ID: 1085685960

View in Genome Browser
Species Human (GRCh38)
Location 11:78622162-78622184
Sequence ACTTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085685960_1085685965 16 Left 1085685960 11:78622162-78622184 CCTGCCATCTTCTGCAGATAAGT No data
Right 1085685965 11:78622201-78622223 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1085685960_1085685962 4 Left 1085685960 11:78622162-78622184 CCTGCCATCTTCTGCAGATAAGT No data
Right 1085685962 11:78622189-78622211 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1085685960_1085685964 15 Left 1085685960 11:78622162-78622184 CCTGCCATCTTCTGCAGATAAGT No data
Right 1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1085685960_1085685966 25 Left 1085685960 11:78622162-78622184 CCTGCCATCTTCTGCAGATAAGT No data
Right 1085685966 11:78622210-78622232 GGCCTGTTACTGGGATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085685960 Original CRISPR ACTTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr