ID: 1085684622

View in Genome Browser
Species Human (GRCh38)
Location 11:78610427-78610449
Sequence AACAGCTCTTGGCCTGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085684618_1085684622 26 Left 1085684618 11:78610378-78610400 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1085684622 11:78610427-78610449 AACAGCTCTTGGCCTGATACTGG No data
1085684620_1085684622 22 Left 1085684620 11:78610382-78610404 CCAAAGTGCTAGGATTACAAGCA 0: 387
1: 12756
2: 118396
3: 249307
4: 242012
Right 1085684622 11:78610427-78610449 AACAGCTCTTGGCCTGATACTGG No data
1085684619_1085684622 23 Left 1085684619 11:78610381-78610403 CCCAAAGTGCTAGGATTACAAGC 0: 700
1: 25444
2: 253789
3: 274300
4: 170459
Right 1085684622 11:78610427-78610449 AACAGCTCTTGGCCTGATACTGG No data
1085684617_1085684622 29 Left 1085684617 11:78610375-78610397 CCGCCTCCCAAAGTGCTAGGATT 0: 315
1: 4213
2: 3712
3: 2558
4: 2013
Right 1085684622 11:78610427-78610449 AACAGCTCTTGGCCTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085684622 Original CRISPR AACAGCTCTTGGCCTGATAC TGG Intergenic
No off target data available for this crispr