ID: 1085665853

View in Genome Browser
Species Human (GRCh38)
Location 11:78415643-78415665
Sequence CCTGATGGGCTGAAGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085665847_1085665853 17 Left 1085665847 11:78415603-78415625 CCTAAGAAAAGCTGTTACTTAAA 0: 1
1: 0
2: 2
3: 43
4: 386
Right 1085665853 11:78415643-78415665 CCTGATGGGCTGAAGGTACATGG 0: 1
1: 0
2: 1
3: 10
4: 144
1085665846_1085665853 22 Left 1085665846 11:78415598-78415620 CCTAACCTAAGAAAAGCTGTTAC 0: 1
1: 0
2: 1
3: 20
4: 187
Right 1085665853 11:78415643-78415665 CCTGATGGGCTGAAGGTACATGG 0: 1
1: 0
2: 1
3: 10
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085665853 Original CRISPR CCTGATGGGCTGAAGGTACA TGG Intronic
900086614 1:901320-901342 CCAGGTGGGCTGAATGCACATGG - Intergenic
900097483 1:945915-945937 CCTGATGGGCTGGAGGCTCCGGG - Intronic
901079567 1:6576301-6576323 CCTGATGGGCTGAAACCACCAGG + Intronic
901167347 1:7229956-7229978 CCGGTTGGGCTGAAGCTCCAAGG + Intronic
901428283 1:9197438-9197460 CCTGCAGGGATGAAGGTATAAGG - Intergenic
901436384 1:9249606-9249628 GCCCCTGGGCTGAAGGTACAGGG - Intronic
902519594 1:17008644-17008666 CCTGAGGGTTTTAAGGTACAAGG - Intronic
903065512 1:20697148-20697170 CCTGTTGGGCTGTGGGTACCTGG - Intronic
903261965 1:22136379-22136401 CCTGCTGGGCTGAGGGAACCTGG + Intronic
906073419 1:43034464-43034486 CCTGTTGGGCTAAAGGAAGAAGG - Intergenic
906741222 1:48187291-48187313 CTTGATGGGCTGAAGGCAAGAGG + Intergenic
915826612 1:159084856-159084878 TCTGAAGGACTGAAGGAACAAGG + Intronic
918132316 1:181640260-181640282 CCTGAAGGCCTGAAGGTACATGG - Intronic
922994293 1:229943850-229943872 CCTGATGGGGACAAGGGACAGGG + Intergenic
923611707 1:235501829-235501851 CCTGTTAGGCTTAAAGTACAAGG + Intronic
924076072 1:240338587-240338609 CCGGAAGGGATGAAGGTAGACGG - Intronic
924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG + Intronic
1068544146 10:58327309-58327331 CCCGATTGGCTGGAGGCACAGGG - Intergenic
1069868589 10:71519391-71519413 CCTGATGGAGGGAGGGTACAGGG + Intronic
1070944428 10:80377271-80377293 CCTCATGGGCTGCAGGCATATGG - Intergenic
1073811309 10:107155390-107155412 CCTGATGGGGAGAAGGGACCAGG - Intronic
1074187887 10:111112916-111112938 CCTGAAGGACTGAAGGAACTGGG + Intergenic
1074309762 10:112312285-112312307 ACTGATGGCCTGATGGTCCAGGG - Intergenic
1075831636 10:125417079-125417101 CCTGATGAGCTGACGGGAGATGG - Intergenic
1076592229 10:131591394-131591416 CCTGAGGGGCCGAGAGTACATGG + Intergenic
1077942304 11:6856085-6856107 CCTGCTGGCCTGCAGGTAGACGG - Intergenic
1078231398 11:9446412-9446434 CTAGATAGGCTGAAGGCACATGG + Exonic
1079390756 11:20019914-20019936 CCTGGTGGGTTGAAGGATCACGG + Intronic
1081822839 11:46016918-46016940 CCTGATGTGATGAAGTCACAAGG + Intronic
1085228175 11:74941572-74941594 CCTGAAGGGCTTGAGGTACCAGG + Intronic
1085444374 11:76590624-76590646 CCTGGAGGCCTGCAGGTACATGG + Intergenic
