ID: 1085687674

View in Genome Browser
Species Human (GRCh38)
Location 11:78638917-78638939
Sequence GGCTTGGCGGGCCCTGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085687667_1085687674 2 Left 1085687667 11:78638892-78638914 CCAGTGAGAGTTCCAGGTGGGTG No data
Right 1085687674 11:78638917-78638939 GGCTTGGCGGGCCCTGCACTTGG No data
1085687671_1085687674 -10 Left 1085687671 11:78638904-78638926 CCAGGTGGGTGTGGGCTTGGCGG No data
Right 1085687674 11:78638917-78638939 GGCTTGGCGGGCCCTGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085687674 Original CRISPR GGCTTGGCGGGCCCTGCACT TGG Intergenic