ID: 1085682894

View in Genome Browser
Species Human (GRCh38)
Location 11:78594840-78594862
Sequence CGTTATCTGCAGGAGCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085682894_1085682897 2 Left 1085682894 11:78594840-78594862 CCCAGTTGCTCCTGCAGATAACG No data
Right 1085682897 11:78594865-78594887 ACTATTGTAGAACCTAAGATTGG 0: 106
1: 288
2: 345
3: 270
4: 272
1085682894_1085682899 24 Left 1085682894 11:78594840-78594862 CCCAGTTGCTCCTGCAGATAACG No data
Right 1085682899 11:78594887-78594909 GCCTTTTGAAATATCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085682894 Original CRISPR CGTTATCTGCAGGAGCAACT GGG (reversed) Intergenic
No off target data available for this crispr