ID: 1085668440

View in Genome Browser
Species Human (GRCh38)
Location 11:78438251-78438273
Sequence ACTAGATATCCCTGTAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085668440_1085668442 17 Left 1085668440 11:78438251-78438273 CCAACATTACAGGGATATCTAGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1085668442 11:78438291-78438313 TAATAACTATAAGAAATAATGGG 0: 1
1: 0
2: 3
3: 72
4: 818
1085668440_1085668441 16 Left 1085668440 11:78438251-78438273 CCAACATTACAGGGATATCTAGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1085668441 11:78438290-78438312 GTAATAACTATAAGAAATAATGG 0: 1
1: 0
2: 2
3: 35
4: 554
1085668440_1085668443 20 Left 1085668440 11:78438251-78438273 CCAACATTACAGGGATATCTAGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1085668443 11:78438294-78438316 TAACTATAAGAAATAATGGGAGG 0: 1
1: 0
2: 3
3: 26
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085668440 Original CRISPR ACTAGATATCCCTGTAATGT TGG (reversed) Intronic
901722486 1:11210745-11210767 ACTTGATATTCTTGTAATCTTGG - Intronic
912490953 1:110062558-110062580 GCTAGATATCCCTGGAAAGCAGG - Intronic
916572703 1:166041244-166041266 CCTACAAATGCCTGTAATGTAGG + Intergenic
918424221 1:184392008-184392030 ACTAGAAATTCTTGTAATTTGGG - Intronic
922289937 1:224201572-224201594 ACTGCATCTCCCTGGAATGTGGG - Intergenic
924445757 1:244128752-244128774 ACTTCATATCCCTGTAGTGATGG - Intergenic
1063525560 10:6781392-6781414 ACCAGATAGTCCTGGAATGTGGG + Intergenic
1068124157 10:52817406-52817428 AGAAGATATGCCTGTATTGTGGG - Intergenic
1079846469 11:25476631-25476653 CCTAAACATTCCTGTAATGTGGG - Intergenic
1085668440 11:78438251-78438273 ACTAGATATCCCTGTAATGTTGG - Intronic
1087484677 11:98746786-98746808 ATTAGATAATCCTTTAATGTAGG + Intergenic
1092855333 12:12667723-12667745 ACTGGTTACCCCTGTAATGATGG + Intronic
1096569478 12:52513244-52513266 ACAAGGTACCCCTGTAATCTTGG + Intergenic
1109872724 13:68355828-68355850 AGTTGATATCACAGTAATGTTGG + Intergenic
1111012406 13:82329057-82329079 ACTTGAAGCCCCTGTAATGTGGG + Intergenic
1111082801 13:83334632-83334654 ACTAGAATTTTCTGTAATGTAGG - Intergenic
1112371240 13:98795527-98795549 ATTAAATATCCCTGTACTTTGGG + Intronic
1114305524 14:21419770-21419792 ACTAGAAATTCCTGGAGTGTCGG + Intronic
1114325926 14:21588505-21588527 ATGAGATATCTCAGTAATGTGGG - Intergenic
1116642280 14:47479631-47479653 ATGAAATATCCCTGTAATGAAGG - Intronic
1118931571 14:70246710-70246732 ACGACATATTCCTGCAATGTAGG + Intergenic
1120810582 14:88799316-88799338 ACTAGTAATCCCTGTACTATGGG + Intergenic
1120958807 14:90106035-90106057 ACTAGTTATCCCTGTGACCTTGG + Intronic
1121888842 14:97570629-97570651 ATTAGAAATCCCTGTACTATTGG - Intergenic
1122966808 14:105134263-105134285 ACTACATTTCCTTGTACTGTGGG + Intergenic
1124592492 15:31065667-31065689 ATTAAATATCTCTGTAATGCTGG - Intronic
1125037883 15:35148035-35148057 ACTATAGATCACTGAAATGTTGG - Intergenic
1126414071 15:48399648-48399670 ACTTGACAGCCCTGTCATGTTGG + Intergenic
1126657850 15:50999387-50999409 ACTAGAAATTCCTCTAACGTAGG - Intronic
1129224458 15:74159929-74159951 ACTAGAAATCAGTGTAATGTGGG + Intergenic
1130201863 15:81838540-81838562 ACTAATTATCTCTGGAATGTAGG - Intergenic
1134040284 16:11063230-11063252 ATAAGATATGCCTGTATTGTTGG + Intronic
1134168557 16:11949940-11949962 ACCAGATATTCCTGTTAAGTCGG - Intronic
1136653639 16:31695379-31695401 ATTAGATATCCCTGTACTACAGG - Intergenic
1138781731 16:59796628-59796650 AGTGGGCATCCCTGTAATGTTGG - Intergenic
1146320507 17:31843002-31843024 ACTAGAAAACCCTGTGAGGTGGG + Intergenic
1148463084 17:47849173-47849195 ACCAGATACCCCTGGAATCTGGG + Intronic
1148897410 17:50847053-50847075 AATAGAATTTCCTGTAATGTTGG - Intergenic
1155147005 18:23092634-23092656 CTTAGAAATCCCTGTTATGTTGG + Intergenic
1158668916 18:59457151-59457173 ACAAGATGGCCCTGTTATGTTGG - Intronic
1164286266 19:23820336-23820358 ACTAGCCATCCCTGAAATGGTGG - Intronic
1166905987 19:46108710-46108732 ATCAGACATCCCTGAAATGTGGG + Intergenic
1167766743 19:51488369-51488391 AGGAGATATCCCTGTGAGGTTGG + Intronic
930281328 2:49373813-49373835 TCCAGATATCCCTGTAAGGAAGG + Intergenic
931578155 2:63742400-63742422 ACTAAGTCTCCCTATAATGTTGG - Intronic
935234807 2:101129582-101129604 TCTAGAAACCCCTGAAATGTGGG - Intronic
936582576 2:113716182-113716204 ACCAGATATCTCTGTAAGGAGGG + Intronic
939565714 2:143784435-143784457 ACTAGAGATTTCTGTAATGAAGG - Intergenic
943119301 2:183714298-183714320 ACTAAATATGCCTATAATGTGGG - Intergenic
943866656 2:192932553-192932575 ACCAGATGGCCCAGTAATGTTGG - Intergenic
944821642 2:203438636-203438658 ACTAATTATCCATGTATTGTAGG + Exonic
946568309 2:220992800-220992822 TCTAGATATTCCAGAAATGTTGG - Intergenic
1179086990 21:38226805-38226827 ACTAGCCATCCCTGAAATGGTGG - Intronic
1180579255 22:16814226-16814248 ACTAGATATTCATGTGAAGTTGG - Intronic
957756177 3:84491320-84491342 AGTGGATATCCCAGTAGTGTAGG - Intergenic
960133866 3:114086448-114086470 CTTGGATATCCCTGGAATGTGGG + Exonic
961775433 3:129280750-129280772 AGTATTTATCCCTGTAGTGTTGG + Intronic
965199916 3:165644778-165644800 ACTTTATATCCCAGTAATCTTGG + Intergenic
968772770 4:2518627-2518649 AGAACATATCCCTGTAAGGTGGG - Intronic
968802722 4:2754020-2754042 ACTAGTCATCCCTGCACTGTGGG + Intronic
970497572 4:16642229-16642251 ACTAGTTAGCTCAGTAATGTAGG - Intronic
973960742 4:56107375-56107397 ACTTAATATCCCTTTAAAGTAGG - Intergenic
977254525 4:94726092-94726114 ACTAGGCATGCCTGTTATGTTGG + Intergenic
980518716 4:133901924-133901946 ACTAGAAATCCCAGTAATGCTGG + Intergenic
986317054 5:6596557-6596579 AGTCGATATCCTTGTGATGTGGG + Intergenic
988009699 5:25465856-25465878 CCACGATATCACTGTAATGTTGG + Intergenic
