ID: 1085690350

View in Genome Browser
Species Human (GRCh38)
Location 11:78659214-78659236
Sequence ACATCAAGAAATGTTAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085690350 Original CRISPR ACATCAAGAAATGTTAGCTA TGG (reversed) Intronic
903593774 1:24478619-24478641 ACATAAATAATTGTTAACTAGGG + Intergenic
903835398 1:26200427-26200449 CACTCAATAAATGTTAGCTACGG + Intronic
904045390 1:27605254-27605276 ACTTCAACAAATGTTAACTGAGG + Intergenic
905362052 1:37427761-37427783 TTCTCAATAAATGTTAGCTATGG - Intergenic
906987892 1:50706538-50706560 AAATCAAGAAATGTAAGTCATGG + Intronic
907149554 1:52270887-52270909 ACATCAAGAAGTATTAGTTTGGG + Intronic
907688459 1:56637459-56637481 ACATCAAGAAATTTTGGTGATGG - Intronic
908376454 1:63546947-63546969 ACATTAAAAAAGGTTATCTAGGG - Intronic
908647133 1:66290319-66290341 ACATCAATAAATATAAGCTATGG - Intronic
912850162 1:113116994-113117016 AAATCAACAAATGGTAGCAATGG + Intronic
914416884 1:147492578-147492600 ACATGAAGAAATGTCTGCTCTGG - Intergenic
915998402 1:160588901-160588923 AGACCATGAAATGTCAGCTAAGG + Intergenic
918137182 1:181684533-181684555 ACATCATGAAATCTTTGCCAAGG + Intronic
919259337 1:195170675-195170697 ACATAAAGCAATGTTAGTTTGGG + Intergenic
919600690 1:199618479-199618501 AAATCAAGAAATTTTAGCAAAGG + Intergenic
920240491 1:204544832-204544854 ACATTAAGTAATGTTAACCAGGG + Intronic
1063276770 10:4577852-4577874 ACATTAACAAATGTTCCCTAGGG + Intergenic
1064618019 10:17183063-17183085 ACATCTGGAAATGTTCGCTAAGG + Intronic
1065240610 10:23700084-23700106 CCATAAAGTAATGTTAGCAAAGG - Intronic
1068358296 10:55941134-55941156 ACATCATGAACTGTAAGCTAGGG - Intergenic
1068680316 10:59812224-59812246 GCATGAACAAATGTCAGCTAAGG + Intronic
1069703969 10:70445594-70445616 TGCTCAATAAATGTTAGCTATGG - Intronic
1071544104 10:86514962-86514984 ACATCAAGAAATGTCAGGCTGGG + Intronic
1072989333 10:100176203-100176225 ACATCAAGATTTGTTAGTTGTGG - Intronic
1073661816 10:105484095-105484117 ACATCAAAAATTCTTAACTAGGG + Intergenic
1079467028 11:20740641-20740663 ACATTAAGAAAAGTTATTTAAGG - Intronic
1080297174 11:30743718-30743740 AGTTCAAGAAATTTGAGCTAAGG - Intergenic
1081029061 11:38054994-38055016 AGATCATGAATTGTTAGCTTTGG + Intergenic
1082070500 11:47935852-47935874 ACTTCAAGGAATGATAGCTGTGG - Intergenic
1083485360 11:62980062-62980084 AAATGAAGAAATATTAGCCAAGG - Intronic
1085690350 11:78659214-78659236 ACATCAAGAAATGTTAGCTATGG - Intronic
1086174064 11:83869127-83869149 ACAGTAAGAAATGTTAGATCTGG + Intronic
1087162893 11:94967465-94967487 AGATCTAGAAGTGATAGCTAAGG - Intronic
1087262450 11:96025939-96025961 CCCTCAATAAATGTTAGCTGGGG - Intronic
1088313196 11:108482118-108482140 ACACCATGAAATGATAGGTATGG + Exonic
1088906445 11:114158766-114158788 ACCCCATGACATGTTAGCTATGG - Intronic
1089058631 11:115608083-115608105 ACATCAAAAAATGTTAAGTAGGG + Intergenic
1090319342 11:125828850-125828872 AAATCCAGACCTGTTAGCTAGGG + Intergenic
1093229238 12:16522838-16522860 ACAGAAAGAAAGGTTACCTAAGG - Intronic
1093367790 12:18324675-18324697 ACATCAAGAAATATTAAGTATGG - Intronic
1096085356 12:48861900-48861922 ACATCAAGAAATGGAAGCCAGGG - Intronic
1097567618 12:61290641-61290663 ACATCAAGAAATGTTTGAGCAGG - Intergenic
1099338789 12:81399965-81399987 TCATCAATACATGTTAACTACGG - Intronic
1099799604 12:87441052-87441074 AACTCAAGAAATGTTAGGAATGG + Intergenic
1099819042 12:87686027-87686049 AAATCAAGAAATGTCAGTAAAGG - Intergenic
1099912815 12:88854171-88854193 AGATCAAGAAATGTGAGAGAGGG - Intergenic
1099938461 12:89156575-89156597 ACACTAAGAAATGGAAGCTAAGG + Intergenic
1100194099 12:92224553-92224575 ACATCAAGAAATGTGGGATTAGG - Intergenic
1101616152 12:106339530-106339552 TCATCACGAAATGTTTGCCAAGG + Intronic
1101693598 12:107103825-107103847 AAATTAAGTAATGTTATCTAAGG - Intergenic
1109506056 13:63305341-63305363 ACAGCAATAAATCGTAGCTATGG + Intergenic
1111074287 13:83212530-83212552 ACATCATAAAATCTTTGCTAGGG - Intergenic
1111550100 13:89797841-89797863 CCATAAAGAAATGATAGATAAGG - Intergenic
1111906248 13:94259202-94259224 ACATAAAGTAATGTTTGCTCGGG - Intronic
1112218903 13:97467445-97467467 ATATAAAGAAATGTTGCCTAAGG + Exonic
1112810364 13:103211491-103211513 ACATCAAGATATGCTATTTATGG + Intergenic
1114346823 14:21805352-21805374 ACATCAAGAAAGGCAAGATAGGG + Intergenic
1114598776 14:23936736-23936758 ACAACAACAAGTGTTAGTTATGG - Intergenic
1115675470 14:35668500-35668522 ACATTAAAAAATGATAGCTCAGG + Intronic
1117076696 14:52112193-52112215 ACATCAACACATGTTAGCCTAGG - Intergenic
1119229962 14:72971919-72971941 GGATTAAGAAAGGTTAGCTAAGG + Intronic
1119981797 14:79090139-79090161 ATAATAAGAAATGTTGGCTAAGG + Intronic
1120612453 14:86658671-86658693 ACATAAAGAAATGAGAGTTAAGG - Intergenic
1123780237 15:23619801-23619823 ACATGAAGAAATGGAAGCGAGGG - Intronic
1126274551 15:46861708-46861730 ACAAGGAGAAAGGTTAGCTAGGG - Intergenic
1126429799 15:48570572-48570594 ATTTTAAGAAATGTTAGATAGGG - Intronic
1128096820 15:64962854-64962876 AGATCAATAAATGATAGCTTAGG + Intergenic
1129018501 15:72491191-72491213 GCATAAAGAAATGGCAGCTAAGG - Intronic
1129968826 15:79759553-79759575 GGATTAAGAAAGGTTAGCTAAGG + Intergenic
1133688626 16:8191055-8191077 ACATGAAGAAAAGATAGCAAAGG + Intergenic
1138004808 16:53322861-53322883 ACATAATGAAATGTTAGCAATGG + Intronic
1139293032 16:65875058-65875080 AAATAAAGAAATTTTAGCCAGGG - Intergenic
1139389574 16:66598218-66598240 ACATCAGGAAATGTCTGCTATGG - Intergenic
1140608396 16:76568841-76568863 ACATCATGAAATTTCAACTATGG - Intronic
1146643401 17:34558572-34558594 ACATCACGAAATTTTTGCTTTGG - Intergenic
1146649132 17:34595928-34595950 ACAGCATGAAATGTGAACTATGG + Intronic
1148254543 17:46118083-46118105 ACATCTAGAAATTTAACCTAAGG + Intronic
1149083257 17:52683567-52683589 ACATAAAGAAATAATAGCTTTGG + Intergenic
1149487025 17:57050486-57050508 ACAACAACAAATGTGAGCTTGGG - Intergenic
1149586055 17:57787704-57787726 ACTCAAAAAAATGTTAGCTATGG + Intergenic
1150361316 17:64536970-64536992 ACATTAAGAAATGTTACATTTGG + Intronic
1152877244 17:82793866-82793888 ACACCAAGAAATGGTATCTTGGG - Intronic
1155779781 18:29816505-29816527 TCATCATGAAATTTTTGCTAGGG - Intergenic
1156131579 18:33982618-33982640 ACTTCAACAAATGTTAGAAATGG + Intronic
1157168119 18:45377192-45377214 ACTTCAAGAGATGTAAGCTGAGG - Intronic
1159865305 18:73696736-73696758 ACATCAAGAAATTTTAGCTGTGG + Intergenic
1159925928 18:74269011-74269033 GCATCTATAAAGGTTAGCTATGG + Intronic
1160289043 18:77573176-77573198 GTACCAAGAAATGTTTGCTACGG - Intergenic
1161186437 19:2924509-2924531 ACATCAAGATATGTGAGTTAAGG - Intergenic
927411254 2:22828785-22828807 AATTCAGTAAATGTTAGCTATGG - Intergenic
928422127 2:31145846-31145868 TCATCAAGAAAAGTTTGCTAAGG - Intronic
928513500 2:32023159-32023181 ACATCAACAAATGTTCTCTGGGG + Intronic
929241131 2:39654694-39654716 TAATTAAGAAATGTTAGCCATGG - Intergenic
930549728 2:52817749-52817771 AAATAAAGAATTGTTAACTATGG - Intergenic
931154927 2:59617395-59617417 ACATCAGGAATTGAAAGCTAAGG - Intergenic
933348566 2:81123304-81123326 AAATCAACAAATGCTAGCCAAGG - Intergenic
933619837 2:84526155-84526177 GCATAAAGAAATGGTAGCTCAGG + Intronic
934603489 2:95676979-95677001 AGATCATAAAATGTTAGCTCTGG + Intergenic
935262892 2:101370354-101370376 GCACCAATAAATGGTAGCTATGG - Intronic
936480797 2:112883346-112883368 ACAGCAAGAAATGGCAGCAAAGG - Intergenic
936536879 2:113319206-113319228 AGATCATAAAATGTTAGCTCTGG + Intergenic
936798713 2:116240290-116240312 ACATCATGTGATGTTAGCTATGG - Intergenic
937366812 2:121268512-121268534 AAATTTAGAAATGTTAGCTGGGG - Intronic
938452136 2:131430717-131430739 ACTTCATGAAATGTTAACAATGG - Intergenic
939106155 2:137950974-137950996 ACATCAAGAAATTTTAGGCCAGG - Intergenic
939186877 2:138871643-138871665 ACATAAAGAAATGTTTTCGATGG - Intergenic
940469525 2:154077702-154077724 ACATCAAGGAATGTATGCTTTGG + Intronic
941177277 2:162213851-162213873 ACAACATAAAATGTTAGCTATGG + Intronic
942372722 2:175302855-175302877 AAATCAAGAAATATAAGCTCTGG - Intergenic
942892461 2:181007895-181007917 ACTTCATTAAATGTTAGCTGTGG - Intronic
944471738 2:200060731-200060753 TCATCATGAAATGTTTGCCAGGG - Intergenic
946136459 2:217651578-217651600 ACCTAAAGAATTGTTAACTAGGG - Intronic
947292220 2:228588539-228588561 AGATTAAGAAATGACAGCTAAGG - Intergenic
948307287 2:236958017-236958039 AGCTCAAGAAATGTGAGTTAGGG - Intergenic
1169108331 20:3016420-3016442 ACATCCAGATATTTTTGCTAGGG - Intronic
1170936915 20:20818409-20818431 ACAGAAAGAAATGGTGGCTAAGG - Intergenic
1177579518 21:23002463-23002485 AAACCAAGAAATATCAGCTATGG + Intergenic
1180526205 22:16264179-16264201 TCATCAATGAATGTTATCTAAGG - Intergenic
