AAGAACAGGAATGAATCTGGGGG + Intergenic
930878410 2:56245381-56245403 GGCATGAGGAGGGAATCTGTGGG - Intronic
931193844 2:60031026-60031048 GAGATGAGAAGTGAAGCTGGTGG + Intergenic
931202882 2:60117170-60117192 GGGAACATGAATGAAGCTGGAGG - Intergenic
931831721 2:66059288-66059310 GTGACCAGGGGAGAATCTGGAGG - Intergenic
933692243 2:85188162-85188184 GGTAGCATGAGAGAATCTGGTGG + Intronic
936653818 2:114461384-114461406 GGGATCAGGAAAGAATTTGCAGG - Intronic
937866755 2:126757806-126757828 GGGAGCAGGAGGGAAGGTGGAGG + Intergenic
938504978 2:131869886-131869908 GGTATCAGGAGTGGTTCTAGAGG + Intergenic
938913360 2:135907334-135907356 GGGATCACGAGGGAACATGGAGG + Exonic
939229887 2:139411084-139411106 TGGCTCAGGAGTGAAGCTGCAGG - Intergenic
940666534 2:156617332-156617354 TGGCTCAGGAGTGAAGCTGCAGG + Intergenic
942228106 2:173834623-173834645 GGGGTCAGGAGGGAATCTTGAGG - Intergenic
942670937 2:178375968-178375990 GGGTTGGGGAGTGAATGTGGTGG + Intronic
943905942 2:193501634-193501656 TGGCTCAGGAGTGAAGCTGCAGG + Intergenic
944746532 2:202662231-202662253 GGCAGCATGGGTGAATCTGGAGG + Intronic
945302433 2:208227149-208227171 GGCTTCAGGAGTGAAGCTGCAGG + Intergenic
945641764 2:212440555-212440577 GGTACCAGGAGTGGTTCTGGAGG + Intronic
946219172 2:218211615-218211637 AGGATGAAGAGTGGATCTGGAGG + Intergenic
946430959 2:219627348-219627370 GGGTTGGGGAGCGAATCTGGGGG + Intronic
946528267 2:220543212-220543234 GGTACCAGGAGTGGATCTAGAGG - Intergenic
948137722 2:235649234-235649256 AGGCTCAGGAGTGAGTCTAGAGG + Intronic
948608927 2:239154706-239154728 AGTATCAGGAGAGAATCTGTGGG - Intronic
1168746355 20:245857-245879 GGCAACGTGAGTGAATCTGGAGG - Intergenic
1168856096 20:1010115-1010137 GGGATGAGGGATGAGTCTGGGGG - Intergenic
1170133194 20:13044892-13044914 GTGATCAGGAGTGATTCTTGAGG - Intronic
1174528112 20:51189817-51189839 GGCAGCAGGAGGGAATTTGGGGG - Intergenic
1175630104 20:60528529-60528551 ACCATCAGGACTGAATCTGGAGG - Intergenic
1176792071 21:13329421-13329443 GGTATCAGGAGTGGTTCTAGAGG - Intergenic
1177614913 21:23504157-23504179 GGGTTTATCAGTGAATCTGGAGG + Intergenic
1178419195 21:32430081-32430103 GGGATCAGGCGTGGAGCTTGGGG + Intronic
1178552452 21:33552095-33552117 GGGATCAGGAGTTAGTCTGTAGG - Exonic
1180109077 21:45639469-45639491 GGGATCATGAGGGCAACTGGGGG + Intergenic
1184949798 22:47833206-47833228 TGGATCAAGAGTGAGTCTGTGGG + Intergenic
1185046396 22:48530726-48530748 GGGGTCAGGTGTGAACCAGGTGG - Intronic
1185068752 22:48644911-48644933 GGGATCAGCAGAGAGTCTGCGGG - Intronic
949126064 3:446407-446429 GGTATCAGGAGTGGTTCTAGAGG - Intergenic
950152220 3:10696645-10696667 GGGATCAGAAGTGAGTGAGGGGG - Intronic
950392169 3:12705271-12705293 AGGGTGAGGAGTGGATCTGGAGG + Intergenic
955266293 3:57448484-57448506 GGCTTCAGGAGTGAAGCTGTAGG + Intronic
