ID: 1085687035

View in Genome Browser
Species Human (GRCh38)
Location 11:78632921-78632943
Sequence TCTGAGCCACAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085687028_1085687035 22 Left 1085687028 11:78632876-78632898 CCTAAGAAAGAATACCAGAATTC No data
Right 1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG No data
1085687031_1085687035 8 Left 1085687031 11:78632890-78632912 CCAGAATTCAGCAGGGAAATGAT No data
Right 1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085687035 Original CRISPR TCTGAGCCACAGAAGGAGAA GGG Intergenic
No off target data available for this crispr