ID: 1085681037

View in Genome Browser
Species Human (GRCh38)
Location 11:78575033-78575055
Sequence GGTGAGGCTGAGAAACTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 404}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085681037 Original CRISPR GGTGAGGCTGAGAAACTGAG AGG Intergenic
900459890 1:2798029-2798051 TGGGAGGCTGAGAGACTGGGAGG - Intronic
900489260 1:2938763-2938785 GGTGAGGCTGAGGGTCTGTGGGG - Intergenic
900489594 1:2940567-2940589 GGTGAGGCTGAGGGTCTGTGGGG - Intergenic
900570946 1:3357907-3357929 GGTGAGGCAGAGAAACCCTGTGG + Intronic
901447077 1:9315126-9315148 GGCAAGGCTGAGAAGCTCAGCGG + Intronic
901839979 1:11948083-11948105 GGTGAGGCAGAGACAGTGAGGGG + Intronic
902250169 1:15149317-15149339 GGTTACCCTTAGAAACTGAGGGG - Intergenic
903026084 1:20430712-20430734 GGTGGAGCTGAGAAAGGGAGGGG + Intergenic
903034629 1:20485918-20485940 GGTGGGGGAGAGAAACCGAGAGG + Exonic
903173814 1:21569134-21569156 GGTGGGGGTGTGGAACTGAGTGG + Intronic
904318745 1:29682811-29682833 GCCGAGGCTGAGGGACTGAGTGG - Intergenic
904630766 1:31840500-31840522 GGTGAGTCAGAGTAACTGAGAGG + Intergenic
906188593 1:43880958-43880980 GGTGAGGCAGCCAAACAGAGAGG - Intronic
906678161 1:47708319-47708341 AGAGAGGCAGAGAAAATGAGAGG + Intergenic
907447634 1:54519173-54519195 GGTGAGTCTGAGGAAATCAGTGG + Intergenic
907773023 1:57484953-57484975 ACTGAGGCAGAGAGACTGAGTGG + Intronic
908278730 1:62506142-62506164 GATAAGGCTGAAAAATTGAGTGG + Intronic
909554293 1:76935973-76935995 GATGAAGCTGAGATTCTGAGTGG + Intronic
910617547 1:89216194-89216216 GGTGAGGGGAAGAAACTTAGAGG - Intergenic
910770970 1:90832292-90832314 CATGAAGCTTAGAAACTGAGAGG - Intergenic
911099635 1:94084854-94084876 GGTGGGGCTGAGAAGAAGAGTGG + Intronic
912549694 1:110477217-110477239 CTTGAGGCAGAGATACTGAGAGG + Intergenic
912580875 1:110719826-110719848 GGTGTTGGTGAGGAACTGAGAGG + Intergenic
912997828 1:114549333-114549355 GCTGAGGCTGTGGAATTGAGAGG - Intergenic
913079080 1:115365033-115365055 GGTGAAGCTGCTAAGCTGAGAGG - Intergenic
914910735 1:151784001-151784023 AGGGAGGCTGAGAAACTATGTGG - Intronic
915300829 1:154950742-154950764 GGAGAGGCTGGGACAGTGAGAGG - Intronic
915516752 1:156417776-156417798 TATGAGGGTGAGAAACTGAGTGG - Intronic
915973487 1:160370383-160370405 GGAGAGGCCGAGAGACAGAGAGG - Intronic
916832818 1:168510441-168510463 GCTGAGGCTGAGGAAATGGGAGG + Intergenic
916910454 1:169340696-169340718 GATGAAGATGAGAAACTTAGTGG + Intronic
917062938 1:171059889-171059911 GGTGAGGGGAAGAAACTTAGAGG + Intronic
917143538 1:171862947-171862969 GGAGTGGTTGAGAAAATGAGAGG + Intronic
918092037 1:181305437-181305459 AGTGAGGCTCAGAACCTAAGAGG - Intergenic
918406373 1:184215186-184215208 GCTGGGGGTGAGGAACTGAGGGG - Intergenic
918458695 1:184754433-184754455 GGTGAGGCTGACAACAGGAGGGG - Intronic
919283061 1:195517566-195517588 GGAGAGGCTGAGACACAGAGAGG + Intergenic
921696439 1:218215677-218215699 AGTTAGGCAGAGAAAGTGAGTGG - Intergenic
922070188 1:222184492-222184514 GGTGAGGCTGGAGAACTGAATGG - Intergenic
922141369 1:222891197-222891219 GCTGAAGCATAGAAACTGAGAGG + Intronic
922831553 1:228556966-228556988 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922832031 1:228608948-228608970 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922832592 1:228611189-228611211 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922833152 1:228613430-228613452 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922833713 1:228615671-228615693 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922834272 1:228617912-228617934 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922834832 1:228620143-228620165 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922835381 1:228622346-228622368 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922835940 1:228624588-228624610 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922836499 1:228626828-228626850 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922837057 1:228629069-228629091 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922837616 1:228631311-228631333 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922838175 1:228633552-228633574 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922838734 1:228635777-228635799 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922839292 1:228638017-228638039 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922839853 1:228640248-228640270 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922840414 1:228642489-228642511 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922840976 1:228644720-228644742 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922961622 1:229651729-229651751 GGTGAGGCTGGAACAGTGAGCGG - Intronic
1063063115 10:2578466-2578488 GGCGAGTCAGCGAAACTGAGAGG - Intergenic
1065914086 10:30337830-30337852 TGTTATTCTGAGAAACTGAGAGG - Intronic
1066437757 10:35409554-35409576 TGAGAGGCTGAGGAACAGAGAGG + Intronic
1066478688 10:35773780-35773802 GGTGAGCATGAGGAACTGAAAGG + Intergenic
1066648306 10:37633278-37633300 GGTGAGTCTGGGTGACTGAGAGG + Intergenic
1067297256 10:44982036-44982058 GGTGAGGCTGAGACACAGCTAGG + Intronic
1067369794 10:45672657-45672679 GGTGAGGCTGAGCTAGCGAGCGG - Intronic
1068524967 10:58117880-58117902 GTTGAGGCTAAGAAGCTTAGGGG + Intergenic
1069816353 10:71197065-71197087 GGTGAGGTGGTGAAACTCAGAGG - Intergenic
1070575482 10:77674089-77674111 GGTGAGGCTCAGGAAGTGTGGGG + Intergenic
1070846298 10:79524869-79524891 GGTGATGATGAGACATTGAGAGG - Intergenic
1070927499 10:80235437-80235459 GGTGATGATGAGACATTGAGAGG + Intergenic
1070996073 10:80783987-80784009 GGTGATGATGAGGAACTGAGAGG - Intergenic
1071683975 10:87735636-87735658 GCTGAGGCTGAGAAACCCTGCGG - Intronic
1072426822 10:95337052-95337074 GGGGAGGCTGAGAGACAGGGAGG + Exonic
1074635812 10:115316089-115316111 GGTGAGGGGAAGAAACTCAGAGG - Intronic
1075078619 10:119368211-119368233 GGAGAGACTGAGGCACTGAGCGG + Intronic
1075317839 10:121466572-121466594 TGTTAGGCAGAGAAACTGGGGGG - Intergenic
1075370090 10:121928192-121928214 GGTGAGGCGGAGAGACAGAGCGG + Intronic
1075548774 10:123376756-123376778 GGTGAGGCTGGGATGCTCAGGGG + Intergenic
1075717749 10:124566761-124566783 GAGGAGGCTGAGAGTCTGAGGGG + Intronic
1075723330 10:124599570-124599592 AGCCAGGCTGAGGAACTGAGAGG - Intronic
1075801215 10:125154724-125154746 GGTGAGGGTTAGAAAGTGAGGGG + Intronic
1075902496 10:126054430-126054452 GGTGTGGCTGAGAGAGTGACAGG + Intronic
1076161478 10:128247350-128247372 GGGGAGGATGAGACCCTGAGGGG + Intergenic
1076366521 10:129924517-129924539 GGTGTGGATGAGAAACAGTGCGG + Intronic
1076776262 10:132699759-132699781 GGCGGGGCTGAGAGACGGAGGGG - Intronic
1077219445 11:1409161-1409183 GGCGGGGCAGAGAAACAGAGAGG - Intronic
1077903828 11:6513141-6513163 GGTGGGATTGAGGAACTGAGAGG - Intronic
1078184807 11:9042505-9042527 ATTGAGTCAGAGAAACTGAGAGG - Intronic
1078585349 11:12581883-12581905 GGTGAGGCTGAGAGACTATGAGG - Intergenic
1079025687 11:16946071-16946093 GGAGAGGTTGGGAAAGTGAGTGG - Intronic
1079111451 11:17607474-17607496 GATGATGCTGAGAAAGTGAAAGG - Intronic
1079990183 11:27238226-27238248 AGTGGGGCTGAGAGAATGAGGGG - Intergenic
1080546142 11:33320722-33320744 TGTGGGCCTGAGAAACTGAAAGG + Intronic
1080943233 11:36942807-36942829 GGTGTGTCTGAGGAACTGAAAGG + Intergenic
1082833699 11:57637917-57637939 GGTGAGGCTGAAAGGCTGAGTGG + Intergenic
1082977344 11:59086425-59086447 GTTGAGGATGAGAAACTAACAGG + Intergenic
1083608338 11:63992436-63992458 GTTGGGGCTGGGGAACTGAGCGG + Intronic
1084433694 11:69125891-69125913 GGTGAGACTCATAAACTGTGGGG - Intergenic
1084451607 11:69242385-69242407 GGTGAGGCTGGGAACTGGAGTGG - Intergenic
1084784351 11:71433593-71433615 GAGGAAGCTGAGACACTGAGAGG + Intronic
1085681037 11:78575033-78575055 GGTGAGGCTGAGAAACTGAGAGG + Intergenic
1086905073 11:92408759-92408781 GGTGATGTTGAGAAAATGAGAGG + Intronic
1087969307 11:104459625-104459647 GATGGTGCTAAGAAACTGAGGGG + Intergenic