955403898 3:58613302-58613324 GGGAGCAGGAGTCAAACTGTGGG + Intronic
956371671 3:68570473-68570495 GTGGCCAGGAATGAATCTGGGGG - Intergenic
959377796 3:105606441-105606463 GGTATCAGGAGTGGTTCTAGAGG - Intergenic
960495136 3:118364030-118364052 GGTAGCAGGAGTGATTCTAGAGG - Intergenic
961756082 3:129128161-129128183 GGACTCAGGAGTGAATATCGTGG - Intronic
963003032 3:140700956-140700978 GGGCTCAGAAGTGCTTCTGGAGG - Exonic
966835710 3:184048088-184048110 GTGACCAGGTGTGAAGCTGGAGG + Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969111678 4:4848414-4848436 GGGATCAGGAGGATATCTGTGGG + Intergenic
970745474 4:19289613-19289635 GGGAACATGAATGAACCTGGAGG - Intergenic
971002714 4:22340596-22340618 GGTATCAGGAGTGGTTCTAGAGG + Intergenic
973807710 4:54541502-54541524 GAGATAATGAGTGGATCTGGGGG - Intergenic
975158408 4:71097317-71097339 GGGAACATGGGTGGATCTGGAGG - Intergenic
975805127 4:78104249-78104271 AGGAACTGTAGTGAATCTGGCGG - Intronic
977750808 4:100608088-100608110 GGGCTCAAGAGTGAAGCTGCAGG + Intronic
977850410 4:101820767-101820789 GGGAACATGAATGAAGCTGGAGG - Intronic
978173360 4:105701170-105701192 AGGATGAGGAGTGAAGCTGGAGG - Intronic
979466057 4:121039808-121039830 GGGTGCACAAGTGAATCTGGAGG - Intronic
980406297 4:132357050-132357072 GGTATCAGGAGTGGTTCTGGAGG - Intergenic
980865983 4:138553542-138553564 GGCTTCAGGAGTGAAGCTGCAGG - Intergenic
981753551 4:148117448-148117470 GGGAGCAGGAATGACACTGGAGG + Intronic
982692930 4:158568107-158568129 TGGCTCAGGAGTGAAGCTGAAGG - Intronic
983204499 4:164899006-164899028 GATATCAGGAGTGAGTGTGGTGG + Intergenic
983657220 4:170095296-170095318 GGGATGAGGAGTCAATCTGCTGG + Intergenic
985605876 5:857855-857877 GGGACCAGGACAGACTCTGGGGG - Intronic
985605961 5:858191-858213 GGGACCAGGACAGACTCTGGGGG - Intronic
986955940 5:13149398-13149420 GGTATCAGGAGTGGTTCTAGAGG - Intergenic
987243817 5:16028110-16028132 TGAAGCATGAGTGAATCTGGTGG + Intergenic
988267888 5:28974637-28974659 GGTATCAGGAGTGGTTCTAGAGG - Intergenic
990142280 5:52719523-52719545 GAGATCAGCAGTTAATCTGATGG - Intergenic
990304110 5:54478122-54478144 TGGATAAGGAGTGAATCTCTAGG + Intergenic
990744837 5:58949485-58949507 GGGATTAGCAGGGAGTCTGGAGG + Intergenic
992110501 5:73488191-73488213 GGTATCAGGAGTGGTTCTAGAGG - Intergenic
993913981 5:93718939-93718961 TGCATCAGGAGTGAATCAGTAGG - Intronic
994096530 5:95852462-95852484 TGGCTCAGGAGTGAAGCTGCGGG - Exonic
994783715 5:104127802-104127824 GGGAGAAGGTGTGAATGTGGAGG + Intergenic
994817258 5:104599839-104599861 GGGATCAGGAGAGGATTTGTTGG - Intergenic
997158020 5:131579093-131579115 GGCTTCAGGAGTGAAGCTGCAGG + Intronic
997201020 5:132010288-132010310 TGGATCAGGCCTGAACCTGGAGG - Intronic
997361172 5:133296060-133296082 AAGATCAGGAGTTAATTTGGGGG - Intronic
998146757 5:139733562-139733584 GGGATCAGGAGGGCTTCTTGGGG + Intergenic