1085665853 11:78415643-78415665 CCTGATGGGCTGAAGGTACATGG + Intronic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1087897423 11:103602213-103602235 CCTGATTTGGTGAAGGGACATGG - Intergenic
1090240376 11:125177324-125177346 ACTGATGGGCTTAAGTGACAAGG + Intronic
1090906685 11:131082817-131082839 CCTGATAGGTTGAAAGTAAAAGG - Intergenic
1093370515 12:18359039-18359061 GCTGAAGGGCTGAAGGCAAAAGG + Intronic
1098385120 12:69910335-69910357 GCTCATGGGCTGAGGGTTCAGGG + Intronic
1098532474 12:71556394-71556416 CCTGATGTCCTGAAGCTAAAAGG + Intronic
1100369018 12:93948415-93948437 CATGGTGGGCTGGAGGTAGAGGG - Intergenic
1104158628 12:126157273-126157295 ACTCATGTGCTGAAGCTACATGG - Intergenic
1105066337 12:133202356-133202378 CCTAATGGGTTTCAGGTACATGG + Exonic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1107140168 13:36990318-36990340 CCTGATGGGCTAAGGTTACAAGG - Intronic
1109406260 13:61903705-61903727 CCTGATGGGCCGAATAGACAAGG + Intergenic
1111028890 13:82570194-82570216 CCTGATGGGCTGAGTGGGCATGG - Intergenic
1111597563 13:90430862-90430884 CCTAATGGGTTGAAAGTAAATGG - Intergenic
1112342722 13:98565944-98565966 CCCGGTGGGCTGAAGGCCCAGGG + Intronic
1113339687 13:109409825-109409847 GCTGATGGGCTGGAGAGACACGG - Intergenic
1118056872 14:62087867-62087889 TCTGATGGGCTGGAGGTAGTGGG + Intronic
1119123155 14:72098421-72098443 CCTGATGGCATGAAGGCACGGGG - Intronic
1122399842 14:101460111-101460133 CCAGATGGGTTGAAGGGACCTGG + Intergenic
1124609485 15:31198489-31198511 CATGGTGAGCTGAAGGGACAAGG - Intergenic
1125538086 15:40454248-40454270 CATGCCGGGCTGAAGGTTCAAGG - Intronic
1125832009 15:42723648-42723670 GCACAGGGGCTGAAGGTACAGGG + Exonic
1126056728 15:44736686-44736708 CTTGGTGGGCTGAAGCTTCATGG + Exonic
1127536223 15:59892445-59892467 GCTGATTGGCTGAAAGTCCAAGG - Intergenic
1128732682 15:70031745-70031767 CCTGATGCTCTGTAGGCACAAGG - Intergenic
1129826633 15:78638776-78638798 CCTGCTGGGCTCAAAGGACAAGG + Intronic
1131516330 15:93079855-93079877 CCTTGTGGGCGGGAGGTACAGGG + Intronic
1133229770 16:4360956-4360978 GCTGATCGGCTGAAGCTGCAGGG - Exonic
1142264856 16:89058938-89058960 ACTGATGGGCAGAAGGTCAAGGG - Intergenic
1144704498 17:17358277-17358299 CCTGATGGGATGATTGTTCAAGG + Intergenic
1145901339 17:28492270-28492292 CCTGATGGGCTACAAGGACAGGG - Intronic
1146636836 17:34512836-34512858 ACTGATGGGTGGAAGGTACCAGG - Intergenic
1147917593 17:43898083-43898105 CCTGAGTGGCTGCAGGTAGAGGG - Intronic
1149176104 17:53872274-53872296 CCTTATGGGCTGAAAGTTCATGG + Intergenic
1150620765 17:66806418-66806440 CCTGCAGGGCTGCAGGGACAGGG - Exonic
1155070043 18:22307045-22307067 CCTGATGTGCTCAAGGCACAGGG + Intergenic
1156158232 18:34329236-34329258 CCACATGGGCTAAAGGCACAAGG + Intergenic
1160386700 18:78501334-78501356 CCTCACGGGCTGATGGTCCAGGG - Intergenic
1160904980 19:1447737-1447759 CCTGGAGGGCTGAGGGTACATGG - Intronic