1088329203 11:108632906-108632928 AGAGAGGCTGAGAAGCTGGGCGG - Intergenic
1089139443 11:116274339-116274361 GGTGGGTCTGGGAAAGTGAGGGG - Intergenic
1089191699 11:116658615-116658637 TGTGAGGTTGCGCAACTGAGAGG - Intergenic
1091613130 12:2028616-2028638 GGAGAGGCTGTGACACAGAGAGG + Intronic
1091923193 12:4321729-4321751 GGGGAACCTCAGAAACTGAGAGG - Intronic
1092095392 12:5838121-5838143 GGTGAGGCTCAGGAACTGCCTGG - Intronic
1092566708 12:9673683-9673705 GCTGAGTCAGAGAACCTGAGGGG - Intronic
1092959682 12:13584172-13584194 GGTGAGTTTTAGAAACTGCGAGG - Intronic
1094243828 12:28262931-28262953 GGTTAGGCTATGAAACAGAGAGG - Intronic
1095328958 12:40933821-40933843 TGTGAGGCTGAGAACATTAGAGG + Exonic
1095643102 12:44507810-44507832 GGTGAGGCAGTGAGACAGAGAGG + Intergenic
1096594871 12:52688568-52688590 GCTGAGGCCCACAAACTGAGTGG - Intergenic
1096694782 12:53341613-53341635 AGTGAGGCTGAGCAACTCAAGGG + Intronic
1097234109 12:57528228-57528250 GGTGGGGCTAAGGCACTGAGGGG - Exonic
1098123370 12:67266061-67266083 GGTGATGTTGAGAAAGTGAATGG + Intergenic
1098910940 12:76207756-76207778 GGTGGAGATGAGAAACGGAGTGG - Intergenic
1099296601 12:80836170-80836192 GATGAGGCTGAAGAACTGATTGG - Intronic
1100901824 12:99250070-99250092 GAGGAGGCTGACAAAGTGAGGGG + Intronic
1101605341 12:106244297-106244319 TGAGAGGCTAAGTAACTGAGCGG - Intronic
1101737168 12:107471763-107471785 GGTGAGGCTCAGGGGCTGAGTGG + Intronic
1102762187 12:115397699-115397721 AGTCAGGCAGAGATACTGAGGGG - Intergenic
1103167845 12:118785524-118785546 AGTAAGGATGAGAGACTGAGAGG + Intergenic
1103198680 12:119068798-119068820 GGTGAGGCTTAGAAACAGAGAGG + Intronic
1103249163 12:119485290-119485312 GGTGAGCTTGAGTGACTGAGTGG + Intronic
1103364455 12:120371071-120371093 GGGGATGCTGAGAAACTGTGGGG - Intergenic
1106628292 13:31443169-31443191 AGGCAGGCTGAGGAACTGAGGGG - Intergenic
1107478206 13:40761770-40761792 GATGAGGGAAAGAAACTGAGTGG + Intronic
1110546983 13:76766655-76766677 GGTGAGGCCTAGTAACTGTGAGG + Intergenic
1110988613 13:82007988-82008010 TGGGAGGCTGTGAGACTGAGGGG - Intergenic
1111075681 13:83231683-83231705 GTTATGGCTGAGAAACTCAGTGG - Intergenic
1111606731 13:90548112-90548134 GGTGAAGATGAGAAACTGGTTGG - Intergenic
1112446491 13:99469299-99469321 GGTGATGCTGAGAAAACCAGCGG - Intergenic
1114440511 14:22742832-22742854 GATGGGACTGAGAAGCTGAGAGG + Intergenic
1117408184 14:55425563-55425585 GCTGAGGCAGAGAAAGAGAGTGG + Intronic
1117836030 14:59807080-59807102 GGAGAGGCTGAGAGAGTGAAAGG + Intronic
1118598627 14:67455278-67455300 GGTGGGGATGAGAAACTGAGGGG - Intronic
1119168250 14:72513620-72513642 GATGAGGCCAAGAAACTGAGCGG - Intronic
1120028082 14:79608514-79608536 GGTGACACAGTGAAACTGAGGGG - Intronic
1120224840 14:81779013-81779035 GGTGGATTTGAGAAACTGAGAGG - Intergenic
1120753871 14:88223583-88223605 AGGGAGTCTGAGAATCTGAGAGG - Intronic
1120828439 14:88976054-88976076 GGTGAGGCTGAAGAAATCAGGGG + Intergenic
1122102105 14:99420859-99420881 GGTGAGGCTGGGAACCTGCCAGG + Intronic
1123713384 15:23007892-23007914 AGTGAGGCTGAGAGACACAGAGG + Intronic
1124818042 15:33016738-33016760 GGTGAGGCTTAAAAACTGTCAGG - Intronic
1125682017 15:41536907-41536929 TGTGAGGCTGAGAAGTAGAGAGG - Intronic
1126266537 15:46761277-46761299 GGTGGGCCTGAGAGAATGAGAGG + Intergenic
1126382311 15:48061640-48061662 GGTGAGGCTGAAAATCTGTCAGG - Intergenic
1127233380 15:57020836-57020858 GGTGTGCATAAGAAACTGAGGGG + Intronic
1127265159 15:57355149-57355171 GGTGAGGCAGGGAAACCAAGGGG - Intergenic
1127406269 15:58650572-58650594 GAGGTGGCTGAGAGACTGAGAGG - Intronic
1127576657 15:60298396-60298418 GGAGAGGATGAGGAACTAAGTGG + Intergenic
1127898520 15:63323643-63323665 GCTGAGGCACAGGAACTGAGGGG + Exonic
1128517889 15:68354718-68354740 GGTGAGGATGAGAGAGGGAGGGG - Intronic
1128758443 15:70198672-70198694 GGTGAGGCTGTGCAGCTGAGAGG + Intergenic
1129887449 15:79048458-79048480 GGGGAAGCTGAGACACAGAGAGG - Intronic
1130342413 15:83011035-83011057 GCTGAGTCTGAGAAACGGACTGG + Intronic
1132234168 15:100206642-100206664 GGTGAGGCTGAGAAGAAGTGTGG + Intronic
1132679917 16:1135461-1135483 GGTGAGGCTGGGCCACAGAGGGG + Intergenic
1132729690 16:1355360-1355382 AATCAGGCTGAGAAACTCAGGGG + Intronic
1133108174 16:3527801-3527823 GCTGAGGCAGAGAGACAGAGAGG - Intronic
1135205592 16:20481077-20481099 GGGGAAACTGAGAAACAGAGAGG - Intronic
1135516901 16:23143693-23143715 GCTGAGGCTGAGAAACTGTTTGG - Intronic
1136173116 16:28499950-28499972 GGCCAGGCCGAGAACCTGAGAGG + Intronic
1136480098 16:30535781-30535803 GGTAAGGCTGAGAAAGTCAGAGG + Intronic
1136483959 16:30559233-30559255 GGTAAGGTTGAGAAAGTCAGAGG + Intergenic
1137619339 16:49866418-49866440 GGGGAGACTGAGGCACTGAGAGG - Intergenic
1137869669 16:51937872-51937894 GGTGATGGTGAGAAAGTCAGTGG + Intergenic
1138142456 16:54580535-54580557 GGAGAGGCTGAGGCACAGAGAGG + Intergenic
1138391478 16:56673366-56673388 GATGAGACTGAGACACAGAGAGG - Intronic
1139367175 16:66440647-66440669 GGTGAGGCTGAGAAGGTCTGGGG - Intronic
1139440873 16:66966193-66966215 GGTGGGGCTGAGTGGCTGAGAGG + Intronic
1140379353 16:74472269-74472291 GGTGAGTCTGAGATACTCAGGGG + Intronic
1141521682 16:84584327-84584349 TCAGAGCCTGAGAAACTGAGAGG - Intronic
1143046623 17:4086090-4086112 GATGAGGCTGATAGATTGAGGGG - Intronic
1143611344 17:8019621-8019643 GGAGAGGCTGAGGCACAGAGAGG - Intronic
1143734296 17:8899628-8899650 GGAGAGGCTGAATAACTTAGTGG - Intronic
1144281157 17:13728061-13728083 CTTGAGGGTGAGTAACTGAGGGG - Intergenic
1144606196 17:16667222-16667244 GGGGCGGCTGAGAGGCTGAGGGG + Intergenic
1144624327 17:16837075-16837097 AGTGGGGCAGAGAAGCTGAGGGG + Intergenic
1146729666 17:35182847-35182869 GGTGAGGATGAGATGCTGTGAGG + Intronic
1147760619 17:42795446-42795468 GGTGAGGCCTAGAAAGTGGGGGG - Exonic
1147888001 17:43697540-43697562 GGGGAGGCCCAGAGACTGAGAGG - Intergenic
1148337837 17:46852989-46853011 AGTGAGGCCCAGAGACTGAGTGG - Intronic
1148758091 17:49985142-49985164 GGAGGGGCTGTGAAGCTGAGGGG - Intergenic
1149242032 17:54662328-54662350 GATGAAGCTGAGAAACACAGAGG - Intergenic
1149701958 17:58662651-58662673 GGTGAGACTCACAAACTGAGGGG - Intronic
1150634854 17:66905723-66905745 GGTGGGCTTGAGAAACTAAGAGG + Intergenic
1151716404 17:75833206-75833228 GGACAGGCTGAGCAACGGAGAGG - Intronic
1151815328 17:76468847-76468869 GGTGAGGCAGCGAAACTCACTGG - Exonic
1151973871 17:77473199-77473221 GATGAGTCTGAGAAACAAAGAGG - Intronic
1152386758 17:79979412-79979434 GGTGAAGCTGCGACACTGTGTGG + Intronic
1152551733 17:81033788-81033810 TGGGAGGCTGGGAGACTGAGAGG + Intergenic
1153479221 18:5530465-5530487 GGTGAGGCAGAGCCAGTGAGGGG - Intronic
1155257084 18:24008157-24008179 GGTGAGGGTGAGCTACAGAGGGG - Intronic
1157158008 18:45286603-45286625 TAAGAAGCTGAGAAACTGAGGGG + Intronic
1157291103 18:46410452-46410474 CGTTAGGCTGTGAGACTGAGGGG + Intronic
1157591561 18:48839196-48839218 GGTGAGACTGAGAACAGGAGGGG - Intronic
1159771463 18:72550260-72550282 GGAGAGGATGAGATCCTGAGGGG - Intronic
1159914271 18:74174488-74174510 GGTCAGGCTGCGAAAGTGAATGG + Intergenic
1160423341 18:78764447-78764469 GATGAGGCTGAGAGACACAGGGG - Intergenic
1160762821 19:794175-794197 GGTGGGGCTGAGGGGCTGAGAGG + Intergenic
1160933241 19:1580636-1580658 GGTGAGGCTGAGCAGCCCAGGGG - Intronic
1161454225 19:4362148-4362170 TGTGAGGCTGAGACCCAGAGGGG + Intronic
1162028512 19:7907501-7907523 GGTGAGGATGAGAAAGAGAACGG - Intronic
1164434214 19:28215050-28215072 GGGGATGCTGGGAAGCTGAGAGG - Intergenic
1164522173 19:28988074-28988096 TGTGGGGCGGAGAGACTGAGGGG + Intergenic
1164567855 19:29340836-29340858 GGTGACTCTGACACACTGAGAGG - Intergenic
1165332992 19:35151673-35151695 GGTGAGGGTGAGAAACTGTGTGG + Exonic
1167112025 19:47468215-47468237 GGTGAGGCTGAGGAGCAGAGGGG - Intronic
1167820518 19:51923375-51923397 GGTGAGGCTGAGCACATGAGTGG - Intronic
1168072013 19:53958631-53958653 GGTGAGGCTGAGAAGCCCCGAGG - Intergenic
1168669714 19:58231228-58231250 GGGGAGGCTGGGAGCCTGAGTGG + Intronic
1168684740 19:58341670-58341692 CCAGAGGCTGAGAGACTGAGAGG + Exonic
925120875 2:1417065-1417087 CGTGAGACTGTGAGACTGAGCGG - Intronic
927523414 2:23716597-23716619 GGTGGGGCTGCTAAACTGGGAGG - Intergenic
927703658 2:25283851-25283873 AGGGAGGCTGAGAAACTCTGAGG - Intronic
927746294 2:25624557-25624579 GTATAGGCTGACAAACTGAGGGG - Intronic
928099236 2:28425694-28425716 TGTGAGGCTGGGAGACTGATCGG - Intergenic
928182388 2:29078358-29078380 GGTGAGGCTGATAGACTTTGAGG - Intergenic
929744001 2:44636494-44636516 GGTGCAGCTGAGAACCTGACTGG + Intronic
931878992 2:66546483-66546505 GGTGAGGCTTAGGCACTGAAAGG + Intronic
931910965 2:66899454-66899476 GGTGAAACTGAGAAAGAGAGAGG + Intergenic
932415247 2:71569720-71569742 GGTGAGGCTGACATACGCAGGGG + Intronic
933154577 2:78959004-78959026 CATGTTGCTGAGAAACTGAGGGG - Intergenic
934149850 2:89135796-89135818 GGTGATGCTGGGAGGCTGAGGGG + Intergenic
934197200 2:89848449-89848471 GATGAGGCTGAGACACACAGAGG - Intergenic
934217447 2:90046235-90046257 GGTGATGCTGGGAGGCTGAGGGG - Intergenic
934573549 2:95386212-95386234 TGTGAGCCTGAGAATTTGAGCGG - Intergenic
934898708 2:98140413-98140435 GGAGAGGCTTAGAAGATGAGTGG - Intronic
935263459 2:101375000-101375022 TGTGAAGCAGAGTAACTGAGGGG - Intronic
936452028 2:112640986-112641008 TTTTAGGCTGAGAAAGTGAGGGG - Intergenic
938302499 2:130227244-130227266 GGTGAGAGTGAGAAGCAGAGAGG - Intergenic
939139346 2:138335183-138335205 GGAGAGACTCAGACACTGAGAGG + Intergenic
940820528 2:158350935-158350957 GGTGAGGATGAGTAACAGTGAGG - Intronic
942113956 2:172709274-172709296 TGAGGGGCTGAGGAACTGAGAGG - Intergenic
942155725 2:173125082-173125104 GGTGTGGATGTGGAACTGAGAGG + Intronic
945060549 2:205905077-205905099 GGAGGGGCTGAGAAAGGGAGGGG - Intergenic
945191819 2:207196692-207196714 TTTGAGGCTGAGAAAGTGAGAGG + Intergenic
946353836 2:219172648-219172670 GCTGAGGCTGAGGAAGTGAAAGG + Exonic
948775811 2:240288260-240288282 GATGAGCCTGAGCAACAGAGAGG + Intergenic
948793385 2:240390510-240390532 GGGGAGCCTGTGAAACTCAGTGG + Intergenic
1169030273 20:2401316-2401338 GGGGAGGCTGGGGAACTGGGCGG - Intronic
1169670881 20:8100629-8100651 GGGGAGGGAGACAAACTGAGAGG + Intergenic
1171302902 20:24079200-24079222 AAGGAGGCTGAAAAACTGAGTGG + Intergenic
1172011086 20:31845850-31845872 GGACAGGATGTGAAACTGAGCGG + Intergenic
1172132309 20:32664081-32664103 GGGGAGGCTGAGAGCCTGCGGGG - Intergenic
1174144591 20:48442673-48442695 GCTGAGGCTGAGAAGCTCTGGGG - Intergenic
1174207524 20:48851570-48851592 GGTAAGGCTGAGAAAGACAGTGG - Intergenic
1174572589 20:51512767-51512789 GTGGAGACTGAGTAACTGAGAGG + Intronic
1175272248 20:57742526-57742548 GGTGAGTTTGAGAAACTGGAAGG + Intergenic
1175839154 20:62015651-62015673 GGAGAGGCTGGGAAACGCAGTGG - Intronic
1175940257 20:62534509-62534531 ATGGAGGCTGAGAGACTGAGAGG + Intergenic
1176098496 20:63354570-63354592 GGTGAGGCTGTGGAAGTGGGGGG + Intronic
1177809240 21:25907111-25907133 GGAGAGGCAGAGAAACTTATAGG - Intronic
1178334848 21:31733336-31733358 GCTGAGGCAGAGTAACTGTGAGG + Intergenic
1178385029 21:32142110-32142132 GGTGGGGCTGAGAACCTCTGTGG - Intergenic
1179190744 21:39119761-39119783 GGTGAGGCAGAGAACAAGAGGGG + Intergenic
1180651099 22:17377890-17377912 GCTGAGGCTGAGAAACCCAGAGG - Intronic
1181305176 22:21912385-21912407 GGTGAGGATGAGAAACGAGGTGG + Intergenic
1183056832 22:35311945-35311967 GGTGGGGCTTAGAAGATGAGGGG + Intronic
1183351725 22:37338298-37338320 GGTGAGGCTGAGGAACCTGGAGG - Intergenic
1183462073 22:37957423-37957445 TATGGGGCTGAGAAAGTGAGTGG + Intronic
1184045639 22:41970855-41970877 GGTGAGGATGGGAAATGGAGAGG - Intergenic
1184282572 22:43446575-43446597 GGAGAGTCTGAGCAAGTGAGTGG + Intronic
1184738621 22:46413853-46413875 GGTGGGGCTCACAAAGTGAGGGG - Intronic
950011480 3:9727201-9727223 GGAGAGGCTGTGGAGCTGAGAGG + Intronic
950014495 3:9746087-9746109 GGAGAGATGGAGAAACTGAGTGG - Intronic
950184383 3:10936334-10936356 GGTGAGGCAGCGAAATTCAGGGG - Intronic
950660065 3:14461715-14461737 GGTGAGGCTGAGAAAGTGAAAGG - Intronic