1002309314 5:178305264-178305286 GCGCTAAGGAGTGTATCTGGAGG + Intronic
1002566830 5:180116833-180116855 GGGAACAGGAGTCAGCCTGGCGG + Intronic
1002995599 6:2281099-2281121 AGGATCAAGAGTAAATCAGGAGG - Intergenic
1003891212 6:10565356-10565378 GGGAAAAGGAGTCAAGCTGGTGG + Intronic
1004455516 6:15788225-15788247 GGGAAGAGGAGAGAATCGGGAGG - Intergenic
1004871088 6:19904884-19904906 GGCAGCATGAGGGAATCTGGGGG - Intergenic
1005017239 6:21385922-21385944 GTAATAATGAGTGAATCTGGAGG + Intergenic
1005178012 6:23070216-23070238 GGGAACATGAATGAAGCTGGAGG - Intergenic
1005629774 6:27696619-27696641 GGAATGAGGAGTGAATCACGGGG + Intergenic
1006213793 6:32421021-32421043 GGGCTCAGGAGGGAATCTGCTGG + Intergenic
1007101630 6:39251662-39251684 GGGAGAAGGGGTTAATCTGGAGG + Intergenic
1007158192 6:39766683-39766705 GGGATGACGAATGGATCTGGAGG - Intergenic
1008202105 6:48603222-48603244 GGGATGAGCAGTGGATCTGAAGG + Intergenic
1008293551 6:49749653-49749675 GACAACATGAGTGAATCTGGAGG - Intergenic
1008471384 6:51889101-51889123 GTGATCAGGATTGAATCATGTGG - Intronic
1008587379 6:52961953-52961975 GGCCTCAGGAGTGAAGCTGCAGG + Intergenic
1008899488 6:56595187-56595209 GGGAGCAGCAAAGAATCTGGAGG - Intronic
1009806071 6:68603536-68603558 GGGAGCAGGAGTGGTTCTAGAGG + Intergenic
1011680855 6:89782046-89782068 GGGAACAGGAGTGAGTAAGGGGG - Intronic
1013292049 6:108728224-108728246 GGGTTGAGGAGTGCATTTGGGGG - Intergenic
1015467338 6:133561483-133561505 GGTATCAGGAGTGTTTCTAGAGG - Intergenic
1015873506 6:137800359-137800381 GGAATCAGGAGGGGATGTGGAGG - Intergenic
1018107738 6:160505070-160505092 GGAACCAGGAGTGGTTCTGGAGG - Intergenic
1019367984 7:645029-645051 GGGATCTGCAGTGAATCACGGGG - Intronic
1019914400 7:4123483-4123505 GGGAGCAGGAGTGAGCCGGGTGG + Intronic
1020223139 7:6256850-6256872 GTCATCAAGAGTGAAGCTGGCGG + Intronic
1020283516 7:6663722-6663744 GGGAGCAGGAGGGGATGTGGAGG + Intergenic
1020796990 7:12687560-12687582 GGGATCATGAGTGGACCGGGAGG + Exonic
1021597314 7:22331036-22331058 GGACTCAGGAGGGAATGTGGTGG - Intronic
1022631824 7:32092573-32092595 ACAATCAAGAGTGAATCTGGAGG + Intronic
1022896138 7:34751858-34751880 GGGATCCAGAGTGGGTCTGGTGG + Intronic
1024465264 7:49705663-49705685 GAGACCTGGAGTGAATCTGATGG - Intergenic
1024959270 7:54957776-54957798 GGGATGAGGAGAGCTTCTGGAGG + Intergenic
1024992220 7:55244331-55244353 GGGATAAGGAATGATTCTGGGGG - Intronic
1027340013 7:77196900-77196922 GGGATCAGGTGTAACTCTGTAGG + Exonic
1028385185 7:90245637-90245659 GGGGACAGGAGTGAAGATGGGGG + Intronic
1030257463 7:107526906-107526928 GGGATAATGAGGGAATCTGGAGG + Intronic
1030750484 7:113226398-113226420 GGGGTCAGGGGTGATACTGGGGG + Intergenic
1030857385 7:114577624-114577646 GAGATCAGGAGGAAGTCTGGTGG - Intronic
