ID: 1085666536

View in Genome Browser
Species Human (GRCh38)
Location 11:78419289-78419311
Sequence CTCCCTTAACCTTACAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085666534_1085666536 3 Left 1085666534 11:78419263-78419285 CCAGAACTGGTAGGCTGGGACCA No data
Right 1085666536 11:78419289-78419311 CTCCCTTAACCTTACAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085666536 Original CRISPR CTCCCTTAACCTTACAATTT AGG Intergenic
No off target data available for this crispr