927351934 2:22126008-22126030 CTTGATGGCCTGAAGGCAAAAGG - Intergenic
929580630 2:43079823-43079845 CCAGATGGGCTGGAGGAGCATGG - Intergenic
930000151 2:46855953-46855975 GCTGCTGGGCTGAAGGGACTGGG + Exonic
931353278 2:61511534-61511556 CCTGAGTGGCTGAAACTACAGGG + Intronic
932348434 2:71011800-71011822 CCTGGGGGGCTCAAGGCACAGGG - Intergenic
933994065 2:87655066-87655088 ACTGGTGGGATGAAGGTAAAGGG + Intergenic
935157234 2:100494197-100494219 TCAGATGGGATGAAGGTACAGGG + Intergenic
935205128 2:100890509-100890531 CCTGATGACCTGAGGGTACAGGG - Intronic
935603058 2:104942133-104942155 CCTTATAGGCTGATGGGACAGGG + Intergenic
936052431 2:109235024-109235046 CCTACTGGGCTGAAGGGACCAGG - Intronic
936299799 2:111295844-111295866 ACTGGTGGGATGAAGGTAAAGGG - Intergenic
937885844 2:126899591-126899613 TCTGATGGGCTGAAGGAGAAGGG + Exonic
938627410 2:133126050-133126072 CCTGATGGCTTGAAGGCACCAGG - Intronic
941656706 2:168152098-168152120 CCAGATGTGCTGAAGGTTCCAGG + Intronic
942187444 2:173437885-173437907 ACAGATGGGTTGAAGGTAGAAGG + Intergenic
944115390 2:196180507-196180529 ACTGATGGGGTTAAGATACAGGG - Intergenic
944660667 2:201919033-201919055 TCTGATGGGTTGTAGGTACTTGG + Intergenic
945916518 2:215710404-215710426 CCTGGTGGGGTGAAGGAAGAAGG - Intergenic
946592092 2:221261778-221261800 CCTTTTGGGGGGAAGGTACAGGG + Intergenic
947530643 2:230906861-230906883 ACTGAGGGGCTGAAGACACAGGG - Intergenic
1169147006 20:3259330-3259352 CCTGATGGCGTGAAGGCCCAGGG + Intronic
1169316264 20:4593095-4593117 CCTGCTGGGCTAGAGGTAAAGGG - Intergenic
1169781440 20:9314770-9314792 CCTGATGGGATGAAGGAATGAGG + Intronic
1169957838 20:11125409-11125431 TCAGATGGGCTAAGGGTACAAGG + Intergenic
1170567393 20:17614880-17614902 CCTGATGGTCAGAAGGTTGACGG + Exonic
1170716491 20:18835911-18835933 CCTGATGGAGTAAAGGGACAAGG + Intergenic
1171133792 20:22678497-22678519 CCTGATGGGAGGAAGGTGTAGGG + Intergenic
1171500888 20:25592267-25592289 CTAGATAGGCTGAAGGCACATGG + Intergenic
1172060156 20:32181938-32181960 CCTGGAGGGCTGGAGGTGCATGG + Intergenic
1172498975 20:35411657-35411679 CCTGAGGGGAAGCAGGTACATGG + Intronic
1172829717 20:37823323-37823345 CCTGACTGGCTGAAGGAAGAAGG + Intronic
1173024126 20:39292325-39292347 CCTGATGTGCCGAAGCCACAGGG - Intergenic
1175188941 20:57198500-57198522 CCTGATGAGCTGCAGGTGCCTGG + Intronic
1175375530 20:58521126-58521148 CCTGGTGGGCTGCAGGTCCTTGG + Intergenic
1175939815 20:62532767-62532789 GCTGGGGGGCTGAAGGTGCAAGG + Intergenic
1179003466 21:37485235-37485257 CCTGATGGGCTGCAGGATAAAGG - Intronic
1180105604 21:45616408-45616430 CCTGAGGGGCAGAAGGGACTGGG - Intergenic
1183511812 22:38239909-38239931 CCTGATTGGGTGATGGAACATGG - Intronic
1184316278 22:43693215-43693237 CCGGATAGGCTGAAAGTAAAAGG + Intronic
953558404 3:43965276-43965298 TCCGATGGGCTGCAGGGACATGG - Intergenic
954196694 3:49001362-49001384 CCTGAAGGGAGGAAGGTACTGGG + Intronic
