ID: 1085694444

View in Genome Browser
Species Human (GRCh38)
Location 11:78692042-78692064
Sequence CAGGTCCCTGCTCTTTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085694444_1085694450 4 Left 1085694444 11:78692042-78692064 CCACAACAAAGAGCAGGGACCTG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1085694450 11:78692069-78692091 GGGCAGTTCTCTGAACTCCCTGG 0: 1
1: 0
2: 2
3: 10
4: 301
1085694444_1085694451 5 Left 1085694444 11:78692042-78692064 CCACAACAAAGAGCAGGGACCTG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1085694451 11:78692070-78692092 GGCAGTTCTCTGAACTCCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 288
1085694444_1085694452 15 Left 1085694444 11:78692042-78692064 CCACAACAAAGAGCAGGGACCTG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1085694452 11:78692080-78692102 TGAACTCCCTGGGCTCCAAGTGG 0: 1
1: 0
2: 1
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085694444 Original CRISPR CAGGTCCCTGCTCTTTGTTG TGG (reversed) Intronic
900368501 1:2321140-2321162 CACGTCCCTGCTCACTGCTGTGG - Intergenic
902101894 1:13996989-13997011 CAGGTGCCTGCTCCTTTTTCTGG - Intergenic
906582627 1:46948803-46948825 CATGTCCCTACTCTTTGGTTTGG - Intergenic
906600981 1:47129069-47129091 CATGTCCCTACTCTTTGGTTTGG + Intergenic
906734397 1:48110687-48110709 CTGGTTCCTTCTCTTTGTTCAGG - Intergenic
907097905 1:51798278-51798300 CAAATCCCAGCTCTTTGTGGAGG - Exonic
907391421 1:54160772-54160794 CAGGTCCCTCATCTGTGATGTGG - Intronic
907454746 1:54568079-54568101 CCGGTCCCTGCGCTTCCTTGGGG + Intronic
908021294 1:59901258-59901280 CAGGACCCTTCTCTTTGTCTGGG + Intronic
910283640 1:85529548-85529570 GAATTCCCTGCTCTTGGTTGGGG - Intronic
910493350 1:87797746-87797768 CAGCTACCTGCTCTCTGCTGGGG + Intergenic
910789210 1:91033797-91033819 CAGGTTCCTCCTTTTTATTGTGG + Intergenic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
914206375 1:145533442-145533464 GAATTCCCTGCTCTTGGTTGGGG + Intergenic
915129764 1:153688219-153688241 CAGGTCCCTGGTGTTTGTCATGG + Exonic
915899910 1:159839436-159839458 AAGGGCCCTCCTCTTTGATGGGG + Intronic
916624861 1:166544430-166544452 CAGTCCCCAGCTCTTTATTGTGG + Intergenic
918050242 1:180967290-180967312 CAGCTCTCTGGTCTTTTTTGAGG + Intergenic
918798374 1:188936794-188936816 CAGATCTCTGCTCTTTATAGGGG + Intergenic
921713712 1:218397754-218397776 CAGGTTCCTGCTCATTGCAGTGG - Intronic
923303687 1:232667953-232667975 AAGGTCGCTTCTCTTTGTTCAGG - Intergenic
923801841 1:237217803-237217825 CAAGTCTCTGCTCTTTCTTGGGG - Intronic
924057162 1:240135145-240135167 GAGGTCCCTATTCTTTGGTGAGG - Intronic
924587376 1:245371762-245371784 CAGGTTCCTGGTCTTTCTGGAGG - Intronic
1070067946 10:73056668-73056690 AATATGCCTGCTCTTTGTTGGGG - Intronic
