ID: 1085687667

View in Genome Browser
Species Human (GRCh38)
Location 11:78638892-78638914
Sequence CACCCACCTGGAACTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085687667_1085687674 2 Left 1085687667 11:78638892-78638914 CCAGTGAGAGTTCCAGGTGGGTG No data
Right 1085687674 11:78638917-78638939 GGCTTGGCGGGCCCTGCACTTGG 0: 57
1: 314
2: 372
3: 311
4: 366
1085687667_1085687677 15 Left 1085687667 11:78638892-78638914 CCAGTGAGAGTTCCAGGTGGGTG No data
Right 1085687677 11:78638930-78638952 CTGCACTTGGAGCAGCCAGCCGG No data
1085687667_1085687673 -10 Left 1085687667 11:78638892-78638914 CCAGTGAGAGTTCCAGGTGGGTG No data
Right 1085687673 11:78638905-78638927 CAGGTGGGTGTGGGCTTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085687667 Original CRISPR CACCCACCTGGAACTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr