ID: 1085670526

View in Genome Browser
Species Human (GRCh38)
Location 11:78460081-78460103
Sequence CTGAAGACACAGAAGAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 1, 2: 7, 3: 71, 4: 612}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085670526 Original CRISPR CTGAAGACACAGAAGAAGGG TGG Intronic
900161437 1:1225907-1225929 CTGAAGACACGGCTGCAGGGCGG + Intronic
900926542 1:5709709-5709731 CTGATGACAGGGAAGATGGGAGG - Intergenic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901019116 1:6247009-6247031 CTGAAGAGACAGAACAGGGCAGG - Intergenic
901127441 1:6939565-6939587 CTGGAGACAGAGAGGACGGGAGG - Intronic
901595571 1:10382837-10382859 GGGGAGAAACAGAAGAAGGGAGG + Intergenic
902500572 1:16908351-16908373 CTGAAGACACCCAGGCAGGGAGG + Intronic
903656009 1:24949236-24949258 CTGAAGAAACAGCAAAAAGGAGG + Intronic
904757248 1:32774696-32774718 CAGAGGACAAAGGAGAAGGGAGG + Exonic
904789267 1:33006344-33006366 CTGAGGGCACAGCACAAGGGAGG - Intergenic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905343999 1:37299167-37299189 CTGAAGACAGAACAGGAGGGAGG - Intergenic
905510956 1:38519741-38519763 CTGAAGGGAGAGGAGAAGGGAGG + Intergenic
905815286 1:40945560-40945582 CTGAAGACAAAGAAGTAAAGTGG + Intergenic
905828504 1:41045743-41045765 CCCAGGACACAGAACAAGGGAGG - Intronic
906477398 1:46178972-46178994 CTGAAGAGACAGAAGAGAGAGGG - Intronic
906641386 1:47442984-47443006 CTGAAGGCAGAGAAGAAGGGAGG + Intergenic
907266192 1:53262942-53262964 CTGAGGAGACAAAAGCAGGGAGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
908013720 1:59810138-59810160 ATGAAGGCATAAAAGAAGGGAGG - Intergenic
908549532 1:65194806-65194828 ATGAGGACTCAGAAGAAGAGGGG - Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909700607 1:78517676-78517698 TTGAGGACACAGAAGAAGGTAGG + Intronic
909861025 1:80606177-80606199 GTGAAGGCTCAGAAGAAGAGAGG + Intergenic
910445952 1:87299181-87299203 TGGAAGACAGAGAAGATGGGTGG + Intergenic
910549449 1:88459613-88459635 ATGAAGACACTGATGAAGGTGGG - Intergenic
910572323 1:88719432-88719454 AGGAAGAGACAGAACAAGGGAGG - Intronic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
914302807 1:146390878-146390900 CTGAAGACACCCAGGCAGGGAGG + Intergenic
914517010 1:148382805-148382827 CTGAAGACACCCAGGCAGGGAGG - Intergenic
914760527 1:150594846-150594868 GTGAAGAGAAAGCAGAAGGGTGG + Intergenic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915854429 1:159366680-159366702 CGGATGTCACAGAAGAAGTGAGG - Intergenic
915860593 1:159440311-159440333 CGGATGTCACAGAAGAAGTGGGG - Exonic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918223607 1:182458229-182458251 CTACAGCCACAGAGGAAGGGAGG - Intronic
918982111 1:191575794-191575816 CTGCAGAGAAAGATGAAGGGAGG + Intergenic
919061586 1:192640902-192640924 TTGAAAACACAGAAGAAAGAAGG - Intronic
920009896 1:202860130-202860152 GTGAAGGACCAGAAGAAGGGAGG - Intergenic
920034408 1:203056558-203056580 CTGCAGAGGCAGAGGAAGGGAGG - Intronic
920203921 1:204277728-204277750 CTGTCCACACAGAAGAAGGCTGG - Intronic
922055781 1:222041248-222041270 CTGAAGTCACAGAGGTAGAGGGG - Intergenic
922236455 1:223726256-223726278 CAGACCCCACAGAAGAAGGGAGG - Intronic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922614168 1:226951351-226951373 CTGAAGCGACAGGAGGAGGGAGG + Intronic
923885771 1:238153599-238153621 CTGCATACACAGTAGAAAGGTGG + Intergenic
924457587 1:244230925-244230947 GTGAAGTCACCGAAGAAAGGTGG - Intergenic
924583912 1:245345297-245345319 GTGAAGTCGCAGAAGGAGGGAGG - Intronic
1062995620 10:1863583-1863605 CTGAAGAGACAGAGGAAGACGGG - Intergenic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063243439 10:4194244-4194266 ATGAAGTCAGAGAAGAAGGTGGG - Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1063914281 10:10865978-10866000 GTGAAGTAACAGCAGAAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064504675 10:16015729-16015751 AGGAAGAGACAGAGGAAGGGAGG + Intergenic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1066111425 10:32200524-32200546 CTAAGGACAGAGAAGAGGGGAGG + Intergenic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1067426899 10:46217358-46217380 GTGAAGACACAGGAGAAAGAGGG + Intergenic
1067516747 10:46954228-46954250 GTGAAGACACAGAGGAAAGACGG - Intronic
1067645504 10:48097598-48097620 GTGAAGACACAGAGGAAAGACGG + Intergenic
1067831646 10:49614196-49614218 CTGAGGACAGCGAAGAAGAGGGG + Exonic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070830910 10:79417641-79417663 ATGAAGAAAGAGAAGAAGAGTGG + Intronic
1070976251 10:80608281-80608303 CTGAAGGCACAGAGGGCGGGAGG + Intronic
1071138451 10:82479345-82479367 CTATAGACAGAGAGGAAGGGGGG + Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071585966 10:86821804-86821826 CTCAAGAAACAAAAGGAGGGAGG - Intronic
1071629652 10:87208042-87208064 CTGGAGTCTTAGAAGAAGGGAGG + Intergenic
1072715477 10:97749647-97749669 CTGTAGAGACAGAAGAACTGGGG - Intronic
1072791100 10:98318471-98318493 TTGAAGACAGAGAGGAAGAGGGG + Intergenic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073749986 10:106514499-106514521 CTGCAGTCACAGAACAATGGCGG + Intergenic
1073787752 10:106908884-106908906 CTGAAGAAACAGAAATTGGGTGG - Intronic