1070367847 10:75753447-75753469 CAGCTCCCTGCTTTTTGAAGAGG - Intronic
1070796744 10:79221376-79221398 CAGCCCCCAGCTCTTTGTTCTGG + Intronic
1071494149 10:86156226-86156248 CAGCTCCCTGCTCTTGTTTGGGG + Intronic
1072036359 10:91566399-91566421 CAGGGCCCAGCTCTATGCTGTGG - Intergenic
1072680478 10:97502473-97502495 CAGGTCCTAGCTCCCTGTTGAGG - Intronic
1074449606 10:113548463-113548485 GAAGTCCCTGCTTTTTCTTGTGG - Intergenic
1074559150 10:114519681-114519703 GGGGTCCCTGCTCTTTGTGATGG + Intronic
1074858267 10:117489535-117489557 CAGTTCCCTCCTCTTTGAAGTGG + Intergenic
1077673917 11:4181187-4181209 CAGGTCCCTGTTATGAGTTGTGG + Intergenic
1077677349 11:4206865-4206887 CAGGTGCCTGTGCTTTGGTGAGG - Intergenic
1081169899 11:39854424-39854446 CAGGTCCCTGGTCTGTGTTATGG + Intergenic
1083294196 11:61706488-61706510 GAGGGCCCTGCTCGTGGTTGGGG + Intronic
1084398154 11:68928218-68928240 CTGTTCCCTGCTGGTTGTTGGGG + Intronic
1085200756 11:74700529-74700551 CATGTCCCGGCACTTAGTTGGGG + Intronic
1085694444 11:78692042-78692064 CAGGTCCCTGCTCTTTGTTGTGG - Intronic
1087943573 11:104130317-104130339 AATGTCCCTGCTCTTCCTTGGGG - Intronic
1088495928 11:110430775-110430797 CAGGTCCCAGGTCTTTGTCAGGG + Intronic
1088612574 11:111591964-111591986 CTGGTCTCTACTCTTTGGTGGGG + Intergenic
1095206799 12:39447407-39447429 CAGGTAGCTGGTCTTTGTGGGGG - Intergenic
1098415253 12:70227336-70227358 CAGGTCCCTGTTGTTTGCTCAGG + Intergenic
1099636297 12:85217441-85217463 CAGGTCCCTGCTCTATCTAAAGG - Intronic
1102918455 12:116773429-116773451 CTGGTCCCTGCCCTTTCTCGAGG - Intronic
1106138146 13:26989958-26989980 GAGGACCCTGCTTTTTGCTGGGG + Intergenic
1107769120 13:43771224-43771246 AAGGTTCCTGCTCTTTCTGGAGG - Intronic
1111216573 13:85151016-85151038 CTGGTCCATGATCTTTGTTTTGG + Intergenic
1111718674 13:91913538-91913560 CAGATCCCAGCTTTTTTTTGAGG - Intronic
1112163932 13:96897494-96897516 CAAGGCCTTGCTCTTTGTTCAGG - Intergenic
1113988687 13:114340974-114340996 CAGGATCCTGCTCTTTCCTGTGG + Intergenic
1114515411 14:23296635-23296657 CAGGTCTCTGCTCGGTGTGGTGG - Exonic
1116968610 14:51041376-51041398 CATTTCCCTGCACTTTGTTCTGG - Intronic
1117815456 14:59593141-59593163 CAGGGCCCTGCTCTCTTTTTCGG - Intergenic
1119830408 14:77697106-77697128 CAGGTCACTGCTCTTCTTTGGGG - Intronic
1121592864 14:95131987-95132009 CATGTCACTGCTCTTTTTTTAGG - Intronic
1122059939 14:99130258-99130280 CTGGGCACTGCTCTTTCTTGGGG - Intergenic
1128127953 15:65206827-65206849 CAGGCCGCTGCTCCCTGTTGAGG + Exonic
1128327592 15:66735154-66735176 CAGGTCCCACCTCTTTTGTGTGG - Intronic
1128331594 15:66759835-66759857 AGGGTCCCTGCCCTCTGTTGGGG + Intronic
1128647906 15:69390491-69390513 GAGGTCCCTGCTCTTTGATTCGG + Intronic
1128881995 15:71252470-71252492 CAGCTCCCTGCTCCTTGTGGTGG + Intronic
1130192244 15:81748543-81748565 CAGGGCCATGCTCTTTTCTGAGG - Intergenic
1130901533 15:88210318-88210340 CAGGTCATTGCTCTCTGTTTTGG - Intronic
1130943906 15:88536331-88536353 CAGTTCCCTGCTCTCTGGTATGG - Exonic
1131137715 15:89951158-89951180 CAGTTCCCTGCTCTCTGGTATGG + Intergenic
1132878449 16:2150437-2150459 GAGGACCCTGCTCTTGGGTGAGG + Intronic
1134739534 16:16530289-16530311 CAGGTCTCTGCTGTTGCTTGTGG - Intergenic
1134927966 16:18181863-18181885 CAGGTCTCTGCTGTTGCTTGTGG + Intergenic
1135489880 16:22900074-22900096 CAGGTCCCTGGCCCTTTTTGAGG + Intronic
1136614966 16:31393131-31393153 CAGGTCCCTGCAGGTTGTGGAGG + Intergenic
1136621197 16:31429536-31429558 AAGGTCCCTGCCCGTTGCTGAGG - Intergenic
1141900643 16:86988251-86988273 TGTGTCCCTGCTCTTTGCTGGGG - Intergenic
1143587883 17:7860162-7860184 AAGACCCCTTCTCTTTGTTGGGG - Exonic
1143883973 17:10052466-10052488 CTGGTCACGGCTCTTTGCTGTGG - Intronic
1144173888 17:12685843-12685865 CAATTCCTTGCTATTTGTTGAGG - Intronic
1144214986 17:13047354-13047376 CAGGGCCCTGGACTCTGTTGTGG + Intergenic
1146312588 17:31780557-31780579 TATGTCCCTGGTCTTTGGTGGGG - Intergenic
1146594823 17:34159245-34159267 CAAGTCCCTGCTCCATGGTGTGG + Intronic
1146904966 17:36612387-36612409 CAGACCCTTCCTCTTTGTTGGGG - Intergenic
1147772420 17:42877209-42877231 CTGTTCCCTGCTGTTTGTAGCGG + Intergenic
1147993523 17:44349436-44349458 CAGATGCCTGCTCAGTGTTGTGG - Exonic
1151824117 17:76514108-76514130 CAGGTCCCTGCCCTGTCATGGGG + Intergenic
1155082311 18:22422974-22422996 CAGGTCCAGGCTCTTTGCTCTGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1155620027 18:27767928-27767950 CAGGTCCCTTTGCTCTGTTGGGG - Intergenic
1156242916 18:35271169-35271191 CAGGTTCCTGCTGCTTGCTGGGG + Intronic
1157500009 18:48183723-48183745 CGGGTCCTTGCTCTTGGTTGAGG + Intronic
1158231359 18:55259245-55259267 CATGTCTCTGCTCTTTGGTAAGG - Intronic
1158319499 18:56247754-56247776 TAGGTCCCAGCTCTTTGTGCTGG - Intergenic
1159938938 18:74390695-74390717 CAGCTCTCTGCTCTCTGCTGTGG - Intergenic
1160727321 19:623089-623111 AAGGTCCCTGCTGTGTGTTCCGG + Intronic
1160732056 19:645788-645810 CAGGCCGCTCCTCTCTGTTGGGG - Intergenic
1161293879 19:3509777-3509799 CAGAGCCCTGCTCTTTGTCGTGG + Intronic
1164430882 19:28187753-28187775 CAGGTCCATGCTTTATTTTGTGG - Intergenic
1165733937 19:38164024-38164046 CAGGTCCCGGATCTGTGTTGAGG + Intronic
1166033195 19:40148269-40148291 CAGCGCCCTGCTCTTTGTGAAGG + Intergenic
926245058 2:11117027-11117049 CAAGTCCCTGCTCTTGTTAGAGG - Intergenic
926751230 2:16200200-16200222 CAGGTCCCAGCTGTTTCTGGTGG + Intergenic
928697210 2:33861451-33861473 CAGGACCCCTCTCTTTGCTGAGG + Intergenic
929960163 2:46490423-46490445 CAGGGCCCTGCTCTCAGTGGGGG - Intergenic
932563417 2:72891267-72891289 CAGGTCCCTGTTTTATGTCGGGG - Intronic
936834328 2:116689113-116689135 CAGGACCCTTCTCTTTGCTGAGG - Intergenic
937319731 2:120953998-120954020 CAGGTCCCTGCTATGTCGTGGGG - Intronic
937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG + Intronic
940850978 2:158688066-158688088 CAACTCCTTTCTCTTTGTTGAGG - Intergenic
941049435 2:160715768-160715790 CAGCTCCCTGCTCATGCTTGAGG + Intergenic
943608140 2:190000449-190000471 CATTTCCTTGCTATTTGTTGGGG + Intronic
945053827 2:205850524-205850546 TAGGGGCCTGCTCTTTGTTGGGG - Intergenic
946378203 2:219327066-219327088 CTGGACCCTGCTGTTTTTTGAGG - Intergenic
947854306 2:233312926-233312948 AAGGTCCCTGCTCTTTGGTTGGG - Intronic
948003967 2:234592179-234592201 CAGGACACTGCTCTTGTTTGAGG + Intergenic
948603540 2:239120796-239120818 CAGGTCCCTTCTCTAGGGTGGGG + Intronic
948865392 2:240772391-240772413 CAGGGCCCTGCTCGTAGATGTGG - Intronic
1169257430 20:4109966-4109988 CAGGACCCCACTCTTTCTTGTGG + Intergenic
1169992302 20:11516964-11516986 CAGTTCTCTCCTCTGTGTTGTGG + Intergenic
1171212685 20:23328774-23328796 CAGCGTCATGCTCTTTGTTGGGG - Intergenic
1172749606 20:37241469-37241491 CAGGTATCTGCTGTGTGTTGGGG - Exonic
1173317461 20:41957977-41957999 CAGGTCCCTGCCCTTTGAGTTGG + Intergenic
1173325989 20:42034278-42034300 CAGTTCCCTGCTGGATGTTGAGG + Intergenic
1173637499 20:44573505-44573527 CATGTCCCTCCTGTTTCTTGGGG + Intronic
1174242872 20:49152280-49152302 CATTTCCCTGCTCTCTGTTGGGG - Intronic
1177009735 21:15717338-15717360 AAGGTGCCTGCACTTTGTAGAGG - Intergenic
1177049985 21:16220985-16221007 CAGGTTCATGTTCTTTTTTGAGG + Intergenic
1179217275 21:39378383-39378405 CAGACTCCTGCTCTTTGTTTTGG + Intergenic
1180897268 22:19345798-19345820 CAGGTTCCTGGGCTTTGTTCTGG - Intronic
1182709416 22:32311233-32311255 CAGGTCCCTGCTCACTGTGCTGG - Intergenic
1183357097 22:37365402-37365424 CAGTTCCCTGGTCTCTGCTGGGG - Intergenic
1184200704 22:42967279-42967301 CTGGTCCCTGCTCTCCTTTGAGG - Intronic
1184617613 22:45648656-45648678 CAGCTCCCTGCACTTTCCTGTGG + Intergenic
950119230 3:10470795-10470817 AAGGTCACTGCTCTGTGCTGGGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950574813 3:13825879-13825901 CCGGTCCCAGCTATTTATTGGGG - Intronic
952919395 3:38274694-38274716 CATGGCCCTGCGCTTTGCTGTGG + Exonic
953398947 3:42595727-42595749 CAGGTCCCTGCTCCTTTTTTTGG + Intronic
959777194 3:110180818-110180840 CCGGTCTCTGCTCTTTGCTGAGG + Intergenic
960888013 3:122416491-122416513 CCGCTCCCTCCTGTTTGTTGTGG + Intergenic
961156650 3:124685274-124685296 CAGCTCCCTTCTCTTGGTGGCGG - Intronic
961452468 3:127008632-127008654 CAGGTCCCTTTCCTTTGCTGTGG + Intronic
962827216 3:139108687-139108709 CTGGTCCCTGCTCACTGCTGTGG - Intronic
964761186 3:160136301-160136323 GGAGTCCTTGCTCTTTGTTGGGG + Intergenic
967466888 3:189817054-189817076 AAGGTCCCTGCTCTGTTTTCAGG - Intronic
968374586 4:28314-28336 CAGGATCCTGCTCTTTCCTGTGG - Intergenic
970146227 4:13038863-13038885 CAGGGACCTGCTTTTTTTTGTGG - Intergenic
972220227 4:36946940-36946962 CAGGTCCACCCTCTTTGCTGTGG - Intergenic
975008732 4:69322601-69322623 CAGTTCCCAGGTCTTTGGTGAGG + Intronic
978367185 4:107994773-107994795 CTGTTCTCTGCTCTTGGTTGAGG + Intronic
979391341 4:120131380-120131402 CAGTTCCCTGCTTCCTGTTGTGG + Intergenic
981424102 4:144583776-144583798 CAGCTCACTGCTCTCTGCTGTGG + Intergenic
982802956 4:159726837-159726859 CAGGTCCAAGCTCTTTGTCATGG - Intergenic
982803115 4:159728964-159728986 CAGGTCCAAGCTCTTTATTATGG - Intergenic
983990550 4:174114203-174114225 CAGCTCCATTCTCTCTGTTGTGG + Intergenic
985776024 5:1842807-1842829 CAGGACCCTCCTGTCTGTTGCGG + Intergenic
985776035 5:1842860-1842882 CAGGACCCTCCTGTCTGTTGCGG + Intergenic
985776048 5:1842918-1842940 CAGGACCCTCCTGTCTGTTGCGG + Intergenic
985776059 5:1842976-1842998 CAGGACCCTCCTGTCTGTTGCGG + Intergenic
985776072 5:1843029-1843051 CAGGACCCTCCTGTCTGTTGCGG + Intergenic
985776085 5:1843082-1843104 CAGGACCCTCCTGTCTGTTGCGG + Intergenic
985776096 5:1843135-1843157 CAGGACCCTCCTGTCTGTTGCGG + Intergenic
985776107 5:1843188-1843210 CAGGACCCTCCTGTCTGTTGCGG + Intergenic
985987285 5:3526866-3526888 CAGTTTCCTGCTCTTTGTAAAGG + Intergenic
986067256 5:4246636-4246658 CAGGTCCATTCATTTTGTTGAGG + Intergenic
988131120 5:27107456-27107478 CATGTCACTGCTATTTTTTGTGG + Intronic
991941977 5:71862165-71862187 CAGGTCCCTGCTCAGTGCTTAGG + Intergenic
992534418 5:77684417-77684439 CAGTCCACTTCTCTTTGTTGAGG + Intergenic
995264334 5:110139945-110139967 CAGGTCCCTTCCCTATGTTAAGG + Intergenic
997735375 5:136209089-136209111 CTGGTCCCTGCTCATTCTAGAGG + Intergenic
999083564 5:148866906-148866928 CAGGCCCCTGCTCTTTGGCATGG - Intergenic
999101070 5:149026752-149026774 CATGTCCCTGCTTTGTGTTCAGG - Exonic
1000681547 5:164191140-164191162 CTGGTCCCTGCTCTCTCTTTAGG + Intergenic
1001926286 5:175639604-175639626 CTGCTCCCTGCCCCTTGTTGGGG - Intergenic
1002437093 5:179238360-179238382 CAGCTCCCTGCTCTGTGGAGCGG + Intronic
1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG + Intronic
1004748101 6:18532824-18532846 GAGGTCCCTGCTTCTTGTTTTGG - Intergenic
1012742258 6:103033074-103033096 CTGGTGCCTGCTCTTTTTGGAGG - Intergenic
1014145080 6:117988155-117988177 CTGTACCCTGCTCTTTGCTGGGG - Intronic
1017949395 6:159123349-159123371 CAGGGCCATCCTCATTGTTGTGG + Intergenic
1018453180 6:163928025-163928047 CATGTCCCTGCTCTTTAATCTGG + Intergenic
1018612459 6:165659868-165659890 CAGGGCCCTGCTGGATGTTGTGG - Intronic
1018716430 6:166536234-166536256 CAGGTCTTTGCTCTTTGGAGCGG + Intronic
1018871742 6:167789458-167789480 CAGGCCCCTGCTCCATGCTGAGG - Intronic
1019493581 7:1326029-1326051 CAGGTCCCTGCTCTTTGGACGGG + Intergenic
1019500169 7:1360720-1360742 CAGCTCTCTGCCCTTTGATGGGG - Intergenic
1028411829 7:90538304-90538326 AAGGTCCCTGCTCTGAGTAGTGG - Intronic
1028725398 7:94081330-94081352 CAGGTCACTGCTGTGTGTTATGG - Intergenic
1029530774 7:101123819-101123841 CAGGTCTCTGCTGTTTTCTGTGG - Intergenic
1030150421 7:106398939-106398961 CAGTTCCTTCCTCTTTGTTATGG + Intergenic
1030305398 7:108013207-108013229 CAGGTGCCAGCTCTGTGTTTAGG - Intergenic
1032162911 7:129524504-129524526 CAGTTCCCTCCTTTTTGTGGGGG + Intergenic
1032508552 7:132454016-132454038 CTTGTCCCTGCTCTCTGGTGTGG + Intronic
1033529645 7:142248944-142248966 CTGCTCCCAGCTCTTTATTGAGG - Intergenic
1034310132 7:150079906-150079928 CAGGTCTCTGATCTGTTTTGGGG + Intergenic
1034796714 7:154020714-154020736 CAGGTCTCTGATCTGTTTTGGGG - Intronic
1036469801 8:9042534-9042556 CAGTTCCCTGTTCTTTGAGGAGG + Intronic
1037768656 8:21786667-21786689 CAAGTCCCTGCTCTAGGGTGTGG - Intronic
1039718227 8:40133956-40133978 CAGGGCCTTGGTCTTTGTTCGGG - Intergenic
1039834776 8:41247807-41247829 CAGCTGCCTGCTCTTTGTCTGGG - Intergenic
1041843757 8:62303040-62303062 TAGTTCCCTGGTCATTGTTGTGG + Intronic
1044555900 8:93561608-93561630 AAGGGCTCTGCTCTTTGTTTTGG - Intergenic
1045049053 8:98306434-98306456 CAGGGCCCTGCTGTGTGCTGTGG + Intergenic
1047710067 8:127542699-127542721 CTGGTGCCAGCTGTTTGTTGGGG - Intergenic
1049039317 8:140100160-140100182 CAGTTCCCTGCTCTAGGCTGCGG - Intronic
1049207228 8:141369263-141369285 CAGTTCCCCGCTGTTTGCTGGGG - Intergenic
1049226838 8:141457327-141457349 TGGGTCCCAGCTCTATGTTGGGG - Intergenic
1049932940 9:473627-473649 CAGGTGCCTGTGGTTTGTTGGGG - Intronic
1053475500 9:38379341-38379363 CAGGGCCCTGCTCCTTTCTGAGG - Intergenic
1055248004 9:74270399-74270421 CAGGTACCTGTGCTTTGTTAAGG + Intergenic
1062630666 9:137461737-137461759 CCGGTCCCTGCCCTTACTTGGGG - Intronic
1062725050 9:138068136-138068158 CCTGTCCCTGGCCTTTGTTGTGG - Intronic
1203574633 Un_KI270744v1:165836-165858 CAGGATCCTGCTCTTTCCTGTGG + Intergenic
1186368323 X:8919278-8919300 CAGGACACTGTTCTTTGTGGGGG - Intergenic
1186485026 X:9927747-9927769 CAGATCCCTGCCCTCTGTAGAGG + Intronic
1186601076 X:11037972-11037994 CAGGTTCCTTGTTTTTGTTGTGG - Intergenic
1187075385 X:15929608-15929630 CAGTCCCCTGCTCTCAGTTGGGG + Intergenic
1188051731 X:25496094-25496116 AAGGTCCATGTTGTTTGTTGAGG + Intergenic
1197867507 X:131034871-131034893 TAGGGCCCTGCACTCTGTTGAGG - Intergenic
1200122590 X:153798146-153798168 CTGGTCCCTCCTCCTTTTTGGGG + Intronic