ID: 1085694737

View in Genome Browser
Species Human (GRCh38)
Location 11:78694534-78694556
Sequence ATTTGAGGTGGTGCCTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085694731_1085694737 -5 Left 1085694731 11:78694516-78694538 CCCACTCTGCCATACTGTATTTG 0: 1
1: 0
2: 2
3: 21
4: 221
Right 1085694737 11:78694534-78694556 ATTTGAGGTGGTGCCTCTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 171
1085694728_1085694737 17 Left 1085694728 11:78694494-78694516 CCTCAGGATTCCCAAGATCTGGC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1085694737 11:78694534-78694556 ATTTGAGGTGGTGCCTCTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 171
1085694730_1085694737 6 Left 1085694730 11:78694505-78694527 CCAAGATCTGGCCCACTCTGCCA 0: 1
1: 0
2: 1
3: 22
4: 174
Right 1085694737 11:78694534-78694556 ATTTGAGGTGGTGCCTCTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 171
1085694732_1085694737 -6 Left 1085694732 11:78694517-78694539 CCACTCTGCCATACTGTATTTGA 0: 1
1: 0
2: 1
3: 17
4: 243
Right 1085694737 11:78694534-78694556 ATTTGAGGTGGTGCCTCTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 171
1085694726_1085694737 18 Left 1085694726 11:78694493-78694515 CCCTCAGGATTCCCAAGATCTGG 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1085694737 11:78694534-78694556 ATTTGAGGTGGTGCCTCTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 171
1085694729_1085694737 7 Left 1085694729 11:78694504-78694526 CCCAAGATCTGGCCCACTCTGCC 0: 1
1: 0
2: 1
3: 22
4: 210
Right 1085694737 11:78694534-78694556 ATTTGAGGTGGTGCCTCTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085694737 Original CRISPR ATTTGAGGTGGTGCCTCTGG TGG Intronic