1074163176 10:110851145-110851167 CTCAAACCACAGAAGAAGGGCGG - Intergenic
1075646931 10:124102800-124102822 CTGAAGCCACAGGGGAAGGATGG + Intergenic
1075765262 10:124887844-124887866 ATGAAGACGCAGAGGAAGGGAGG + Intergenic
1075847263 10:125555017-125555039 AGGAAGACACAGAAGAGGGAAGG - Intergenic
1076186673 10:128455525-128455547 CTGAAGCCACAGCAGAGGAGCGG - Intergenic
1076400454 10:130180714-130180736 CTGAAGAGACAGCAGCAGTGTGG - Exonic
1077006369 11:359446-359468 CTGATGACACAGATCAAGTGAGG - Intergenic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1078772335 11:14362500-14362522 CTGAAGACACAGGAGAATATGGG + Intronic
1079380412 11:19933153-19933175 CTGCAGAGACAGAAGAGAGGAGG - Intronic
1079506957 11:21163720-21163742 CTGAGGACACAGAAAAAGGCAGG - Intronic
1080694983 11:34595649-34595671 GTGTACACACAGAAGAAGGAAGG - Intergenic
1080812317 11:35716869-35716891 ATGAAGAAATTGAAGAAGGGAGG - Intronic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081469967 11:43360434-43360456 ATCAAGAAACAAAAGAAGGGTGG - Intronic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1082821950 11:57550092-57550114 GTGAAGACCAAGAAGAAGTGAGG + Exonic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083859492 11:65412258-65412280 CTGAAGACCCAGACACAGGGAGG - Exonic
1083965893 11:66043576-66043598 CTGAAGACTCACAAGACGGCAGG - Exonic
1084010085 11:66342988-66343010 CTGAAGACACAGAAAAGAGAGGG - Intronic
1084909067 11:72373015-72373037 CTGAAGACACAGAGATGGGGAGG + Intronic
1084911022 11:72389312-72389334 CTGATGGCACAGAGGAAGGTAGG + Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1085532570 11:77200738-77200760 TTGAAGAGCCAGAAGAAGGGAGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085774456 11:79352744-79352766 AAGGAGACAGAGAAGAAGGGAGG + Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086203570 11:84232643-84232665 GTGAGGACACAGCAGAAGGATGG + Intronic
1086859555 11:91909083-91909105 CTGTAGCCACAGAATAAGTGGGG - Intergenic
1089029164 11:115305410-115305432 CTGAAAACACAGAAAAGGAGAGG - Intronic
1089436518 11:118473472-118473494 AGGAAGAGACAGAAGACGGGGGG - Exonic
1090517737 11:127446840-127446862 CTGAAGACCCAGAGGAAATGAGG - Intergenic
1090822891 11:130360790-130360812 CTGAAAACACAGTAAAAGGATGG - Intergenic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091180071 11:133596368-133596390 CAGAAGGCACGGAGGAAGGGAGG - Intergenic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1091898046 12:4120456-4120478 TTGAGGACACAGGGGAAGGGAGG - Intergenic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092909635 12:13135552-13135574 GCAAAGACACAGAACAAGGGGGG + Intronic
1093065846 12:14657218-14657240 CTGATGACATAGAAGGAGTGAGG + Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093428151 12:19052606-19052628 CTTAAAACATAGAAGAAAGGAGG + Intergenic
1093623079 12:21315264-21315286 CTGAAGACTGAGTAGAAGTGGGG - Intronic
1093996021 12:25643722-25643744 CTGATGGCAAAGAAGAAGGGAGG + Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094281332 12:28743006-28743028 CTGGAGTCACAGAAGCATGGAGG - Intergenic
1094320632 12:29179010-29179032 CTGAAGACACAGGAAAAAGATGG - Intronic
1094388080 12:29917181-29917203 CTGCAGAACCAGAAGAAGAGTGG - Intergenic
1095042608 12:37459411-37459433 CCGAAGACACAGAAGAAGGCAGG - Intergenic
1095109679 12:38279282-38279304 ATGAACACACAGATGAAAGGTGG - Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1096066950 12:48748658-48748680 TTGAAGAAACAGGAGAAGGTAGG - Intergenic
1096819968 12:54226315-54226337 CTCAAAACAGAGAAGAGGGGTGG - Intergenic
1096869066 12:54582132-54582154 CTGGGGACACAGAGAAAGGGAGG + Intronic
1097362175 12:58670227-58670249 ATGAAGAAACTGAAGAAGTGAGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1099265724 12:80445005-80445027 CTGAAGAAACAGCAGAATGCAGG - Intronic
1099389575 12:82062839-82062861 GTGAAGACACAGAAAAAAGATGG + Intergenic
1099749615 12:86756211-86756233 TTGAACACACAGAAAAAAGGTGG - Intronic
1100784762 12:98067038-98067060 ATTAAGACACAGAGAAAGGGAGG + Intergenic
1101288425 12:103340815-103340837 CTGAAGACACAGCAATAGGCTGG + Intronic
1101632642 12:106510624-106510646 GTGAAGAAAAAGAAGAAGTGAGG - Intronic
1101997493 12:109535425-109535447 CTGAGGACGCAGAAAATGGGAGG - Exonic
1102542217 12:113629506-113629528 CTGAAGACAGAAAAGCAGGTGGG + Intergenic
1102882271 12:116494687-116494709 CTGAAGACAAAGGAGAAGCCTGG + Intergenic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1102908436 12:116694836-116694858 CGGATGACACAGAAGAGGTGGGG + Intergenic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1104565290 12:129875652-129875674 TTCAAGTCACAGAACAAGGGAGG + Intronic
1105461559 13:20594463-20594485 CTGCATGCAAAGAAGAAGGGCGG + Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106380140 13:29228734-29228756 ATGAAGAGAAAGGAGAAGGGGGG + Intronic
1106610613 13:31276081-31276103 CTGATCACACAGATGAAAGGGGG - Intronic
1107011071 13:35671789-35671811 TTGAAGACACAGCAGAAAGGGGG + Exonic
1107809441 13:44186203-44186225 GTGAAGACACAGCAAAAAGGTGG - Intergenic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1108695005 13:52895536-52895558 CTGAAGACACAGGAGAGGAAGGG - Intergenic
1108756353 13:53507723-53507745 ATGAGGACACAGAAGCATGGTGG - Intergenic
1108808290 13:54186936-54186958 CTGAGGGCCCAGAAAAAGGGAGG + Intergenic
1109679607 13:65733009-65733031 CTGAAAACAAGGAAGCAGGGAGG + Intergenic
1111203368 13:84969660-84969682 CTGGAGGTAGAGAAGAAGGGTGG - Intergenic
1112883050 13:104133278-104133300 CTGAAGTCACAGAAGAAATCAGG - Intergenic
1113580686 13:111426501-111426523 CTGAAGTCACAGAGGCAGTGAGG - Intergenic
1113738716 13:112696647-112696669 CAGAAGAGACAGGAGAAGGAAGG - Intronic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114209168 14:20601023-20601045 CTGCAGCCACTGATGAAGGGAGG - Intronic
1114365535 14:22023368-22023390 CTGAGGCCTCAGAAGAAGAGAGG - Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1116722816 14:48522761-48522783 CTCAAGAAACAGAAGTAAGGTGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1117106767 14:52405427-52405449 CTAAGAACAAAGAAGAAGGGTGG + Intergenic
1117389341 14:55248086-55248108 AAGAAGCCACAGAATAAGGGAGG + Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1119597237 14:75946590-75946612 CTGAACACACAGAAGATGCTTGG - Intronic
1119858107 14:77916189-77916211 GGGAAGACACAGAGAAAGGGAGG - Intronic
1120037070 14:79709800-79709822 CTGAAGACAGACAAGGAGAGAGG + Intronic
1120524232 14:85559275-85559297 CTGAAAACAGAGTAGAAGAGGGG + Intronic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121881083 14:97500813-97500835 ATGCAGACATAGGAGAAGGGGGG + Intergenic
1121918762 14:97860775-97860797 GTGAAGACACAGAAGACAGATGG + Intergenic
1122622642 14:103068564-103068586 CTGAAGACACAGGGCAAGGGTGG + Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1202941138 14_KI270725v1_random:147145-147167 CCCAAGACACAGAAAAAGGCAGG - Intergenic
1123663222 15:22584834-22584856 CTAAAGACACAGAAGAATTATGG - Intergenic
1124259320 15:28174253-28174275 CTAAAGACACAGAAGAATTATGG - Intronic
1124317051 15:28679272-28679294 CTAAAGACACAGAAGAATTATGG - Intergenic
1124566400 15:30818217-30818239 CTAAAGACACAGAAGAATTATGG + Intergenic
1124698010 15:31882694-31882716 TGGAAGCCAGAGAAGAAGGGAGG - Intergenic
1124836983 15:33204830-33204852 CTGAAATCACACAAGAAGGCTGG + Intergenic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1126292324 15:47095996-47096018 CCCAAGACACAGAACAAGGCAGG + Intergenic
1126586619 15:50294902-50294924 CTAAAGACAAAAAAGAAGGGTGG + Intronic
1126957522 15:53950720-53950742 CTGAAGACACAGAAATAGCCAGG + Intergenic
1127804806 15:62509665-62509687 CTGATCACACAGAACCAGGGAGG + Intronic
1128510766 15:68312774-68312796 CTGAAGATGCAGCTGAAGGGAGG + Exonic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1128955686 15:71940939-71940961 AAGAAGAGACAGAAGAAAGGAGG + Intronic
1129236730 15:74228190-74228212 CTGAAGGCGCAGTAGAGGGGTGG + Intergenic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129790502 15:78337884-78337906 CTGCAGGCACAAAACAAGGGCGG - Intergenic
1130043665 15:80427476-80427498 CTCAAGACTGAAAAGAAGGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1131502217 15:92979464-92979486 AGGAAAACACATAAGAAGGGGGG - Intronic
1131732990 15:95301731-95301753 ATGAAGACAGAGTAGAATGGTGG + Intergenic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132574091 16:656792-656814 CTAAAGCCACAGAAAAAGGTTGG - Exonic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133064248 16:3194911-3194933 CAGAAGTCACAGAAGAAGGGCGG - Intergenic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1133624921 16:7562360-7562382 CTGAAGTTACAGAAGAGGGCAGG + Intronic
1133630331 16:7614350-7614372 CTGATAAGACAGAAGAGGGGAGG - Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134354971 16:13473571-13473593 CAGAAGAAACTGAGGAAGGGTGG - Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134819914 16:17238653-17238675 CTGAAGACAAAGAGGAGGGCAGG - Intronic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135182359 16:20286919-20286941 TTGAAGCCACAGAAAAAGGATGG - Intergenic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135835804 16:25824152-25824174 GGGAAGACACAGAAACAGGGAGG + Intronic
1137774075 16:51041086-51041108 ATGAAGACAAGGAAGAAGGAAGG + Intergenic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1140230272 16:73112208-73112230 GGGAAGACAGAGAAGAAGAGAGG + Intergenic
1140263964 16:73404259-73404281 CTTAAGGCACAGAAGAGGGCTGG + Intergenic
1140283136 16:73573986-73574008 AGGAAGACAGAAAAGAAGGGAGG - Intergenic
1140677751 16:77350266-77350288 CTGAAGACACAGAAAACTCGTGG + Intronic
1140928491 16:79605649-79605671 GTGAAGAAAGAGAAGAAGGCTGG - Intergenic
1141812260 16:86383421-86383443 CTGAGGGCACAGGAGTAGGGAGG - Intergenic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1142909987 17:3080730-3080752 TAGAAGACTCAGAAGAAGAGAGG - Intergenic
1142914728 17:3127007-3127029 TTGATGTCACAGAAGAAGTGTGG + Exonic
1143658861 17:8312679-8312701 CTGAAAACGGAGAAGATGGGTGG - Intronic
1144359563 17:14479086-14479108 CTGAAAACAGAGAACCAGGGAGG - Intergenic
1144858224 17:18282698-18282720 CTTAAGACCAAGAAGAATGGCGG - Exonic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148582094 17:48751323-48751345 CTGCAGACAGAGAAGCAGAGTGG - Intergenic
1148824045 17:50379034-50379056 CAGAAGATACAGAAGAAGACTGG - Intronic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149610714 17:57955946-57955968 CTGAGGACACAGGAGATGGTGGG + Intergenic
1149620293 17:58039779-58039801 GTGCAGCCACAGAAGAAGGAGGG + Intergenic
1150246159 17:63676977-63676999 AGGAAGGCACAGTAGAAGGGTGG + Intronic
1150345996 17:64405175-64405197 CTGAAGACAAAGGAAAAGGAAGG + Intronic
1150951671 17:69808994-69809016 TTGAAGACACAGCAAAAAGGCGG + Intergenic
1151337173 17:73446843-73446865 CCCAAGACAGAGAAGGAGGGAGG - Intronic
1151817958 17:76480790-76480812 CAGAAGACACAGCAGCAGGCAGG - Intronic
1152891562 17:82884508-82884530 CTGAAGACGCAGAAGAGAGTGGG + Intronic
1153084962 18:1274762-1274784 CTGGAGACACAAGAGAAAGGGGG + Intergenic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153460919 18:5332315-5332337 ATGAAGACGGAGGAGAAGGGAGG + Intergenic
1153469172 18:5424029-5424051 CTAAAGATACTAAAGAAGGGGGG + Intronic
1155128501 18:22904420-22904442 CTTGAGACACAGAAGAAGACTGG + Intronic
1155621580 18:27785942-27785964 CTTAAGACCCTGAGGAAGGGAGG + Intergenic
1156503953 18:37577407-37577429 CGGATGGCACAGAAGAAGGAAGG - Intergenic
1156641777 18:39109667-39109689 GTGAAGACAGAGAAGAATTGAGG + Intergenic
1157125529 18:44952377-44952399 TTGAAGTCAAAGAAGAAGCGTGG + Exonic
1157414366 18:47489754-47489776 GTGAGGTCACAGAAGAGGGGAGG + Intergenic
1157621155 18:49018169-49018191 AGGAAGACACAGGAGAAGGAAGG + Intergenic
1157719545 18:49913485-49913507 CTGAGGACACAGAGAAAGTGGGG - Intronic
1157958308 18:52124016-52124038 TTGAAGACACAGATGAAAGTAGG + Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158860502 18:61587452-61587474 AGGAAGACAAATAAGAAGGGAGG + Intergenic
1159103636 18:63981779-63981801 CTGAAGACACTGAAGAGTGCAGG + Exonic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1161735444 19:5989624-5989646 AGGAAGAAACAGAAGCAGGGGGG - Intergenic
1162575753 19:11497844-11497866 CTGGAGAAACCTAAGAAGGGAGG + Intronic
1162673210 19:12276207-12276229 GTGCAGACACAGAATAAGAGTGG - Intronic
1162682122 19:12353235-12353257 TTGTAGACAGAGAATAAGGGTGG - Intronic
1162956765 19:14103067-14103089 CTGAGGACACAGCATCAGGGAGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1165015082 19:32874926-32874948 TTGGAGAGAAAGAAGAAGGGCGG - Intergenic
1165293295 19:34906089-34906111 CTGAAGACAGAGAAGATGCAGGG + Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167408932 19:49333677-49333699 CTCAGGACAGAGAAGAGGGGTGG + Intergenic
1168417077 19:56175951-56175973 CTGAGGAGACAATAGAAGGGAGG - Intergenic
925368294 2:3325842-3325864 CTGAAGCCACAGGATAAGGGTGG - Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
926931849 2:18048854-18048876 ATGAAGACACAGGGGAAGGCTGG - Intronic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927205356 2:20605616-20605638 TTAAAGAGACAGAAGAAGGTAGG - Intronic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927454945 2:23241317-23241339 CTGGAGACAGAGCAGAAGGTGGG + Intergenic
927686413 2:25174445-25174467 AGGAAGACATAAAAGAAGGGAGG + Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928168550 2:28988513-28988535 CTGAAGACACAGGGGAGGGAGGG - Intronic
928205949 2:29283510-29283532 GAGAAGACCCAGAAAAAGGGTGG + Intronic
928320413 2:30278814-30278836 TTGAAGATACAGAAGAAAGGAGG - Intronic
928520702 2:32085660-32085682 GTGAAGAAACAGAAGAATCGGGG + Intronic
928738333 2:34319155-34319177 CTGGAGACAGATAAGAAGGGTGG - Intergenic
928963664 2:36955560-36955582 GAGAAGAGACAGAAGAAGGGAGG - Intronic
929271938 2:39982223-39982245 CTGAAGACTCAGAGAAAGGCTGG + Intergenic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
930021644 2:47005213-47005235 CTGGACACAGAGAGGAAGGGAGG + Intronic
930068363 2:47345132-47345154 CTGGAGACAAAGGAGAGGGGAGG + Intergenic
930294040 2:49530929-49530951 CAGAAGGCTCAGAAGAAGGAGGG - Intergenic
930554114 2:52873407-52873429 TTGAAGACTCAGAAGAAGAGAGG + Intergenic
931210199 2:60186476-60186498 GTGAGGACACAGAAGAAAGGTGG - Intergenic
931510959 2:62993235-62993257 CTGATGACACAGAATAGTGGGGG + Intronic
932042214 2:68311844-68311866 CCTAAGACACTGAAGAATGGCGG + Intronic
932542038 2:72665016-72665038 CTGAGAACACTGAAGAGGGGTGG + Intronic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
934161870 2:89257452-89257474 CGGAAGACACAGAGGAAGGGAGG + Intergenic
934205412 2:89924910-89924932 CGGAAGACACAGAGGAAGGGAGG - Intergenic
934518645 2:95005630-95005652 CTGATGACAGAGAGGAAGGCAGG + Intergenic
934607307 2:95706393-95706415 CTCAGGACACAGGAGAAGGTTGG + Intergenic
935641250 2:105292555-105292577 CAAAAGGCAGAGAAGAAGGGAGG + Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935813437 2:106823820-106823842 GTGAAGACACAGCAGAAAGATGG - Intronic
936252547 2:110877768-110877790 GTGAAGACAGAGAGGAAGGGAGG + Intronic
936381964 2:111994228-111994250 CTGGAGACAGAGAGGAAGAGAGG - Intronic
937305777 2:120869751-120869773 CTGAAGACAGAGGAGTAGAGTGG + Intronic
938230788 2:129656991-129657013 CTTAAGCCACAGAAGAAGGTGGG + Intergenic
938930173 2:136079864-136079886 GTGAAGACACAGCAGGAAGGTGG - Intergenic
939038768 2:137163465-137163487 ATTGAGACACAGAAGAAGAGAGG + Intronic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
940322173 2:152389303-152389325 ATGAAGATACAGCAGAAGGATGG - Intronic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
