ID: 1085687673

View in Genome Browser
Species Human (GRCh38)
Location 11:78638905-78638927
Sequence CAGGTGGGTGTGGGCTTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085687667_1085687673 -10 Left 1085687667 11:78638892-78638914 CCAGTGAGAGTTCCAGGTGGGTG No data
Right 1085687673 11:78638905-78638927 CAGGTGGGTGTGGGCTTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085687673 Original CRISPR CAGGTGGGTGTGGGCTTGGC GGG Intergenic