1033581487 7:142741074-142741096 GGGATGAGGAGAGCATCTGTAGG + Intergenic
1035565438 8:637709-637731 GGGAGCAGGAGGAAAGCTGGGGG + Intronic
1037114353 8:15205934-15205956 GGGAACATGGGTGAAGCTGGAGG + Intronic
1037926297 8:22846397-22846419 TGGATTGGGAGAGAATCTGGTGG + Intronic
1039068967 8:33633270-33633292 GGCTTCAGGAGTGAAGCTGTAGG + Intergenic
1044715400 8:95095252-95095274 TGAATCAGGAGAAAATCTGGTGG + Intronic
1046164263 8:110409377-110409399 GGGAACATGAGTGGAGCTGGAGG + Intergenic
1046586185 8:116150893-116150915 GGTACCAGGAGTGATTCTAGAGG - Intergenic
1046969335 8:120204286-120204308 GGGAACAGGAGTGATCCTTGTGG - Intronic
1047623225 8:126629891-126629913 AGGATCAGGAGTGAAATTGCTGG + Intergenic
1049680428 8:143915619-143915641 GGTCTCAGGAGTGAGTGTGGGGG + Exonic
1050447466 9:5740390-5740412 GGTACCAGGAGTGATTCTAGAGG - Intronic
1050606337 9:7305183-7305205 AGGAACAGGAGTGGAGCTGGAGG - Intergenic
1051966015 9:22830967-22830989 GGTAACAGGAGTGATTCTAGAGG + Intergenic
1052729952 9:32273741-32273763 GGGTTCAGGTGGGACTCTGGGGG - Intergenic
1052900197 9:33787007-33787029 GGGATGAGGAGAGCATCTGCAGG + Intronic
1054964776 9:71011007-71011029 GGCATCATGAATGAATCTGTAGG + Intronic
1055976212 9:81957470-81957492 GGGATCAGGAGAGAGAGTGGAGG + Intergenic
1056922386 9:90802047-90802069 AGGTTCAGGAGCGAAGCTGGCGG - Intronic
1057242756 9:93426733-93426755 GGGATAAGGAGAGGACCTGGAGG - Intergenic
1057727075 9:97575269-97575291 TGGATCAGGAGTGAAGCTGCAGG - Intronic
1058786655 9:108394591-108394613 GGCTTCAGGAGTGAAGCTGCAGG - Intergenic
1059458843 9:114416791-114416813 GAGATCAGGAGTGGATATGCAGG - Intronic
1185784394 X:2877567-2877589 GGGATCAGGAGGGAAGTTGAGGG + Intronic
1185848583 X:3464249-3464271 GGGATCATGAATGGAGCTGGAGG - Intergenic
1185946751 X:4385313-4385335 GGCATCAGGTCTTAATCTGGAGG - Intergenic
1187581752 X:20614640-20614662 GGGATCAGGAGTGAAGGAGCAGG - Intergenic
1189187816 X:39069411-39069433 GGCCTCAGGAGTGAAGCTGCAGG + Intergenic
1190807724 X:53854565-53854587 GGCAACAAGAGTGAAACTGGGGG - Intergenic
1193904194 X:87223279-87223301 GGTACCAGGAGTGGTTCTGGAGG + Intergenic
1193979568 X:88165219-88165241 GGGATCTGCTGTGATTCTGGGGG + Intergenic
1195752013 X:108169247-108169269 AGGAACAGAAGAGAATCTGGAGG + Intronic
1196714801 X:118800374-118800396 GGGCTCAGGAGTGAAGCCGCAGG - Intergenic
1198068260 X:133121595-133121617 GGGAAGAGGAGTCAGTCTGGAGG + Intergenic
1200916395 Y:8574938-8574960 GGGATGAGGATAAAATCTGGAGG + Intergenic
1201406435 Y:13654607-13654629 GAGATAAGGAGTGAATCTCTAGG + Intergenic
1202136949 Y:21676111-21676133 GGCTTCAGGAGTGAAGCTGCAGG + Intergenic
1202257497 Y:22937248-22937270 GGTTTCAGGAGTGAAGCTGCAGG - Intergenic
1202410487 Y:24570995-24571017 GGTTTCAGGAGTGAAGCTGCAGG - Intergenic
1202460294 Y:25099077-25099099 GGTTTCAGGAGTGAAGCTGCAGG + Intergenic