ID: 1085669864

View in Genome Browser
Species Human (GRCh38)
Location 11:78452934-78452956
Sequence CTGTAGGTCTGGCGGTTACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085669859_1085669864 -1 Left 1085669859 11:78452912-78452934 CCAGAAGATACACATAGTTTATC 0: 1
1: 0
2: 0
3: 28
4: 225
Right 1085669864 11:78452934-78452956 CTGTAGGTCTGGCGGTTACCGGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085669864 Original CRISPR CTGTAGGTCTGGCGGTTACC GGG Intronic
900496793 1:2979339-2979361 CTGTAGGTCTGGCTGTGTTCAGG + Intergenic
905518210 1:38577825-38577847 CTGAAGGTCTGGAATTTACCAGG + Intergenic
905630906 1:39518177-39518199 GTGTAGCTCTGGGGGTTCCCAGG + Intronic
905666854 1:39767999-39768021 GTGTAGCTCTGGGGGTTCCCAGG - Intronic
906120961 1:43390074-43390096 CTCTAGGTCTGGGGGTGGCCGGG + Intronic
920059419 1:203217285-203217307 CTGTAGGTATGGCTGTTGTCTGG - Intronic
1063570577 10:7211297-7211319 CTGCAGGTCTGGGGTTGACCTGG - Intronic
1070669594 10:78368669-78368691 GTGGAGGTCTGGCAGTTACATGG + Intergenic
1078461488 11:11518499-11518521 CTTTAGGTGTCGTGGTTACCAGG + Intronic
1084784943 11:71436962-71436984 CTGCAGGTCTGCTGGTTCCCTGG - Intronic
1085669864 11:78452934-78452956 CTGTAGGTCTGGCGGTTACCGGG + Intronic
1100325729 12:93538172-93538194 ATGTAGGTCTGCAGGTTAGCTGG - Intergenic
1109584097 13:64375175-64375197 CTGTAGCTCTGACCTTTACCTGG - Intergenic
1119218102 14:72884720-72884742 CTGTAGCACTAGCAGTTACCTGG - Intronic
1120110638 14:80551410-80551432 CTGTAGGTCTGGGGTTTATATGG - Intronic
1202859799 14_GL000225v1_random:73743-73765 CTGTGGGTGTGGCCGTTGCCGGG + Intergenic
1123980344 15:25596576-25596598 CTGCAGATCTGGCTGTTCCCAGG + Intergenic
1127841618 15:62836451-62836473 CTGTAGGTCTGTCTGTGAGCAGG + Intronic
1131710368 15:95047558-95047580 GTGAAGGTCTGGCTGTTTCCTGG - Intergenic
1143719157 17:8798240-8798262 CTGTGGGTCTGGAGGTTGCTGGG - Exonic
1147321953 17:39651951-39651973 CTGTAGGCCTGGGGGCTACATGG + Intronic
1160628200 18:80227832-80227854 CTGGTGGTCTGGTGGTTCCCGGG - Intronic
1160628212 18:80227883-80227905 CTGGTGGTCTGGTGGTTCCCGGG - Intronic
1164831017 19:31320808-31320830 CTGTAGGTCTGGGTGTTCCTGGG + Intronic
1165313286 19:35040995-35041017 CTGCACGTCTGGTGTTTACCTGG + Intronic
930329413 2:49963626-49963648 CTGAAGGTTTGGTGTTTACCAGG - Intronic
933759677 2:85665086-85665108 CTGTAGGCCTGGCACCTACCAGG + Intronic
934764484 2:96872999-96873021 CTCTAGGTGTGAAGGTTACCAGG + Intergenic
942485861 2:176439396-176439418 CTGTTGGTCTGGTGGCTTCCTGG + Intergenic
945739995 2:213647720-213647742 CTGTAGGTCAGGCTCTTGCCAGG + Intronic
948378941 2:237540134-237540156 CTGCAGGGCTGGGGGTTCCCAGG - Intronic
1175166800 20:57049628-57049650 CTATAGGTCTCACAGTTACCTGG + Intergenic
1175599772 20:60263755-60263777 CTGTAGGTCTGGAAGAGACCTGG + Intergenic
1181485105 22:23225564-23225586 CTGTAGGTCTGGAGGTGGCTGGG + Intronic
960364705 3:116757145-116757167 ATGTAGGTCTGGTTGTTACTGGG - Intronic
962891783 3:139678512-139678534 TTTGAGGTCTGGCGTTTACCAGG - Intergenic
988894406 5:35656637-35656659 ATCTAGGTCTGGCGTTTGCCTGG + Intronic
992828497 5:80571543-80571565 CTGTTTGTTTGGAGGTTACCAGG + Intergenic
998820577 5:146054091-146054113 CTGCAGGTCTGGGGGTGTCCTGG + Intronic
999722120 5:154406137-154406159 GTGTAGGTCTGACAGGTACCTGG + Intronic
1005085044 6:21997267-21997289 CTGTACTTCTGGCTGTTACCAGG - Intergenic
1006055203 6:31378898-31378920 CTGCAGGGCTGGGGGTAACCGGG - Intergenic
1007814961 6:44515231-44515253 CTGTAGTTCTGGTGGTCTCCAGG + Intergenic
1008971028 6:57368315-57368337 CTGTAGGTCTGGGTGGCACCAGG + Intronic
1009159990 6:60270133-60270155 CTGTAGGTCTGGGTGGCACCAGG + Intergenic
1021250651 7:18321257-18321279 CTGAAGGTCTGGAGTTAACCAGG - Intronic
1025160312 7:56653708-56653730 CTGTGGGTGTGGCGGTTTCAAGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035553585 8:546506-546528 CGGTAGGTTTAGCGGTCACCGGG - Intergenic
1039772690 8:40703655-40703677 CTGTAGATCTGGCAGTCACACGG + Intronic
1052316865 9:27124349-27124371 CTGTAGGTATGTGGGTTTCCTGG + Intronic
1062181834 9:135195136-135195158 CTGCAGGTCTGGGGGGTACATGG - Intergenic
1195731662 X:107974462-107974484 CTGTAGGCCGGGCAGTTATCAGG - Intergenic