1181340598 22:22176586-22176608 ACAGAAAGAAATGTTAGCTCTGG - Intergenic
1182200990 22:28569644-28569666 TCATCATGAAATCTTTGCTAGGG - Intronic
949248682 3:1956868-1956890 ATAGAAAGAAATGTTAGGTAAGG + Intergenic
951664634 3:25108708-25108730 ACATCAAGAAAAAATAGCTTTGG - Intergenic
952170812 3:30805092-30805114 AGCTCAATAAATGTTAGCTCTGG - Intronic
953245559 3:41188246-41188268 CCATCAAGCAATGATAGATAGGG - Intergenic
956341493 3:68229094-68229116 AATTCAAGAAATCTTGGCTATGG + Intronic
956367124 3:68516399-68516421 CCTTCAAGAAATGTTAGCCTTGG + Intronic
958154673 3:89741205-89741227 ACATTAAGAAATGAAAGATAAGG - Intergenic
958576408 3:95954436-95954458 ACTTCAAGAAATGTGTACTAGGG + Intergenic
958830970 3:99088793-99088815 ACATCAGGAAAGCTTATCTATGG + Intergenic
959265310 3:104130012-104130034 ACTCCAAGAAATTTTGGCTAAGG + Intergenic
960023158 3:112978100-112978122 ACATCCAGAAAATTCAGCTATGG - Intergenic
960118438 3:113922016-113922038 TCATCATGAAATCTTTGCTAGGG + Intronic
960210958 3:114965179-114965201 ACATCATGATATATTAACTAAGG - Intronic
960410508 3:117317800-117317822 ATATCAAAAAATGTTAGTGAAGG + Intergenic
961220469 3:125195193-125195215 ACATGAAGACAAGTTAGCTGGGG - Intronic
962976111 3:140447260-140447282 TCATCAAGCAATGTGAGTTATGG - Intronic
965005333 3:163015256-163015278 ACATAAATATATTTTAGCTAAGG - Intergenic
965755471 3:172021869-172021891 AGATCAATAAATTTTAGCTCAGG + Intergenic
965766473 3:172135967-172135989 AGATGAATAAATGTTAGCAATGG - Intronic
966123039 3:176544874-176544896 CCATCAAGAAATTTCAGCTGGGG + Intergenic
966515817 3:180820236-180820258 TCATCATGAAATCTTTGCTAGGG - Intronic
970093566 4:12436363-12436385 GCATCATGCAATGTTAGCTGTGG + Intergenic
970285029 4:14502716-14502738 TCATCATGAAATCTTAGCCAGGG + Intergenic
970844085 4:20515248-20515270 ACATCAAGAAATAATATGTATGG + Intronic
971037894 4:22715063-22715085 ACCTCAACAAATGGAAGCTAGGG - Intergenic
971147249 4:23991882-23991904 ATAGCAAGAAATCTTAGCTGAGG + Intergenic
972743857 4:41914435-41914457 AGATAAAGAAATGATAGCAAAGG + Intergenic
973875932 4:55218424-55218446 ATATCAAGAAATGGTGGCAAAGG + Intergenic
974218903 4:58939761-58939783 ACATGGAGAAATGTTAGGTTTGG + Intergenic
975447772 4:74486564-74486586 ATATCAAGAAAATTTAGTTATGG - Intergenic
977424512 4:96850572-96850594 ACCTCAAGAGAAGTTATCTAAGG + Intergenic
977781861 4:100990052-100990074 ACATAAAGAAATGTCAGGGATGG - Intergenic
978802496 4:112768842-112768864 ACATAAAGAAAGATTAGCTCAGG - Intergenic
978884800 4:113755149-113755171 ACATCAAAAAAGGTTACTTAGGG + Intronic
979840598 4:125435426-125435448 ACATTAAGAATTATCAGCTATGG + Intronic
980428797 4:132663050-132663072 GCATTAAGAAATATGAGCTATGG - Intergenic
984874926 4:184359014-184359036 CCATCAACAAATGTCAGCTTTGG - Intergenic
986480634 5:8183575-8183597 ACCTCAATAAATCTTACCTATGG - Intergenic
987553104 5:19409556-19409578 TCATCATGAAACTTTAGCTAGGG + Intergenic
987768527 5:22268623-22268645 TCATCAAACTATGTTAGCTATGG - Intronic
988556618 5:32241788-32241810 ACATTAAGAAATGTGAGCTTTGG + Intronic
989721426 5:44533336-44533358 AAATCAATAAATGTTATTTATGG - Intergenic
990642482 5:57803176-57803198 ATATCAAGCAATGTTAGAGATGG - Intergenic
991230192 5:64323712-64323734 TTATCAAAAAATGTTAGCCACGG - Intronic
992117617 5:73556084-73556106 ACAGGCAGCAATGTTAGCTATGG - Intronic
994680933 5:102887052-102887074 ACATTAAGAAATATTTGTTAGGG + Intronic
994765024 5:103904463-103904485 TCATCATGAAATGTTTGCCAGGG - Intergenic
994952686 5:106484509-106484531 ACCTCAGGAAATGTTAGATGAGG - Intergenic
995160402 5:108973872-108973894 ACATTAAGAAATGATTCCTAAGG - Intronic
996799215 5:127384211-127384233 AGATAAGGAAATCTTAGCTATGG + Intronic
997639380 5:135438672-135438694 ACCTCAGAAAATGATAGCTATGG - Intergenic
998672169 5:144366409-144366431 ACAGCAAAAAATGATAGCAAAGG - Intronic
998888256 5:146717862-146717884 AAATGAAGAGATGTTGGCTAAGG - Intronic
999975739 5:156910322-156910344 AGAGCAAGAATTCTTAGCTATGG - Intergenic
1000152065 5:158512955-158512977 ACATCAAGAAGCTTTAGCTAGGG + Intergenic
1003484802 6:6566294-6566316 ATATCAAGATATGTTAACAAAGG - Intergenic
1004163482 6:13235047-13235069 ACATAAAGGAATGGTACCTATGG + Intronic
1004214070 6:13685152-13685174 ACTTCAAGAAATCTTTCCTACGG + Intronic
1004397598 6:15259604-15259626 AGATCATAAAATGTTTGCTAGGG + Intronic
1004486812 6:16073784-16073806 ACATCAAGAAAACTTAGACATGG - Intergenic
1007812437 6:44495925-44495947 ACACCAATAAATGGTAGCTATGG + Intergenic
1008041460 6:46805300-46805322 ACAACACCAAATGTTAGCAAAGG - Intronic
1008241113 6:49112926-49112948 ACATCAAGAAAGGACAGTTAGGG + Intergenic
1009694632 6:67086357-67086379 ACATCATGAAATCTTTGCCAGGG + Intergenic
1010617608 6:78031557-78031579 AAATCAAGAAATCTTAGCCTTGG + Intergenic
1010675147 6:78734589-78734611 ACATGAAGAAAGGTTAGTTATGG - Intergenic
1010847687 6:80730522-80730544 AATTCAAAAAATGGTAGCTATGG + Intergenic
1013533639 6:111042958-111042980 ACAACAAGAAGTGTTATCAATGG + Intergenic
1013763423 6:113545793-113545815 ACATAAAGATATATTAACTAAGG + Intergenic
1014205742 6:118652775-118652797 AAATCATGTAATGTTAGCCAAGG + Exonic
1016526631 6:145009228-145009250 ATATTAAAAAATATTAGCTATGG + Intergenic
1018278230 6:162156233-162156255 ACATCAAGTAATGTTACTTTTGG - Intronic
1021291411 7:18849888-18849910 ACATCTACAAATGTTATCTTTGG - Intronic
1021310306 7:19086969-19086991 TCACCATGAAATGTTAGCTGTGG - Intronic
1021711246 7:23417413-23417435 AAATTAAGAAAAGTTAGATACGG + Intronic
1023607729 7:41945359-41945381 TTACCAAGAAATATTAGCTAGGG + Intergenic
1025322273 7:58108494-58108516 ACATCAATGAATGGTATCTAAGG - Intergenic
1027109229 7:75423863-75423885 ACATCAGGAAGTGTTAGAGAAGG - Intronic
1028243257 7:88446792-88446814 ACATCTAGAATTGTGAGGTAAGG + Intergenic
1028555779 7:92122957-92122979 ACATTAAGATATTTTAGGTAAGG + Intronic
1029881594 7:103817151-103817173 ACATAAAGAAATATAAGCAAGGG - Intronic
