ID: 1085687674 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:78638917-78638939 |
Sequence | GGCTTGGCGGGCCCTGCACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1085687671_1085687674 | -10 | Left | 1085687671 | 11:78638904-78638926 | CCAGGTGGGTGTGGGCTTGGCGG | No data | ||
Right | 1085687674 | 11:78638917-78638939 | GGCTTGGCGGGCCCTGCACTTGG | No data | ||||
1085687667_1085687674 | 2 | Left | 1085687667 | 11:78638892-78638914 | CCAGTGAGAGTTCCAGGTGGGTG | No data | ||
Right | 1085687674 | 11:78638917-78638939 | GGCTTGGCGGGCCCTGCACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1085687674 | Original CRISPR | GGCTTGGCGGGCCCTGCACT TGG | Intergenic | ||