991279165 5:64891650-64891672 ATTAAATATGCCTATAATGTAGG - Intronic
994549663 5:101215285-101215307 CTTAGATATCACAGTAATGTTGG - Intergenic
999660369 5:153856364-153856386 AGGAGATATCCCTGTAGTGTGGG + Intergenic
1000856437 5:166403853-166403875 AGTAGAGATCCCTATAGTGTGGG - Intergenic
1000917021 5:167094986-167095008 ACTAGAAATCCCTCAAAGGTAGG - Intergenic
1001782989 5:174386462-174386484 TCTAGATATTCCTGTGAGGTTGG + Intergenic
1002714977 5:181221499-181221521 ACTAAATCTCCCAGTAAAGTGGG + Intergenic
1003157526 6:3608949-3608971 GCTAGACATCCCTATACTGTCGG + Intergenic
1005129444 6:22488458-22488480 ACTAGATATCACTCTTAAGTAGG + Intergenic
1010542850 6:77113540-77113562 ATTGGGTATCCCTGTACTGTGGG + Intergenic
1012181929 6:96164953-96164975 AATAGAAATTCCTGTAATGATGG - Intronic
1012842059 6:104341931-104341953 AGTAGATCTCTCTGTAATGGTGG + Intergenic
1013411710 6:109889274-109889296 ACTAGCCATCCCTGAAATGGTGG - Intergenic
1016155368 6:140800276-140800298 AGGGGATATCCCTGCAATGTGGG + Intergenic
1017534449 6:155331247-155331269 ACTTGCTATCTCTGTGATGTGGG + Intergenic
1021673380 7:23055767-23055789 AGTAGATGTCACTGTAGTGTAGG - Intergenic
1035143374 7:156786985-156787007 ACTATAGATACCTGTATTGTTGG - Intronic
1037094676 8:14970930-14970952 ACTACATATCTCTATAATATAGG + Intronic
1038606189 8:29007416-29007438 ACTAAAGATTCATGTAATGTAGG - Intronic
1039305462 8:36257398-36257420 ACTACCTACCCCTGAAATGTGGG + Intergenic
1044789397 8:95832343-95832365 AGTATGTATCCCTGTAATATTGG - Intergenic
1053226908 9:36367027-36367049 ACCAGATATCCCTGTATTCTGGG + Intronic
1053621775 9:39826869-39826891 ACTGGATTTGCCTGGAATGTGGG - Intergenic
1053837710 9:42158735-42158757 ACTGGATTTGCCTGGAATGTGGG - Intergenic
1053883320 9:42617427-42617449 ACTGGATTTGCCTGGAATGTGGG + Intergenic
1053889349 9:42676872-42676894 ACTGGATTTGCCTGGAATGTGGG - Intergenic
1054222343 9:62424894-62424916 ACTGGATTTGCCTGGAATGTGGG + Intergenic
1054228370 9:62484278-62484300 ACTGGATTTGCCTGGAATGTGGG - Intergenic
1058287416 9:103196060-103196082 AGTAGATATCACTGTAATCAAGG + Intergenic
1060603538 9:124894589-124894611 ACTAGATATGCCTGTTGGGTAGG + Intronic
1186864043 X:13701544-13701566 AGTACACATCCATGTAATGTGGG + Intronic
1187325945 X:18288594-18288616 ACTAAATATCTCGGTAATTTTGG - Intronic
1187825280 X:23329600-23329622 GATAGAAATCCCTGTAAAGTAGG + Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1191791959 X:64980563-64980585 ACTATATATCCCTGGAACCTAGG - Intronic
1193305521 X:79946091-79946113 AGTATATATCCCTAAAATGTAGG + Intergenic
1195480394 X:105338210-105338232 AATATATATCACTGTACTGTAGG - Intronic
1196713684 X:118790597-118790619 ACTAGATCTCTATGTATTGTTGG - Intronic
1197483341 X:127014761-127014783 AATAAATATCCCTGTAGTGATGG + Intergenic
1197943474 X:131813721-131813743 ACAAGATATCCCTGTACTTTGGG + Intergenic