1029931865 7:104380326-104380348 ACATTAAGAGATGTTAGATGTGG + Intronic
1030142377 7:106318486-106318508 ACAGCAAGTAATGTTACCTTTGG - Intergenic
1031669109 7:124520721-124520743 TCATCACGAAATGTTTGCCAGGG + Intergenic
1032207069 7:129875829-129875851 ACCTCGAGAAGTGTGAGCTATGG + Intronic
1032752770 7:134858494-134858516 ACATGAAGGTATGTTAGATATGG - Intronic
1033933131 7:146548659-146548681 ACATCAACAAAAATGAGCTATGG - Intronic
1035087130 7:156270116-156270138 CACTCAAGAAATATTAGCTATGG - Intergenic
1036586173 8:10125781-10125803 TCATCAACAAATGATAGCAATGG - Intronic
1039380251 8:37078382-37078404 ACTTCAAGAAATGTTGGTAAAGG + Intergenic
1039666176 8:39531806-39531828 ACATTAAGAAATGTTATCAATGG + Intergenic
1041187721 8:55318313-55318335 ACATCAATAAATGGTTGTTATGG + Intronic
1041665062 8:60435757-60435779 TCATCATGAAATGTTTGCCAGGG - Intergenic
1041848203 8:62356399-62356421 ACATAAACAAATGTAAGTTATGG - Intronic
1042186798 8:66144221-66144243 ACATCCAGAAATGTTGGCATTGG + Intronic
1047434947 8:124828534-124828556 ACTTCCACAAATGTTAGATATGG + Intergenic
1048101357 8:131355778-131355800 TCATCATGAAATCTTTGCTATGG + Intergenic
1050403027 9:5276560-5276582 TCATCAAGAAATCTTTGCCAGGG - Intergenic
1053441484 9:38120077-38120099 ACATCTGGAAATGTCAGCTGAGG - Intergenic
1054847021 9:69808778-69808800 ACACCAAGAAATATAACCTAGGG - Intergenic
1055969647 9:81899087-81899109 ACTCTAAGAAATGTAAGCTATGG - Intergenic
1058227727 9:102386277-102386299 ATATGAAGAAATGGAAGCTAAGG - Intergenic
1058910027 9:109512489-109512511 ACGTCAAGAAATGTTTGTTAGGG + Intergenic
1059132785 9:111772021-111772043 ACATCAAGAATTCTTAGATTTGG + Intronic
1185820846 X:3202874-3202896 ACCTCAAGAAAAGTGAGCTTGGG - Intergenic
1186675277 X:11809875-11809897 GCATTAACAAATGTTAGCTAGGG - Intergenic
1187585121 X:20651878-20651900 ACATAAAGAAAATTTTGCTATGG - Intergenic
1188775414 X:34211689-34211711 AGATTTAGAAATGTTAGATATGG - Intergenic
1189397074 X:40632452-40632474 GTTTCAAGAAATGTCAGCTATGG - Intronic
1190142910 X:47863675-47863697 AGAGCAAGAGGTGTTAGCTATGG + Intronic
1194063234 X:89230502-89230524 AGATGAAGAGAGGTTAGCTACGG + Intergenic
1194516432 X:94861024-94861046 ATATCAAGACATGTAAGATATGG + Intergenic
1195054545 X:101130931-101130953 ACATGAAGAAAAGTTAGACATGG - Intronic
1195532474 X:105972127-105972149 ACATAAATAAATGTATGCTATGG - Intergenic
1195611086 X:106867490-106867512 ATATAAAGAAATGTGAGCTTTGG - Intronic
1196065308 X:111457845-111457867 AAATCAAGAAACGTCAGCCATGG + Intergenic
1196588757 X:117460881-117460903 AAGTCAAGAAATGTTATCCAAGG - Intergenic
1197353332 X:125403646-125403668 ACATCCAGTAATTTTATCTATGG + Intergenic
1197424141 X:126273668-126273690 ACATCAAGAAATACAAGTTAAGG - Intergenic
1199325168 X:146490465-146490487 ATATCTAGAAATGTTATCTTGGG - Intergenic
1200949364 Y:8879216-8879238 ACATCCATAAATGCTATCTAGGG + Intergenic