941080040 2:161050100-161050122 CTGAAGAAACAGAAAACTGGGGG - Intergenic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941758990 2:169220002-169220024 ATGAAGGCACAGAAGTATGGCGG - Intronic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942475963 2:176321130-176321152 CTGAAAACAAGGAAGAAGGGAGG - Intronic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
942774945 2:179570236-179570258 CTGATGACACAGAACATGGGAGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
943453455 2:188074313-188074335 ATCAAGATACAGAAGAAGGTTGG - Intergenic
943600979 2:189920660-189920682 CACAAGACACAGAAGAAAGTGGG - Intronic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946617565 2:221526500-221526522 CTGAGCACACAGGAGAAAGGTGG - Intronic
947164178 2:227244928-227244950 CTGAAGACATAGGAAAAAGGAGG - Intronic
947288740 2:228547363-228547385 CTGGAGAAAGAGAGGAAGGGAGG - Intergenic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
948715729 2:239860679-239860701 CTCAAGACAAAGAAAAAGTGTGG + Intergenic
948749862 2:240125329-240125351 CTGAAGATACACAAGAAAGTGGG - Intergenic
1169007002 20:2215974-2215996 CTGAAGAGAAAGAAGAAAGGGGG + Intergenic
1170082205 20:12489184-12489206 CTAAAGACATAAAAGAAGTGTGG - Intergenic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170700084 20:18695651-18695673 AGGAAGAAACAGAAAAAGGGAGG - Intronic
1170943881 20:20872198-20872220 TTGAAGACAGGGAAGAAAGGGGG - Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171804071 20:29658669-29658691 CCCAAGACACAGAAGAAGGCAGG + Intergenic
1172115959 20:32573861-32573883 CTGAGGGGAGAGAAGAAGGGAGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173182178 20:40813707-40813729 GTAAAGACAGAGAAGAAGAGTGG - Intergenic
1173306509 20:41855745-41855767 TTGAATAAACAGAATAAGGGAGG + Intergenic
1173454384 20:43190967-43190989 GTGCTGACACAGAAGAAGGAGGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1175106458 20:56618494-56618516 CTGAAGACAGAGAGCAAAGGTGG - Intergenic
1175245285 20:57578591-57578613 CTGAAGAGCCAGGAGAAGCGAGG + Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1175765358 20:61588662-61588684 CTGGAGACAGAGGAGAAAGGGGG - Intronic
1176225337 20:63994926-63994948 CAGAAGTCACAGAAGAAGAGTGG + Exonic
1176582023 21:8539797-8539819 CCCAAGACACAGAAAAAGGCAGG + Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1177787559 21:25688361-25688383 CTTAAGACACAGAAGACATGAGG + Intronic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1177931331 21:27287730-27287752 CTAAAAACAAAGAAGAAGGGAGG + Intergenic
1178901602 21:36603444-36603466 CTAAAGACACATAAGAAAGGAGG + Intergenic
1179274923 21:39883399-39883421 CTGATGACAAAGAAGAAATGTGG - Intronic
1179367760 21:40773932-40773954 TTGAAGACACAGTAGAAGCTGGG + Intronic
1179670381 21:42942826-42942848 CTGAAGTCACAGGGGAGGGGTGG + Intergenic
1179979074 21:44887138-44887160 CTGCTGACAGAGAAGAAGGCAGG + Intronic
1179994090 21:44966030-44966052 CTGAGGACCCAGAGGAAGGGTGG + Intronic
1180264860 22:10516845-10516867 CCCAAGACACAGAAAAAGGCAGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180716877 22:17877837-17877859 CTCAAAAAAAAGAAGAAGGGAGG - Intronic
1182473712 22:30564373-30564395 CAGAAGACAAAGAGGCAGGGAGG + Intronic
1183477314 22:38042736-38042758 CTGACCACACAGAAGAGGGCTGG + Intergenic
1183508851 22:38223506-38223528 GGGAAGGCACAGAGGAAGGGGGG + Intronic
1183590557 22:38777111-38777133 CTGAAGACAGAGAAGTTAGGAGG + Intronic
1185325802 22:50225331-50225353 CAGAAGACACAGGAGAGGCGTGG + Intronic
949474639 3:4431731-4431753 CTGAAGTCACAGACCAAGGTGGG + Intronic
950182989 3:10928043-10928065 ATGAAGACACAGAAGCACAGAGG - Intronic
951318762 3:21219651-21219673 CTGAAGACACAGCATAAGTATGG - Intergenic
951660503 3:25058614-25058636 CCTAAGACACAGAATAAGAGGGG + Intergenic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
952720699 3:36529757-36529779 CTGCAGTCAGAGAAGAAGGCAGG - Intronic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953305083 3:41821577-41821599 CTAATGACCCTGAAGAAGGGAGG - Intronic
953321377 3:41975219-41975241 CTGAAGACAAGGAAGAAAGAGGG - Intergenic
955200871 3:56851128-56851150 CTGCAGGCACAGAGGAAGTGAGG - Intronic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955562195 3:60203905-60203927 GTGAAGACAGAGTAGAAGGATGG + Intronic
955569667 3:60291102-60291124 CTGCAGACACACAAGGAGTGAGG + Intronic
956669173 3:71670466-71670488 CTAAAGACACGGAAGAAAGTTGG - Intergenic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
956992366 3:74781889-74781911 TTGAAGACTCAGAAGCTGGGAGG + Intergenic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960726623 3:120676801-120676823 CTTAAGAGATATAAGAAGGGTGG + Intronic
961511927 3:127408615-127408637 CTGAGGACACAGGGGAAGAGAGG + Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
965892051 3:173526771-173526793 ATGAAGACAGAGTAGAAGGATGG - Intronic
966499305 3:180620921-180620943 CGGAAGACTCAGAAGCATGGTGG - Intronic
966678534 3:182615911-182615933 CTGGAGACAGAGAAGAAGTAAGG + Intergenic
966839758 3:184078870-184078892 CACAAGTCACAAAAGAAGGGTGG - Intergenic
966863829 3:184245333-184245355 ATGAAGAAAAAGACGAAGGGAGG + Exonic