956471400 3:69570766-69570788 CCTGCTGAGCTGAAGCTACGTGG + Intergenic
961590007 3:127971763-127971785 TCAGATGGGCTGAAGGCAGAAGG - Intronic
968568174 4:1325970-1325992 GATGAGGGGCTGAGGGTACAGGG + Intronic
970204182 4:13639720-13639742 CTTGATGGGCTGAAGATTCAAGG - Intergenic
970839678 4:20452745-20452767 CTTGATGGGCAGAAGGAAAATGG - Intronic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
973005103 4:44995944-44995966 CTTGATGGCCTGAAGGTAAAAGG - Intergenic
973813414 4:54595329-54595351 CATGATGGGGGGAATGTACAAGG - Intergenic
975713850 4:77187103-77187125 CCTCTAGGCCTGAAGGTACAAGG - Intronic
981685909 4:147454706-147454728 CCTGATGCACTGAGGGTGCAAGG - Intergenic
983658371 4:170106711-170106733 CTTGATGACCTGAAGGTAAAAGG - Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
994542709 5:101120980-101121002 GCTCATGGGCTGAAGGAACTTGG - Intergenic
998063086 5:139134470-139134492 TCTGATGGGCTGCGGGTCCAGGG - Intronic
998149856 5:139750698-139750720 ACTGATGGGATGATGGTTCAGGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1002000358 5:176193538-176193560 GTTGATGGGCTGAGGGTCCACGG - Intergenic
1004766705 6:18737054-18737076 GCTGATAGGCTGAATGTGCAGGG + Intergenic
1006945112 6:37779565-37779587 CCTGAGGGGCTGGAGGTCCTGGG + Intergenic
1017404362 6:154102252-154102274 ACTGATGGGCTGAATGTTCTTGG + Intronic
1017778321 6:157696838-157696860 CCTGAGAGGCTGATGGAACAAGG + Intergenic
1019443137 7:1057416-1057438 CCAGAAGTGCTGCAGGTACAGGG - Intronic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1019850409 7:3550466-3550488 CCAGAAGAGCTGAAGGTAAAGGG - Intronic
1021952095 7:25785281-25785303 CCAGATGGGGAGAAGGAACATGG - Intergenic
1032446624 7:131989804-131989826 CATGAAGGGCAGAAGGCACAAGG - Intergenic
1036754205 8:11461626-11461648 TCTGGTGGGCTGAAGCCACAGGG - Intronic
1045677241 8:104620767-104620789 ACTGATGGACTGAAGGCAGAAGG + Intronic
1053195035 9:36110853-36110875 TCCAATGGGCTGGAGGTACAAGG - Intronic
1053434277 9:38065251-38065273 CCTGATGGGGTGGAGGTGGAGGG + Intronic
1057276911 9:93680918-93680940 GCTGCGGGGCTGAAGGTGCAGGG - Intergenic
1057410177 9:94810958-94810980 TTTGATGGGCTGAAGGAAGAAGG - Intronic
1062472645 9:136713118-136713140 GCTGATGGGATGAAGGGGCAGGG - Intronic
1186107311 X:6221558-6221580 CCTCATGCCCTGAAGCTACATGG - Intronic
1188457548 X:30384110-30384132 CCTTGTGGGATGAAGCTACAAGG + Intergenic
1189952727 X:46248901-46248923 CCTCAAGGTCTGAAGGGACAAGG - Intergenic
1191697364 X:64003806-64003828 GGTGATGGGCAGAAGGTACAAGG - Intergenic
1192340796 X:70261798-70261820 ACTGCAGGGCTGGAGGTACAGGG + Intergenic
1194615046 X:96089967-96089989 TCTTATAGGCTCAAGGTACAGGG + Intergenic
1195117847 X:101717749-101717771 TTTGATGTGTTGAAGGTACATGG - Intergenic
1195672661 X:107482890-107482912 GTTGATGGGCAGAAGGAACAGGG + Intergenic
1197255614 X:124259882-124259904 CATGATGGGCTGGAGGCAGAAGG + Intronic