ID: 1085687677

View in Genome Browser
Species Human (GRCh38)
Location 11:78638930-78638952
Sequence CTGCACTTGGAGCAGCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085687667_1085687677 15 Left 1085687667 11:78638892-78638914 CCAGTGAGAGTTCCAGGTGGGTG No data
Right 1085687677 11:78638930-78638952 CTGCACTTGGAGCAGCCAGCCGG No data
1085687671_1085687677 3 Left 1085687671 11:78638904-78638926 CCAGGTGGGTGTGGGCTTGGCGG No data
Right 1085687677 11:78638930-78638952 CTGCACTTGGAGCAGCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085687677 Original CRISPR CTGCACTTGGAGCAGCCAGC CGG Intergenic