966904495 3:184512313-184512335 CTGAAGCCACAGGAGAGAGGAGG + Intronic
966929149 3:184664495-184664517 CAGAAGTGACAGAAGAAGGCTGG + Intronic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
967841973 3:194012895-194012917 ATGAAGACAATGAAGAAGGGAGG - Intergenic
968705800 4:2076855-2076877 ATGAAGAAAGAGAGGAAGGGCGG - Intronic
969354533 4:6617622-6617644 CAGAAGACCATGAAGAAGGGCGG - Intronic
969521097 4:7678156-7678178 CTGGAGACACAGCACAGGGGCGG + Intronic
969521170 4:7678521-7678543 CTGGAGACACAGCACAGGGGCGG + Intronic
970338572 4:15080591-15080613 CTGAAGACAGAGAAGACCTGGGG - Intergenic
970417108 4:15869945-15869967 TGTAAGACACAGAAAAAGGGTGG - Intergenic
971923621 4:32976931-32976953 AGGAAGAGACAGGAGAAGGGGGG - Intergenic
973589345 4:52424996-52425018 CTTAAAACCCAGATGAAGGGTGG - Intergenic
973646669 4:52957038-52957060 CTGAAGGCACACAAGAGAGGAGG + Intronic
975533435 4:75424331-75424353 CTTAAGAAACAGAGGAAGGCAGG - Intergenic
975664883 4:76725842-76725864 CTGAAGACACAGGACACAGGAGG - Intronic
975762980 4:77636054-77636076 CTGCAGCCACTGATGAAGGGAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
976920863 4:90441418-90441440 ATGAAGACACAGCAAAAAGGTGG - Intronic
977651194 4:99471509-99471531 CTCAAGGCACAAAAGAAAGGGGG - Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978690862 4:111507607-111507629 CTGATGACCCAGAAGTAGGAGGG + Intergenic
978890483 4:113820659-113820681 CTGCAGAGACAGAAGAATGAAGG + Intergenic
979280162 4:118858546-118858568 CTAAAGACACAGAACAACAGGGG + Intronic
979450902 4:120870123-120870145 CGGAGGAGACAGAGGAAGGGAGG + Intronic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
980475585 4:133310235-133310257 TTAAAGAGAAAGAAGAAGGGTGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981888496 4:149708097-149708119 GTGAAGATAAAGAAGAAAGGTGG - Intergenic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
983883105 4:172954942-172954964 ATGAAGACATAGAGGATGGGAGG + Intronic
984154071 4:176172806-176172828 ATGAAGAGAGAGAGGAAGGGAGG + Intronic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
985324070 4:188747761-188747783 CTGGACACACAAAAGATGGGAGG - Intergenic
986013883 5:3740757-3740779 CTGAGGACACAGAAGAGGTTGGG - Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986418611 5:7553660-7553682 CTGAGGGGACAGAAGCAGGGAGG + Intronic
986936626 5:12896142-12896164 ATAAAGACACAGAAGAAAGAAGG + Intergenic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987508376 5:18801530-18801552 AGGAAGACTCAGAAGAGGGGAGG - Intergenic
987867004 5:23555130-23555152 CTGAAGAGACTGAAGAAAAGTGG - Intergenic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
989228493 5:39058973-39058995 CTGAAGACACAGAAGAGAAATGG + Intronic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
990987009 5:61649890-61649912 CAGATGACACAGAAGGAGAGGGG - Intronic
992184000 5:74225932-74225954 AAGAAGGCACAGAGGAAGGGAGG - Intergenic
992261209 5:74972093-74972115 ATGAAGACACAGCAGCAGGGTGG + Intergenic
992438246 5:76775751-76775773 ATGAGGACAGAGAAGAGGGGTGG - Intergenic
992492626 5:77259708-77259730 TTAAAGACACTGAAGATGGGAGG + Intronic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
993726381 5:91372077-91372099 CTGAAGATAAAGAAGGTGGGAGG - Intronic
994374094 5:98998359-98998381 CAGAAGATACAAAAGAAGAGTGG - Intergenic
995771131 5:115671652-115671674 ATGAAGACAGAGTAGAAGGATGG + Intergenic
995865090 5:116681840-116681862 CTGAAAACACCGAAGAAACGAGG - Intergenic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997109563 5:131059917-131059939 TTGAGGACACAGAAAAAGGATGG - Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997307525 5:132850108-132850130 ATGAGGACAAAGAATAAGGGAGG + Intergenic
997636730 5:135414476-135414498 TCGAAGACTCAGAAGCAGGGAGG + Intergenic
997735284 5:136208552-136208574 CAGAAGCCAGAGAGGAAGGGTGG - Intergenic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
998394138 5:141807187-141807209 CTTAAGACAGAGAAGGATGGAGG + Intergenic
999410098 5:151343050-151343072 CAGGAGACACAGAACAAGGCAGG + Intronic
999523102 5:152372903-152372925 CTGAACAAATAGAAGCAGGGGGG + Intergenic
999639523 5:153658220-153658242 AAGAATACACAGAACAAGGGTGG + Intronic
999907156 5:156154191-156154213 TGGAAGACAGAGAACAAGGGAGG - Intronic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000386077 5:160675849-160675871 CTGAGGCCAGAGAAGCAGGGGGG + Intronic
1000799029 5:165701257-165701279 GTGAAGACATAGAAGGAAGGTGG + Intergenic
1001168953 5:169398844-169398866 CTGAAGACCCAGAAGAAATAGGG + Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002255745 5:177957490-177957512 CTGAGGACACAGGACAAGGCAGG + Intergenic
1002556362 5:180044925-180044947 CTTAAGAGACTGAAGGAGGGAGG + Intronic
1002893002 6:1353002-1353024 CTAAAAACAAAGCAGAAGGGAGG + Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1003418877 6:5938206-5938228 CTGAAGACACCTGAGAAGGAAGG + Intergenic
1003775898 6:9363593-9363615 GTGATGACACAGCAGAGGGGAGG - Intergenic
1003819269 6:9877787-9877809 CTGGAAACAAAGAACAAGGGTGG + Intronic
1004240430 6:13916388-13916410 CTGAGGCAACAGAGGAAGGGAGG - Intergenic
1004497970 6:16182254-16182276 CTCAACCCACCGAAGAAGGGAGG + Intergenic
1004751965 6:18571305-18571327 CTGAAAACCCGGGAGAAGGGAGG - Intergenic
1006186192 6:32182900-32182922 CTGAAGCTACAGGAGAAGGTGGG + Exonic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006800946 6:36759387-36759409 CTGACCACCAAGAAGAAGGGAGG - Intronic
1007412665 6:41673950-41673972 CTGCAGAGCCAGGAGAAGGGAGG + Intergenic
1007500561 6:42293748-42293770 CTGAATACACAGCAACAGGGTGG - Intronic
1007630580 6:43270951-43270973 GTGAAGACACAGCAGAAGAGAGG + Intronic
1007972288 6:46064726-46064748 ATGAAGGAAGAGAAGAAGGGAGG + Intronic
1008043969 6:46833051-46833073 CTGAGGACAGAGAACAAGGCTGG - Intronic
1008118012 6:47575599-47575621 CAGAAGACACAGTAGTAGGTAGG + Intronic
1008306364 6:49906094-49906116 AGGAAGTCACTGAAGAAGGGTGG + Intergenic
1008417327 6:51257293-51257315 CTGAAGAAATAGATAAAGGGAGG + Intergenic
1009849538 6:69178252-69178274 CTGAACACAAAGAAGAAGCAGGG - Intronic
1010017352 6:71120971-71120993 CTTAAGAGAGAGAAGAAGGCCGG - Intergenic
1010472780 6:76249555-76249577 CAGGAGACACAGAAGACGGGTGG + Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011406859 6:87024719-87024741 CTGCAGGCAGAGAATAAGGGTGG - Intergenic
1011585884 6:88924649-88924671 CAAAAGACACAACAGAAGGGAGG - Intronic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012655697 6:101816920-101816942 GTCAAGACACAGTAGAAAGGAGG - Intronic
1013318204 6:108961215-108961237 CTGAAGACCCAGAAAACAGGCGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013505260 6:110793843-110793865 CTGAACAGACAGAGGAAAGGAGG + Intronic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1015011616 6:128356180-128356202 CTAAAGAAACAGGAGAAGAGGGG - Intronic
1016087751 6:139935791-139935813 CTGAAGGCACTGAAGGAAGGAGG - Intergenic
1016097824 6:140059853-140059875 GAGAAGACACAGAAGAGGAGGGG + Intergenic
1016269344 6:142270508-142270530 GTAAAGACAGGGAAGAAGGGTGG + Intergenic
1016381242 6:143483538-143483560 CTGAATACATAGAACAAGAGTGG + Intronic
1017492987 6:154960269-154960291 CAGAGGTCTCAGAAGAAGGGAGG - Intronic
1017493924 6:154966923-154966945 CTGAAGTCCCAGACGATGGGCGG + Intronic
1018272484 6:162095089-162095111 CTGAAGACCCAGTAGAAAGATGG - Intronic
1018581220 6:165309716-165309738 CAGAAGGCACAGAAGAGGGGAGG - Intergenic
1018795746 6:167184376-167184398 CTGAACACCCAGAGGAAAGGGGG - Intronic
1018820569 6:167370688-167370710 CTGAACACCCAGAGGAAAGGGGG + Intronic
1019073499 6:169368580-169368602 GCGAAGACACAGCAGGAGGGCGG + Intergenic
1019785205 7:2972408-2972430 CAGAAGAAAAAGAAGTAGGGTGG + Intronic
1020218930 7:6219034-6219056 CTGAGGACTCAGGAGAAGTGAGG + Intronic
1020594193 7:10183646-10183668 CTTTACCCACAGAAGAAGGGAGG + Intergenic
1020851926 7:13364380-13364402 ATAAAGACACAGAGGGAGGGGGG - Intergenic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1022046276 7:26624907-26624929 CTGAACGCACAGACGCAGGGAGG + Intergenic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1022483611 7:30760379-30760401 ATAAAGACACAGTAGAATGGCGG - Intronic
1022720626 7:32939116-32939138 CTGAAGACCCCAAAAAAGGGTGG - Intergenic
1022756079 7:33292009-33292031 ATGAAGAAACTGAATAAGGGTGG - Intronic
1022905153 7:34848617-34848639 CTGAAGACACAGTAGATGAGGGG - Exonic
1023212837 7:37826745-37826767 TTGAAGAAATAGAAGATGGGAGG - Intronic
1024481097 7:49864254-49864276 AAGAAGACAAAGAAGGAGGGAGG + Intronic
1024962624 7:54993727-54993749 CTGGAGAGACAGAAGAATGTGGG - Intergenic
1025288500 7:57689189-57689211 CCGAAGAGACAGAAGAAGGCAGG - Intergenic
1026384824 7:69836023-69836045 CTGAAGAAACAGATAAATGGTGG - Intronic
1026629078 7:72021956-72021978 CTGAAGAAACAGAAGAGGTGAGG - Intronic
1027053368 7:75033305-75033327 GGGAAGACAGAGAAGCAGGGAGG + Intronic
1027121942 7:75528094-75528116 CTGAAGACTCACAGGAAGCGAGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028199518 7:87944774-87944796 CCTAAGACACAGATCAAGGGTGG - Intronic
1028215374 7:88125802-88125824 CTGAAGAAGCAGTAGAAAGGGGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029839459 7:103346647-103346669 CTAAAGACAAAGTAGAAGGATGG - Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030963242 7:115953523-115953545 CTGCAGACACAGAAGAGAGAAGG + Intronic
1033225697 7:139560511-139560533 ATGGAGACAGAGTAGAAGGGTGG + Intergenic
1033776829 7:144620656-144620678 CAGAAGACTCAGAAGAGGAGAGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034199216 7:149271850-149271872 CTGAATCCACAGAAGAACTGAGG - Intronic
1035627685 8:1084567-1084589 CTGAAAGCACAGAAGCAGTGAGG - Intergenic
1036112173 8:5915207-5915229 CTGACCACACTCAAGAAGGGAGG + Intergenic
1036118605 8:5989028-5989050 CTGAAGAAACCCAAGAAAGGAGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037552265 8:19986017-19986039 GTGAAGAAACAGAAGAAAGTTGG + Intergenic
1037750658 8:21680045-21680067 TTAAAGACAGAGGAGAAGGGAGG - Intergenic
1037926655 8:22848738-22848760 CTGAAAACACAGCAGAAGAAAGG - Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1039800409 8:40949802-40949824 GTGAAGACACAGAAAGAAGGTGG + Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040441415 8:47447023-47447045 CTGAAGTCACTGAAGAGGGTTGG - Intronic
1040674193 8:49728870-49728892 GTCAGGACACAGAAGATGGGAGG + Intergenic