950734771 3:14997558-14997580 GGTGAGGCTGAGATCCTGCAAGG - Intronic
950921913 3:16703504-16703526 CTTGAGGCTGAGAAAGAGAGAGG - Intergenic
951043631 3:18014643-18014665 GATGAGGCTGAGTAAATCAGTGG - Intronic
951585451 3:24210595-24210617 GCTGAGACTGAGAAACTGTGAGG + Intronic
954743594 3:52774111-52774133 GTTGAAGCTGAGAGACTCAGAGG + Intergenic
954797191 3:53167530-53167552 GGGGAGACTGAGGCACTGAGCGG - Intronic
956401514 3:68884525-68884547 GGAGAGTCAGAGAAACTGAGCGG - Intronic
956872111 3:73428301-73428323 GGTGAGGATGTGGAACAGAGGGG - Intronic
957228965 3:77486813-77486835 GGTGGGGAAGAGAAACTAAGAGG - Intronic
958877740 3:99635053-99635075 AATGAGGCTGAGAAATGGAGAGG - Intergenic
959490751 3:106985638-106985660 GGGAAGGGTGAGAACCTGAGAGG + Intergenic
961027919 3:123576956-123576978 GATGAGGCTGAGAAAGTGCTGGG + Intronic
961475476 3:127143347-127143369 GTTGAGCCTGAGGAACAGAGAGG + Intergenic
961496812 3:127298991-127299013 GGTGGGGGTGAGAAACTGTCTGG + Intergenic
961780349 3:129317057-129317079 GGTGAGGCTGTGACACCCAGAGG + Intergenic
962606240 3:137035124-137035146 AGAGAGGGTGAGAAAATGAGAGG - Intergenic
963496554 3:146070628-146070650 GTTGTGGCTGAGAAGATGAGAGG - Exonic
963851333 3:150213381-150213403 GGTGAGGAAGACAAAGTGAGTGG + Intergenic
965142148 3:164851593-164851615 GGTGAGGCTGAGAGGATGTGAGG + Intergenic
965375341 3:167916114-167916136 GGTGAATCTGAGATACTGAAAGG + Intergenic
965483109 3:169244448-169244470 CCTGTGGCTGAGAAGCTGAGGGG - Intronic
968558258 4:1261410-1261432 GGTAGGGCTGAGAAACGGTGAGG + Intergenic
970228617 4:13885727-13885749 GATGAGGTTGAGAGACAGAGGGG - Intergenic
971233284 4:24818222-24818244 TTTGAGCCTGAGAAGCTGAGAGG + Intronic
972960039 4:44442861-44442883 AATGAAGCTGAAAAACTGAGTGG - Intronic
973071915 4:45871128-45871150 GATGAGGCTGAGAAAGTGATGGG + Intergenic
973851076 4:54962216-54962238 GAGGAAGCTGAGAAACAGAGAGG - Intergenic
974257051 4:59471217-59471239 GGTGATGCTAAAAAAGTGAGAGG + Intergenic
975567648 4:75775951-75775973 GATGAGGCAAAAAAACTGAGTGG + Intronic
975845438 4:78520118-78520140 GGTGAGGTGTGGAAACTGAGTGG - Intronic
977018716 4:91731209-91731231 GGTGATGCTGGGAAACTGAGAGG - Intergenic
977277127 4:94991651-94991673 GTTGGAGCTGAGAAACTGAGGGG + Intronic
977831574 4:101600216-101600238 GGTGTGCCTGAGGAACTGCGAGG + Intronic
979503209 4:121463340-121463362 GGTTAGCCTGGGAACCTGAGTGG - Intergenic
980992974 4:139754888-139754910 GCAGAGGAAGAGAAACTGAGGGG - Intronic
981107743 4:140900367-140900389 GGTGATGCTGATAACCTCAGAGG + Intronic
982265324 4:153533398-153533420 GGTGAGGCTCAGCACCTGATTGG - Intronic
982327224 4:154140911-154140933 GATGTGTCTGAGGAACTGAGAGG - Intergenic
982347744 4:154379366-154379388 AGGGAGGCTGAGAAAAGGAGAGG + Intronic
982720263 4:158852285-158852307 GGACAAGCTGAGAAACTGAGGGG + Intronic
983377216 4:166945582-166945604 GGAGAGGGTGAGAAAATAAGTGG - Intronic
984216382 4:176917322-176917344 GGTGAGGGGAAGAAACTTAGAGG + Intergenic
985039452 4:185875008-185875030 GGTGACTCAGAGAAACTGTGAGG + Intronic
985065601 4:186117892-186117914 GGTGAGGCTGAGGAAGCAAGAGG + Intronic
986122016 5:4848242-4848264 GGAGAGGCTGATAAACTCAAAGG - Intergenic
986325185 5:6667406-6667428 TATGAGGACGAGAAACTGAGAGG - Intronic
987075763 5:14380393-14380415 GATGGGGCTGAGAAACCCAGAGG - Intronic
987175948 5:15309727-15309749 AGGGAGACTGAGAAACTCAGGGG - Intergenic
988268459 5:28983196-28983218 GGCGAGGGGGAGAAACTTAGAGG - Intergenic
988815272 5:34828323-34828345 GCTGAAGTTGAGGAACTGAGAGG + Intronic
993123206 5:83800626-83800648 GGTAGGCCTGAGAAACAGAGAGG + Intergenic
994707454 5:103223586-103223608 GGAGAGGCTGAGATACCGAGAGG + Intergenic
995453233 5:112325762-112325784 GAAGAAACTGAGAAACTGAGTGG - Intronic
997634080 5:135391666-135391688 GATGAGGCTGAGAGACCCAGAGG - Intronic
997926276 5:138033302-138033324 GGGGAGGTTGGGAAACAGAGAGG + Intronic
998800114 5:145860552-145860574 TGTGTGACTGAGAGACTGAGTGG + Intronic
999495239 5:152090246-152090268 GATGTGGCTGAGAAATTGAAAGG + Intergenic
999540858 5:152571341-152571363 GATGAGGCTAAGAAACAGACAGG + Intergenic
1000152493 5:158517385-158517407 GGTGAGGATGAGAAGCACAGCGG + Intergenic
1001055658 5:168447854-168447876 AGAGAGGCAGAGAAACAGAGAGG - Intronic
1001254057 5:170170412-170170434 GCTCAGGCTGAGAAACTAACAGG - Intergenic
1001547089 5:172577040-172577062 GGTGAGGGTCAGAGACTGAGTGG + Intergenic
1002358705 5:178652437-178652459 TGCATGGCTGAGAAACTGAGTGG - Intergenic
1003685651 6:8299431-8299453 CGGGAGGCTGAGAACCTGGGAGG - Intergenic
1004325303 6:14669130-14669152 GGAGAAGGTGAGAAACTGTGGGG + Intergenic
1006025779 6:31145739-31145761 GTTGAGGCTGGGAAGCTGGGCGG + Exonic
1006585996 6:35113171-35113193 CGGGAGGCTGAGAACCTGGGAGG + Intergenic
1007600911 6:43080588-43080610 GAAGAGGCTGAGAAGCTAAGAGG - Intronic
1008140952 6:47831318-47831340 GGTGAGGAGGAGAGAGTGAGAGG - Intronic
1008363781 6:50651609-50651631 GAAGAGGATGAGAAATTGAGAGG + Intergenic
1008459283 6:51749050-51749072 GGTGTCACTGAGACACTGAGAGG - Intronic
1008595164 6:53034935-53034957 GGTAAGGCATGGAAACTGAGTGG + Intronic
1009375471 6:62962868-62962890 TGAGTGGCTGAGAAACTGAAAGG - Intergenic
1009411420 6:63369559-63369581 GGGGAGCTTGAGAAACTGATAGG - Intergenic
1012249979 6:96969208-96969230 GGTGTGGCCATGAAACTGAGTGG - Intronic
1013643065 6:112107073-112107095 TGTGATGTTTAGAAACTGAGTGG + Intergenic
1014138124 6:117910720-117910742 GGTAATGCTGAGACACAGAGTGG + Intronic
1015283105 6:131455156-131455178 GGTGAGGCAGAGAGACTGTGAGG - Intergenic
1015727023 6:136309615-136309637 AGTCAGGCTGATAAACTGGGAGG - Intergenic
1016582896 6:145649282-145649304 GATGAAGCTGAAACACTGAGAGG - Intronic
1017433021 6:154390163-154390185 GGTGGTGCTGAGAAAATGTGGGG - Exonic
1017818694 6:158033364-158033386 AGTGTGGCTGAGGAACTGGGGGG - Intronic
1018042160 6:159934360-159934382 GGAGAGGCTGAGACTCAGAGAGG + Intergenic
1018431369 6:163725403-163725425 GGAGAGGCTGAGAGGCCGAGAGG + Intergenic
1019033228 6:169031558-169031580 GGTGATGCTGAGGAAGTCAGAGG - Intergenic
1019702923 7:2482769-2482791 GTGGAAGCTGAGAAAATGAGGGG - Intergenic
1021412486 7:20344104-20344126 GCTGAGCCTGAGGAACTGTGTGG + Intronic
1021622738 7:22564285-22564307 GCAGAGGCTGAGAAAATGAAAGG - Intronic
1021787560 7:24166458-24166480 AGTGAGGCTGAGAGAGTGAAGGG + Intergenic
1022186271 7:27972444-27972466 GGTGAGGCTGGAGAAGTGAGGGG + Intronic
1022267870 7:28775295-28775317 GGTGAGGCGGGGAATCAGAGAGG - Intronic
1022980903 7:35603982-35604004 TTTCAGGCTGAGCAACTGAGTGG - Intergenic
1022981522 7:35609300-35609322 TTTCAGGCTGAGCAACTGAGTGG - Intergenic
1023777322 7:43620339-43620361 AATAAGGCTGTGAAACTGAGAGG + Intronic
1023975428 7:45026098-45026120 GGTGAGGCTGCTCAGCTGAGTGG + Intronic
1024122569 7:46260172-46260194 GGTGAGGCTGGGGAACAGAGTGG - Intergenic
1024548603 7:50542026-50542048 GATGAGGCTGAGAGGCCGAGAGG + Intronic
1026230219 7:68476422-68476444 GGGGAGGTTTAGAAACTGAATGG - Intergenic
1026834588 7:73629829-73629851 GGGGAGACTGAGACTCTGAGAGG + Intergenic
1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG + Intergenic
1028661839 7:93286483-93286505 GGTGAAGCTGAGAACCAGAGTGG + Intronic
1031891702 7:127301973-127301995 GGGGAGGATGAGAGAGTGAGAGG + Intergenic
1032328236 7:130952032-130952054 GGTGATGGTGGGAAGCTGAGTGG + Intergenic
1033226846 7:139569207-139569229 GGGCAGGCTGAGGAACTGGGTGG + Exonic
1033367443 7:140682459-140682481 GCTGAGGCTGAGGAGGTGAGAGG + Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035457506 7:159018278-159018300 GGTGAGACTGAGACACAGTGGGG - Intergenic
1035457517 7:159018326-159018348 GGTGAGACTGAGAAACAATGTGG - Intergenic
1035634940 8:1137458-1137480 GGTGAGGCTCAGACAGCGAGAGG - Intergenic
1036509730 8:9389131-9389153 GGTTAGGCTGACAAAGTGTGAGG - Intergenic
1036902849 8:12684539-12684561 GGCAAGGTTGAGAAGCTGAGAGG + Intergenic
1036987655 8:13554573-13554595 GTTAAGGATGAGAAACTGAAAGG - Intergenic
1037417815 8:18670234-18670256 GGTGGGTCTGAGAAACCCAGCGG + Intronic
1038301922 8:26359222-26359244 GGAGAGCCTGAGAAACTTAAAGG + Intronic
1038454794 8:27666201-27666223 TATTAGGCTGAGAAGCTGAGTGG - Intronic
1038992976 8:32889721-32889743 GGTGAGGCTGATGACCCGAGTGG - Intergenic
1039076797 8:33697782-33697804 GGTGAGGATGAGAGAATGACTGG + Intergenic
1040301909 8:46192408-46192430 GGTGGGCCTTAGAAACTCAGGGG + Intergenic
1041858795 8:62487272-62487294 GGTTGTGCTAAGAAACTGAGAGG + Intronic
1042155487 8:65841178-65841200 GGGGAGGCTGGAGAACTGAGGGG + Intronic
1042807933 8:72792094-72792116 AATGGGGCTGAGAAACTCAGTGG + Intronic
1042863312 8:73334934-73334956 GGTGAGGCTGAGGCACTGCTGGG + Intergenic
1044489707 8:92799041-92799063 GTTGAGGAGGTGAAACTGAGAGG - Intergenic
1044946847 8:97397361-97397383 GGTGAGTTTGAGGAGCTGAGAGG - Intergenic
1045052049 8:98336300-98336322 GGGGAGACTGAGAAACATAGGGG - Intergenic
1045059873 8:98402444-98402466 GGTGAGGCTGAGTTTCTGAAAGG + Intronic
1045280615 8:100746626-100746648 GGTGTGGCTGAGAGATAGAGAGG + Intergenic
1046676873 8:117119169-117119191 TGTGATGCTGAGATACTGTGAGG + Intronic
1047407013 8:124594133-124594155 AGTGAAGCAGAGAAACGGAGTGG - Intronic
1048175145 8:132145179-132145201 GCTGAGGTTGAAAAACTGAATGG + Intronic
1048360736 8:133695177-133695199 GGTGAGGGTGGGAGGCTGAGGGG + Intergenic
1048373240 8:133798804-133798826 GGTGAGGGTAAGAAACTTAGAGG + Intergenic
1049230912 8:141480676-141480698 GGTGAGGCTGGGAAACCAGGAGG + Intergenic
1049294258 8:141822401-141822423 GGGAAGGCTGAGAAAGAGAGTGG - Intergenic
1050491042 9:6188121-6188143 GACGAGGCTGAGAAACATAGTGG + Intergenic
1050730464 9:8703609-8703631 GGTGAGGATGAGAAGTCGAGGGG - Intronic
1053492439 9:38518931-38518953 GGTGAGGCTGAAAAGCTGTCAGG + Intergenic
1055255572 9:74366482-74366504 GGTGTGGCTGAGAGGATGAGGGG - Intergenic
1056286153 9:85089791-85089813 CATGAGACTGAGAAACTGTGTGG + Intergenic
1056769125 9:89464357-89464379 GGTGGGGCTGAGGACCTCAGGGG + Intronic
1056801460 9:89694970-89694992 GTGGAGGCTGAGGCACTGAGGGG + Intergenic
1058067405 9:100564831-100564853 TGTGAGGCTGAGAAAATAAATGG + Intronic
1058069375 9:100586091-100586113 GGAGAGGCTGAGACAGTCAGGGG + Exonic
1058748760 9:108018056-108018078 TGTGTGGCTGAGGAACTGAAAGG - Intergenic
1058759324 9:108115166-108115188 AGTGATGCTGAGTAAATGAGTGG - Intergenic
1059457204 9:114406948-114406970 GGGGAGGCCGAGCAGCTGAGTGG + Intronic
1060169202 9:121447128-121447150 GGTGATGTTGAGAACCTGAATGG + Intergenic
1060462595 9:123871709-123871731 GGTTAGGTTGAGAAACTGTCGGG - Intronic
1060883940 9:127137416-127137438 GGAGAGGCTGAGTGACTGGGGGG + Intronic
1062363051 9:136196611-136196633 GGTGAGGAGGAGACCCTGAGGGG + Exonic
1062708813 9:137960419-137960441 GGTCAGCCTGAGAGACGGAGGGG + Intronic
1187233125 X:17441462-17441484 GATGAAACTGAGATACTGAGAGG + Intronic
1187969277 X:24643321-24643343 TGTCAAGATGAGAAACTGAGTGG - Intronic
1188763604 X:34061920-34061942 GGTCAGGCTGAGGAAATGTGAGG - Intergenic
1189116598 X:38349516-38349538 GGTGAGAGTGAGAGACAGAGAGG - Intronic
1190888035 X:54546410-54546432 GGTGAGGTAGAGAAAGGGAGTGG + Intronic
1191675093 X:63785058-63785080 GGTGGGGCTGGGGGACTGAGAGG + Intronic
1193027596 X:76861366-76861388 GCTGGGGCTGAGAATCTGGGTGG - Intergenic
1193535925 X:82715136-82715158 GGTGGGGATGAGATGCTGAGTGG - Intergenic
1193872604 X:86819754-86819776 AGGGAATCTGAGAAACTGAGAGG - Intronic
1194697946 X:97079049-97079071 AGTGAGGGAGAGAAAGTGAGAGG - Intronic
1195422840 X:104694738-104694760 GGTAAGGTTGATCAACTGAGGGG + Intronic
1196601581 X:117606899-117606921 GGTGAGGCTAAGAACCAAAGAGG + Intergenic
1197047971 X:122023131-122023153 GGTCAGGCTGAAAAAATGACAGG - Intergenic
1197256594 X:124269934-124269956 GGTGAGGATGAGAATCCCAGAGG - Intronic
1198087118 X:133292246-133292268 GTTGAGGATGGGCAACTGAGAGG + Intergenic
1199254294 X:145700740-145700762 CTTGAGGGTGAGAAACTGATAGG - Intergenic
1199423554 X:147675577-147675599 GGTGAAAATGAGAAACTTAGTGG + Intergenic
1199854713 X:151751010-151751032 GGTGTGTCTGAGGAACTCAGAGG - Intergenic