1041377007 8:57215537-57215559 CTGATGGCACAGCAGCAGGGAGG + Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1043519954 8:81034380-81034402 CTGAAGACAGAGAAGAGAGTAGG + Intronic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044852012 8:96437798-96437820 AGGAAGAGACAGCAGAAGGGAGG + Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045345802 8:101292425-101292447 CTCAAGTCACTGAAGAATGGTGG - Intergenic
1045544242 8:103113889-103113911 CAGCAAACACAGTAGAAGGGAGG + Intergenic
1045578630 8:103453680-103453702 CTGCAGACAGAGAAGAGGGCTGG - Intergenic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1047158367 8:122348072-122348094 CAGAAGAGAAAGAAGAAAGGAGG + Intergenic
1047313202 8:123709442-123709464 AGGAAGACAGAGAAGGAGGGAGG - Intronic
1048473423 8:134722957-134722979 CAGAAGACACAGAGAAAAGGTGG + Intergenic
1049037249 8:140086321-140086343 AAGAAGAGACAGAAGAAGCGGGG + Intronic
1049230889 8:141480573-141480595 CTGGGGACTCAAAAGAAGGGAGG - Intergenic
1049366887 8:142243550-142243572 CTGAACTCACAGAAGCAGAGAGG + Intronic
1049368366 8:142251774-142251796 CTGAAGACAGAGAACGTGGGCGG - Intronic
1049368390 8:142251862-142251884 CTGAAGACAGAGAATGCGGGCGG - Intronic
1049368413 8:142251950-142251972 CTGAAGACAGAGAACATGGGCGG - Intronic
1049958023 9:711351-711373 CAGAACCCACAAAAGAAGGGAGG - Exonic
1050084147 9:1947014-1947036 CTGATGACAGTGAAGAAAGGAGG - Intergenic
1050331574 9:4551090-4551112 CTGAAGAGACTGAAGAATAGAGG + Intronic
1050745109 9:8867172-8867194 AGGAAGAAAGAGAAGAAGGGAGG - Intronic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051853119 9:21531978-21532000 ATGAAGACACTTAAGAGGGGTGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1053371805 9:37567850-37567872 CTGAGGACGCAGAAGAGGGAAGG - Intronic
1053653630 9:40193920-40193942 CTGAGGACAGAGAACAAGGCTGG + Intergenic
1053904029 9:42823211-42823233 CTGAGGACAGAGAACAAGGCTGG + Intergenic
1054530956 9:66182303-66182325 CTGAGGACAGAGAACAAGGCTGG - Intergenic
1057336516 9:94159897-94159919 CTGAGCACACAGAAAATGGGAGG + Intergenic
1057756770 9:97845436-97845458 AGGAAGACACAGAGGAAGGCAGG - Intergenic
1057865808 9:98679796-98679818 CTGAAGACACAGGAGCACAGAGG + Intronic
1058483161 9:105417399-105417421 CTGAAGACCAAGCAGGAGGGAGG - Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059975797 9:119715705-119715727 TTGAAGTCACAGAAGTAGAGAGG + Intergenic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1061012547 9:127964044-127964066 GGGAAGACCCAGAAGGAGGGAGG + Intronic
1061302028 9:129710892-129710914 GTGAAGACAGAAAAGAAGGAAGG - Intronic
1061423613 9:130485532-130485554 CTGAGGACAGAAAAGCAGGGAGG + Intronic
1061434375 9:130551799-130551821 CTCAAGACTCACGAGAAGGGTGG + Intergenic
1061853807 9:133430466-133430488 CTGAACCCACAGCAGAAGTGGGG + Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062020172 9:134315680-134315702 CTGAGTCCCCAGAAGAAGGGAGG - Intergenic
1062387618 9:136319253-136319275 CTGAAGCCACACATGAAGTGGGG + Intergenic
1203612041 Un_KI270749v1:17814-17836 CCCAAGACACAGAAAAAGGCAGG + Intergenic
1185764270 X:2712175-2712197 CTGAACTCACAGAAGCAGAGTGG + Intronic
1185999230 X:4989375-4989397 AGGAAGAGACAGAAGGAGGGAGG - Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186217234 X:7313095-7313117 CTGTAGGCAGAGAAAAAGGGAGG - Intronic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187315999 X:18195887-18195909 CGAAAGAGACAGAGGAAGGGAGG + Intronic
1187383073 X:18822944-18822966 CTGAAGAAAAAGAACAAGGTGGG + Intronic
1187452671 X:19412585-19412607 CTGAAGAGAAAGAGGAAGGGAGG + Intronic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187789287 X:22931775-22931797 CTGAAGACATAGAGAAAGAGTGG - Intergenic
1187991227 X:24875170-24875192 CAGAAGCCACAAAAGAAGGGGGG + Intronic
1189116518 X:38348783-38348805 CTGAACACAGAGATGAAGAGAGG - Intronic
1189575801 X:42351932-42351954 ATGAAGACACAGAAGAGTGAGGG - Intergenic
1190765576 X:53473172-53473194 CTGAAGAAAATGAAGCAGGGAGG + Intergenic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191914715 X:66189047-66189069 CTAAAGGCACAGAAGAACCGAGG + Intronic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192699900 X:73457811-73457833 CTGGTGACAAAAAAGAAGGGAGG + Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194922135 X:99779602-99779624 CTGAAGCCACCCAAGAAGGTGGG - Intergenic
1195430343 X:104782170-104782192 ATGAAGACACAGAACTTGGGAGG + Intronic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1195712925 X:107789306-107789328 TTGAAGACACAGATGAGAGGAGG - Intronic
1195824030 X:108977796-108977818 CTGAAGATAGAGTAGAAGGATGG + Intergenic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1196327386 X:114423165-114423187 TTGAAGAAACAGTAGAACGGTGG - Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1197446359 X:126555009-126555031 CTGAGGACGCAGAAAAAGTGGGG - Intergenic
1197823573 X:130565558-130565580 ATGAAGATAGAGAAGCAGGGAGG + Intergenic
1198178047 X:134174368-134174390 TTGGAGAGACAGAAGAAGGTTGG + Intergenic
1198224450 X:134632456-134632478 ATGGTGACAGAGAAGAAGGGAGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200224356 X:154409076-154409098 CTGGGGAGACGGAAGAAGGGAGG - Intronic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic