ID: 1085695954

View in Genome Browser
Species Human (GRCh38)
Location 11:78704960-78704982
Sequence CTGCAGGGACAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 601}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085695954_1085695964 5 Left 1085695954 11:78704960-78704982 CCCAGCTCCCTCTGTCCCTGCAG 0: 1
1: 0
2: 6
3: 74
4: 601
Right 1085695964 11:78704988-78705010 GGGAGCCTGCAAACTCGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1085695954_1085695963 4 Left 1085695954 11:78704960-78704982 CCCAGCTCCCTCTGTCCCTGCAG 0: 1
1: 0
2: 6
3: 74
4: 601
Right 1085695963 11:78704987-78705009 AGGGAGCCTGCAAACTCGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 114
1085695954_1085695966 15 Left 1085695954 11:78704960-78704982 CCCAGCTCCCTCTGTCCCTGCAG 0: 1
1: 0
2: 6
3: 74
4: 601
Right 1085695966 11:78704998-78705020 AAACTCGCCAGGGCCGCTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085695954 Original CRISPR CTGCAGGGACAGAGGGAGCT GGG (reversed) Intronic
900166574 1:1246423-1246445 CGGCAGGGACAGAGCCTGCTGGG + Intronic
900206074 1:1432416-1432438 CTGCAGGGGCAGAGCAGGCTGGG - Intergenic
900367228 1:2316205-2316227 GCGCAGGGGCAGAGAGAGCTGGG + Intergenic
900374400 1:2346911-2346933 CTTCAGGGCTAGTGGGAGCTGGG - Intronic
900703538 1:4062290-4062312 CGGCAGAGACAGCGGGATCTGGG + Intergenic
900749162 1:4383365-4383387 CATCAGGGACAGTGGGAGGTGGG + Intergenic
900799458 1:4728341-4728363 CTCCAGGGAAAAAGGGAGTTTGG - Intronic
900929977 1:5730279-5730301 GAGCAGGGAGAGAGGGAGCAAGG + Intergenic
901028311 1:6291010-6291032 CCACAGAGACAGAGGCAGCTTGG + Intronic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901511820 1:9721421-9721443 CTGCAGGGAAGGAAGGCGCTGGG - Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
901624719 1:10617483-10617505 CCGCAGGTACAGTGGGGGCTGGG - Intronic
902283402 1:15390595-15390617 CCTCAGGGAGGGAGGGAGCTGGG - Intronic
902404768 1:16176585-16176607 ATGCAGGGGCAGTGGGAGCTTGG - Intergenic
903227711 1:21903247-21903269 CTGCAGGGACAGGGGTGTCTTGG - Intronic
903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG + Intergenic
903976213 1:27152056-27152078 GTCCAAGGACAGAGGGAGGTAGG + Intronic
904042640 1:27593341-27593363 CTGCAGGGAGAGAGGGAGAGAGG - Intronic
904132949 1:28288842-28288864 TTGTAGGGACAGAAGGAGCTGGG + Intergenic
904346835 1:29878258-29878280 CTGCAGGGAGAGGGGTATCTAGG + Intergenic
904409989 1:30319556-30319578 CTGTGGGGACATAGGAAGCTGGG - Intergenic
904424684 1:30415770-30415792 CAGCAAGGAAGGAGGGAGCTGGG - Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
904773281 1:32893001-32893023 CTGGAGGGCCAGAGGCAGCTGGG - Intronic
905371592 1:37485387-37485409 GTGCAGAGACAGCGGGGGCTTGG - Intergenic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906104265 1:43282684-43282706 CCTCAGGGACAGAGGTGGCTGGG - Exonic
906243454 1:44256904-44256926 CTGCAGGGACTGAGGCAGCATGG - Intronic
906516358 1:46441071-46441093 CTGCAGGGACAGTGAGGGATGGG - Intergenic
906688084 1:47775354-47775376 CTTCGGGGACAGCGGCAGCTGGG + Exonic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907404737 1:54247006-54247028 CTGCAGGGGCAGGGACAGCTGGG + Intronic
909803687 1:79847830-79847852 CTGCAGGGACGGCTGCAGCTGGG - Intergenic
910194389 1:84625132-84625154 CTGCAGTGAGAAAGGTAGCTCGG - Intergenic
910806522 1:91194001-91194023 CTGCAGTGGCAGATTGAGCTGGG - Intergenic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
913010472 1:114678083-114678105 CTGTCTGGACAGAGAGAGCTAGG + Intronic
913534693 1:119759868-119759890 CTCCAGGGCCAGAGGGGCCTTGG + Exonic
915008644 1:152664213-152664235 CTGCAGGGGAACATGGAGCTGGG - Exonic
915009930 1:152676123-152676145 CTGCAGGGAAACATGGAGCTGGG - Exonic
915011087 1:152686951-152686973 CTGCAGGGGAACATGGAGCTGGG - Exonic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915099005 1:153485190-153485212 CGACAGGGAAAGAGGGAGCAGGG - Intergenic
916047190 1:161008924-161008946 CTGGTGGGAGAGAGGGAGGTGGG - Intronic
916924002 1:169498469-169498491 ATGAAGGGACTGAGAGAGCTGGG + Intergenic
917711175 1:177687126-177687148 ATCCAGGAACAGAGGGAGCCAGG + Intergenic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
918320793 1:183362422-183362444 CTGCAGGGCCAGGGGGCGGTGGG - Intronic
918342909 1:183582014-183582036 CAGCAGGGAACGAGGGGGCTGGG - Intronic
919816662 1:201445129-201445151 CTGCAGGCAGAAAGGGAGGTAGG + Intergenic
920200572 1:204257527-204257549 CTGCAGGGACAGGCGGCGCAGGG + Exonic
920208612 1:204312228-204312250 TTTCAGGGACAGAGTGAGGTTGG - Intronic
920347795 1:205317708-205317730 AGGCAGGTGCAGAGGGAGCTGGG + Intronic
921215849 1:212936218-212936240 CTGCAGGGACTCATGGTGCTCGG - Intergenic
921265962 1:213420831-213420853 CTGCATGTTCAGAGGGAGCGTGG - Intergenic
921525223 1:216209270-216209292 CTACATGGACACAGGGAGCGGGG + Intronic
921800741 1:219399568-219399590 CTGCAGTGTAAGAGGGAGCAGGG + Intergenic
921888520 1:220330416-220330438 CTGGAGGGAGAGAGGGGGCTGGG - Intergenic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
922820120 1:228479020-228479042 CTGCAGGGCCAGAGACAGCATGG - Intergenic
922929458 1:229377474-229377496 CTGCAGGGGAGGCGGGAGCTTGG - Intergenic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
924645133 1:245870497-245870519 ATGCAGGGATAGATGGAGCGAGG - Intronic
1062971689 10:1653603-1653625 CTGCAGGCACAGAAGGCGTTGGG - Intronic
1062971695 10:1653640-1653662 CTGCAGGCACAGAAGGTGTTGGG - Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063940278 10:11121430-11121452 CAGCAAGGACAGAGGGAGAGAGG - Intronic
1064007167 10:11707919-11707941 CTGGAGGGCCAGGGGGACCTGGG + Intergenic
1064689961 10:17906351-17906373 CTTCAGGAACAGAGATAGCTTGG - Intronic
1065282327 10:24152061-24152083 ATGCAGGGAGGGAGGGAGCGGGG - Intronic
1065644062 10:27816173-27816195 GTGCAGGGACAGTGGGAAGTAGG - Intronic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1066451428 10:35533537-35533559 CACCTGGGACAGAGGGAGCTGGG - Intronic
1067809809 10:49417921-49417943 CTCCAGGGGGAGAGGGTGCTGGG - Intergenic
1068120898 10:52781061-52781083 TTGCAGATACACAGGGAGCTGGG + Intergenic
1068677208 10:59780342-59780364 CTGCAGGGTCAGAACAAGCTTGG - Intergenic
1069213474 10:65790815-65790837 CTGCAGGCAAAGAGAGAGCTTGG - Intergenic
1069729339 10:70600907-70600929 CTGCAGAGACAGGGGGCACTTGG + Exonic
1069900165 10:71702370-71702392 CTGAGGGAACGGAGGGAGCTGGG + Intronic
1070360266 10:75681565-75681587 CTTCAGGGACAGAGGTCGCATGG + Intronic
1070396286 10:76013656-76013678 GGGCAGGGACAGAGGGAGGTGGG + Intronic
1070539428 10:77405806-77405828 CTGCAGTGACAAAGGGGGCGGGG + Intronic
1070549870 10:77482646-77482668 CTGCAGGGAGACAGTGAACTGGG - Intronic
1070570440 10:77636903-77636925 CAGCGGGGACGGAGGAAGCTGGG - Intronic
1071113644 10:82191896-82191918 CCGCAGGGCCAGAGGCAGCTAGG - Intronic
1071519441 10:86319905-86319927 CTGCTGTCACCGAGGGAGCTAGG - Intronic
1072798349 10:98374068-98374090 CTTCAGGGGCTGAGGGAGCATGG - Intergenic
1073850605 10:107612978-107613000 CTGCAGGAAGAGGGGTAGCTGGG - Intergenic
1074338161 10:112599223-112599245 CTGCAAGGCCAGAGTGAGGTAGG + Intronic
1074492088 10:113947393-113947415 CAGCAGGTACTGAGGAAGCTGGG - Intergenic
1074867272 10:117552306-117552328 GAGCAGAGCCAGAGGGAGCTTGG - Intergenic
1074927500 10:118088164-118088186 ATGCAAAGTCAGAGGGAGCTGGG - Intergenic
1075672246 10:124270606-124270628 CAGCAGGGAAGGAGGGGGCTGGG - Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076051570 10:127337876-127337898 CTGCAGTGACAGCGGGTGATGGG + Intronic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1076362675 10:129900504-129900526 CTCCAGGGACAGAGGAGGCCTGG + Intronic
1076594623 10:131617911-131617933 GTGCAGGAACACAGGGAGCCTGG + Intergenic
1076675532 10:132145757-132145779 TGGCCTGGACAGAGGGAGCTGGG + Intronic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076995248 11:294533-294555 CTGCAGGGAGAGAGGCAGCCTGG - Intronic
1077113357 11:871718-871740 CTGCAGGGGCGCAGGGACCTGGG + Intronic
1077125502 11:933746-933768 CCCCAGAGACACAGGGAGCTTGG + Intronic
1077183841 11:1227822-1227844 CTCCAGGTCCAGGGGGAGCTGGG + Intronic
1077366688 11:2164098-2164120 GTGCAGGGGCAGTGGGAGCCTGG + Exonic
1077797756 11:5509231-5509253 GGGTAGGGACAGAGGCAGCTGGG + Exonic
1077888954 11:6405194-6405216 CTGCAGGGCCCCAGGCAGCTGGG - Intronic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078618050 11:12883020-12883042 AGGCAGGGACTGAGGGAGCTGGG - Exonic
1079089009 11:17467737-17467759 CTGCAGGGACAGAAGGAAATGGG - Intronic
1079133030 11:17760600-17760622 CAGCAGGTACAGAGGGCCCTAGG - Intronic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1081625313 11:44651952-44651974 CTGCAGGGACCCAGGGAGCCAGG + Intergenic
1082787436 11:57324680-57324702 TTGCAGGGGCCGAGGGCGCTGGG - Intronic
1082997677 11:59266415-59266437 ATGAAGGGCCAGCGGGAGCTGGG - Intergenic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083669773 11:64293115-64293137 CAGCAGGCCCAGAGGGAGCTGGG + Exonic
1083678808 11:64342073-64342095 CTGCAGGGCCAGATGGTGCGAGG - Exonic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1084594033 11:70106576-70106598 CTGCTGGGACAGACAGATCTGGG + Intronic
1084860216 11:72013283-72013305 CTGCGGGCCCAGCGGGAGCTTGG - Exonic
1085095922 11:73760734-73760756 TTGCAGGGGCCGAGAGAGCTCGG - Exonic
1085409300 11:76281981-76282003 CTGCAGGGAGATGGGGAGGTGGG - Intergenic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085743048 11:79093288-79093310 CTGGACTGGCAGAGGGAGCTTGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1087953775 11:104258078-104258100 GTTCAGGGACAGAAGGTGCTTGG + Intergenic
1088231344 11:107676602-107676624 CTGCAGGGACCTAGGGACCAGGG - Intergenic
1089223003 11:116890839-116890861 CTGGTGGGAGAGTGGGAGCTGGG + Intronic
1089620272 11:119718127-119718149 CTGCAGGGTCAGGGTGTGCTGGG + Intronic
1089671883 11:120062426-120062448 CTGCAGTGACAGAGGAGGCCCGG + Intergenic
1090320894 11:125842723-125842745 CTGCAGGAGCAAAGGGAACTTGG - Intergenic
1090903054 11:131049328-131049350 CTCCAGGTACAAAGGAAGCTAGG - Intergenic
1091168505 11:133501062-133501084 CTGCTGGGACAGAGAATGCTGGG + Intronic
1091284679 11:134402034-134402056 AAGCAGGAACAGAGGGAGCCAGG - Intronic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1091782965 12:3225419-3225441 CTGCAGAGACTGAAGGCGCTTGG + Intronic
1091801628 12:3328201-3328223 CTGCAGGTAGAGCAGGAGCTGGG - Intergenic
1091896899 12:4112486-4112508 CTGCTTTGACAGAGGGAGCCAGG - Intergenic
1092057303 12:5518748-5518770 CTGCAGGGAGAGAAAGAGCTGGG + Intronic
1092193801 12:6537286-6537308 CTGCAAAGAAAGAGGGAGCGGGG - Intronic
1092336445 12:7638404-7638426 GTACAGGGACAGAGGGAGGGGGG - Intergenic
1092993341 12:13924525-13924547 CAGCAGGGATAGAGGGAGCTGGG + Intronic
1093707221 12:22287993-22288015 CTTCAGACACTGAGGGAGCTGGG - Intronic
1094071066 12:26413201-26413223 CTGCAGGACCAGAGGAATCTGGG - Intronic
1094107928 12:26833202-26833224 CTGAGGGGACCGAGGGGGCTCGG - Intergenic
1096749872 12:53751875-53751897 CCGCAAGGAGAGAGGGAGCGGGG - Intergenic
1096981049 12:55728499-55728521 CTGCGGGTAAAGAGGGGGCTGGG - Intronic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1097360702 12:58655644-58655666 CTGCAGGCACTGGGGAAGCTTGG + Intronic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1100471250 12:94895214-94895236 CAGAAGGGAGAGAGGGAGCAAGG - Intergenic
1100516578 12:95333981-95334003 CTGCAGGGACAGAAAGATATGGG + Intergenic
1100650269 12:96579712-96579734 CTACAGAGAAAAAGGGAGCTAGG - Intronic
1101946726 12:109143000-109143022 CAGGAGGGACAGAGGGATCTTGG + Intronic
1102344697 12:112152119-112152141 CTTCAGGGAGATACGGAGCTAGG + Exonic
1102459966 12:113094015-113094037 CTGCAGGGACACAGCGGGGTGGG - Intronic
1102658335 12:114502639-114502661 GTGCAGTGGCAGAGGGAGATTGG + Intergenic
1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG + Intronic
1103852463 12:123942121-123942143 CAGCAGGCACAGAGGGCCCTGGG + Intronic
1103974475 12:124693458-124693480 CGGCAGATACATAGGGAGCTAGG + Intergenic
1104056461 12:125234562-125234584 CTGAAGGGACCGAGGGGGGTTGG - Intronic
1104373476 12:128244189-128244211 CAGCAAGGAGAGAGGGACCTCGG - Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104745141 12:131205733-131205755 CTGCAATGTCAGAGGGACCTGGG - Intergenic
1104845561 12:131845095-131845117 CTGCAGGGAGAGAGCCAGGTGGG - Intronic
1107336733 13:39363365-39363387 CTTTAGAGACAGAGGGACCTAGG + Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107878060 13:44807915-44807937 ATCTGGGGACAGAGGGAGCTGGG - Intergenic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113081908 13:106529152-106529174 ATGCAGCGGGAGAGGGAGCTGGG + Intronic
1113308750 13:109108783-109108805 CTGAAGGGTGAGAAGGAGCTGGG + Intronic
1113636467 13:111922276-111922298 CCCCAGGGACACAGAGAGCTCGG + Intergenic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1114613956 14:24058657-24058679 CTGCAGGGACAAGGTGAGGTAGG - Intronic
1114649773 14:24277129-24277151 ATGCAGGGACGAAGGGAACTGGG + Intergenic
1118720385 14:68589765-68589787 CTGCTGGGACAGAGGAAGAGAGG - Intronic
1118796563 14:69151086-69151108 CAGCAGGGAAACTGGGAGCTAGG + Intronic
1121635819 14:95453261-95453283 CTCCTGGGATTGAGGGAGCTGGG - Intronic
1121698555 14:95933270-95933292 CAGCAGGGAGACAGGGAGCTGGG - Intergenic
1122577217 14:102750039-102750061 CTGCAGGGACCGAGGCCGCGGGG - Intergenic
1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG + Intergenic
1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG + Intronic
1122881666 14:104693104-104693126 TTGCAGGGTCAGAGGGACATGGG + Intronic
1122905172 14:104798256-104798278 CTGGCGGGACAGAGAGAGCCTGG - Intergenic
1123100136 14:105792046-105792068 CTGCAGGAACAGAGGCTCCTTGG - Intergenic
1124012504 15:25850266-25850288 AGGCAGGGAGAGAGCGAGCTGGG - Intronic
1124373762 15:29117607-29117629 CTGCAGGGACACGGGCAGCCTGG + Exonic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1126845384 15:52755248-52755270 CTCCAGGGATGGAGGGAGCCGGG - Intergenic
1127628386 15:60802467-60802489 CTGCAGGGGAAGAGAGAGATGGG - Intronic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128347020 15:66860793-66860815 CAACAGGGACAGAGAGAGCGAGG + Intergenic
1128437409 15:67667482-67667504 CTGCAGGGGCTGGGGGAGCCTGG + Intronic
1128741807 15:70088978-70089000 CTGCAAGGGCAGAGGGGCCTTGG + Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129519741 15:76178142-76178164 CTGCTGGGACAGAGGAAGCCTGG + Intronic
1129675179 15:77629429-77629451 CTGCAGAGACACAGAGAGCAGGG - Intronic
1129769209 15:78192934-78192956 ATGCAGGGACAGAGCCAGTTAGG + Intronic
1130084074 15:80762661-80762683 CAGCAGGCAAAGAGAGAGCTTGG + Intergenic
1130270711 15:82445530-82445552 CAGCAGGGAGAGGCGGAGCTGGG + Intergenic
1130651321 15:85763690-85763712 CTCCAGGGACAGGGGCAGTTGGG + Intronic
1130926662 15:88390703-88390725 CTGCAGGGACAAAGAGAAGTGGG - Intergenic
1130955708 15:88626067-88626089 CTGCAGGGAGGGAGGGAGGGTGG + Intronic
1130990835 15:88874772-88874794 GTGCAGGGACAGGGGGAGAAGGG + Exonic
1131261664 15:90890977-90890999 CTGCAGCGGTGGAGGGAGCTGGG - Exonic
1132086194 15:98910201-98910223 TTGCAGGGATAGAGTGAGCAGGG - Intronic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1132866278 16:2094151-2094173 CTGCAGAGGCTGGGGGAGCTGGG - Exonic
1133287501 16:4697428-4697450 GTGCAGGGACCGAGTTAGCTGGG + Intronic
1133456962 16:5950852-5950874 GTGCCAGGAGAGAGGGAGCTAGG + Intergenic
1133881895 16:9790088-9790110 CTGCAGGGAAGGAGGGTGCCTGG + Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135345455 16:21685128-21685150 CTGCAGGGAATGAGGGGGCCGGG + Intronic
1136036485 16:27544440-27544462 GAGCAGGGGTAGAGGGAGCTGGG + Intronic
1136170485 16:28486448-28486470 CCTCAGGGACTGGGGGAGCTGGG - Exonic
1136394631 16:29986394-29986416 CTGCAGCACCAGACGGAGCTGGG + Exonic
1138550660 16:57746371-57746393 CTGCAGAGACAGAGAGAGAGAGG - Intronic
1138556880 16:57775944-57775966 CTCAAGGGGAAGAGGGAGCTGGG + Intronic
1138595194 16:58025966-58025988 GGGCATGGACAGAGGGAGCTGGG + Exonic
1139480816 16:67229719-67229741 CTGCAGGGACAGAGCAGGGTTGG + Intronic
1139700411 16:68704582-68704604 CTGCAGGGAGGGAGGGAGAGAGG + Intronic
1140716900 16:77734826-77734848 AAGCAGGGACAGAGGGAGAGGGG + Intronic
1141145877 16:81529662-81529684 TACCAGGGACAGAGGGAGGTGGG + Intronic
1141308365 16:82888465-82888487 CAGCAGGGACAGAGAGCACTGGG - Intronic
1141479374 16:84296108-84296130 CCGCAGGGACGGAGTGAGCCAGG + Intronic
1141989988 16:87603859-87603881 CAGCAAGGGCAGAGGGGGCTGGG + Intronic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1142266492 16:89066370-89066392 CTGCAGGGAGAGGGAGAGCCGGG + Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142330144 16:89446895-89446917 CTGCAGGGACAGAGGGTGTGTGG - Intronic
1142967400 17:3590173-3590195 GGGCAGAGACAGAGGGAGTTTGG - Intronic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143315069 17:6026351-6026373 CATCAGGGAATGAGGGAGCTCGG - Intronic
1143375372 17:6464035-6464057 CTGCATGGACAGAGGTGGATGGG - Intronic
1143670537 17:8393042-8393064 CAGCAGGTCCAGGGGGAGCTGGG + Exonic
1144191876 17:12853941-12853963 CTGCGGGAACAGAATGAGCTGGG - Intronic
1144215953 17:13055747-13055769 CTCTAGGGTTAGAGGGAGCTTGG + Intergenic
1145007378 17:19345193-19345215 CTGCAGGAACTGAGGTAGATGGG + Intronic
1145209787 17:21004500-21004522 CTGCAGGAACTAAGGGAGCCTGG + Intronic
1145785531 17:27591445-27591467 ATGCAGGGGCAGAGTGGGCTGGG - Intronic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1146918418 17:36693024-36693046 CTGCAGGGTCATAAAGAGCTTGG + Intergenic
1146943978 17:36861858-36861880 CTGCAGGCAGACTGGGAGCTGGG + Intergenic
1147905210 17:43818111-43818133 CTGCAGGGACACAAGGGGATGGG + Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148192068 17:45686242-45686264 ATGCAGGGACAGTGGCAGCCAGG - Intergenic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148675361 17:49441755-49441777 CTGCAGGGAGGGAGGGAGAGGGG - Intronic
1148820734 17:50358184-50358206 CTGTAGAGAGAGAGGCAGCTGGG - Intronic
1148872207 17:50665155-50665177 CAGCCAGGACAGAGGGACCTAGG - Exonic
1148887872 17:50786677-50786699 CAGCGGGAGCAGAGGGAGCTGGG + Intergenic
1150455742 17:65305166-65305188 CTGCAGGGAAGGAGGGTGGTGGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151341557 17:73474494-73474516 CTGCAGAGCCAGAGCGAACTTGG - Intronic
1151360326 17:73584785-73584807 CTGCAGGGACACAGGCAGAAGGG - Intronic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1151786812 17:76279145-76279167 GGGCAGGGACAGAGGGAGAAGGG + Intronic
1151878197 17:76879203-76879225 AGGCAGGGGCAGAGGAAGCTTGG + Intronic
1152239062 17:79152185-79152207 CTGCAGGGACAGAGCCCTCTGGG - Intronic
1152254217 17:79228014-79228036 CTGCAGGGTCAGAAGGACCCAGG + Intronic
1152400903 17:80065610-80065632 CTGCAGGGCCACAGGCAGCGAGG + Intronic
1152663208 17:81552474-81552496 CTGCAGGGACTCCGGGAGCTGGG + Intronic
1152665267 17:81564913-81564935 CTGCAGGGACTCAGGGCACTCGG + Intronic
1153227649 18:2910420-2910442 CTGATGGGACACAGGGAACTCGG - Intronic
1153285047 18:3449558-3449580 CAGCAGCGACAGTGGGAGGTCGG - Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154218240 18:12431434-12431456 CTGCAGGGAGAGAAGGGGCTGGG - Exonic
1156447600 18:37248948-37248970 CTGCAGGGAGGGAGGGAGGGAGG + Intronic
1156507636 18:37608509-37608531 CTTCAGAGGCTGAGGGAGCTGGG + Intergenic
1157413590 18:47484081-47484103 CTGCAGGGACAGAGGGCTCCTGG + Intergenic
1157955185 18:52089121-52089143 AGGTAAGGACAGAGGGAGCTAGG - Intergenic
1158092181 18:53727392-53727414 CTGCAGGGACAGAGGCCTCGTGG - Intergenic
1158964699 18:62612153-62612175 CTGCAGGAACGGAGGCAGCCAGG - Intergenic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1160137649 18:76286156-76286178 CTGCAGGGACAGAGAGCGACTGG + Intergenic
1160406755 18:78651693-78651715 CTGCAGGGCCAGAGGGTGTGTGG + Intergenic
1160406770 18:78651748-78651770 CTGCAGGGCCAGAGGGTGTGTGG + Intergenic
1160887559 19:1357945-1357967 CCGCAGGGAAAGTGTGAGCTAGG - Intronic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1161217372 19:3101145-3101167 CTGCAGGGACGGAGTGGGGTGGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161663797 19:5562986-5563008 CTGCAGGAAGAGAGGGAGTTGGG + Intergenic
1161793923 19:6375799-6375821 CTGCAGGGACAGGAGCAGCAGGG + Exonic
1161841258 19:6682063-6682085 CTGCAGGGAGAGAGGGGTCCAGG - Intronic
1161861540 19:6801761-6801783 GTGCAGGGACAGAGGCCTCTGGG - Intronic
1162127447 19:8507042-8507064 CTGCAGGGAGAGGAGGGGCTTGG - Intergenic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162736062 19:12747760-12747782 CTCCAGGGTCACAGGGACCTAGG - Intronic
1163238043 19:16040857-16040879 CTCCAGGGACTGAGGGAGGGAGG + Intergenic
1163469621 19:17488825-17488847 CTGCAGGGGGAGGGGGAGCCGGG - Intronic
1163649985 19:18511672-18511694 CAGCACTGTCAGAGGGAGCTGGG - Intronic
1163751668 19:19081812-19081834 CTCCAGGGACAGAGGTCACTCGG - Intronic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1164513109 19:28913207-28913229 GTGCAGTGACAGTGGCAGCTGGG + Intergenic
1165103009 19:33450043-33450065 CTGCGGAGACAGAGGCAGCTTGG - Intronic
1165247122 19:34504229-34504251 CTGCAGAGAGAGAGGGAGAGAGG + Exonic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1165904892 19:39187696-39187718 CAGCAGGTGCAGTGGGAGCTAGG + Intergenic
1166079448 19:40434389-40434411 CTGCAGGGAAAGGGGGAGGGCGG + Intergenic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166299261 19:41904926-41904948 CTGCAGGGAGAGGGGGAGATGGG - Intronic
1166504219 19:43361440-43361462 CTCCTGGGACAGGGGCAGCTGGG - Exonic
1166506240 19:43373318-43373340 CTCCTGGGACAGGGGCAGCTGGG + Intergenic
1166523972 19:43499437-43499459 CTCCTGGGACAGAGGGAGAAGGG + Intronic
1166824736 19:45601761-45601783 AGGCAGGGGCAGAGGGAGGTGGG + Intronic
1167018433 19:46856934-46856956 CTAAAGGGACTGTGGGAGCTTGG + Intergenic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
1167197762 19:48042483-48042505 CTCCAGGGATAAAGGGAGATGGG - Intronic
1167213768 19:48150283-48150305 CTGCAGGGTCAGAATGATCTTGG - Intronic
1167669009 19:50839032-50839054 CTCCTGGGTCTGAGGGAGCTGGG + Intergenic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
1168214164 19:54912971-54912993 CTGCAGGGAAAGAGGGACACTGG + Exonic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
925846917 2:8043039-8043061 CTGCAGGGACAGAGGGGCCATGG + Intergenic
925899744 2:8500276-8500298 GGGCTGGGACAGAGGGTGCTGGG - Intergenic
926131099 2:10303551-10303573 CAGCAGGGACAGGGGGCTCTGGG - Intronic
927927288 2:27022896-27022918 CTGCAGGGAAAGGAGGAGCGGGG + Intronic
928165444 2:28968407-28968429 GGGCAGGGAGAGAGGGAGCGAGG - Intronic
928326230 2:30321857-30321879 CTCCAGGGACAGAGGTATCCGGG - Intronic
929107793 2:38380948-38380970 TTGTAGGGACAGAGGGAAATCGG + Intergenic
929588679 2:43131637-43131659 CAGCAGGGACTGAGGGAGAAGGG - Intergenic
929631388 2:43466333-43466355 CTGTAGGGGCAAAGGGAGCCAGG - Intronic
929689818 2:44064897-44064919 CTTGAGGGAAAGAGGGAACTGGG - Intergenic
930002232 2:46869222-46869244 CAGGAGGCACACAGGGAGCTTGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930542909 2:52730025-52730047 CTTCAAGGAGAAAGGGAGCTAGG + Intergenic
930988498 2:57620301-57620323 CCGAAGGGACAGAGGGGGCCTGG - Intergenic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
932445687 2:71779670-71779692 TTGCAGGGACAGACTGAGGTGGG - Intergenic
932880075 2:75493162-75493184 CTGCAGGGACAGTGGGCACAAGG - Exonic
933687876 2:85157787-85157809 CTGCAAGGACCAGGGGAGCTGGG + Intronic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934856362 2:97732744-97732766 CTGCAGGGACTGGGGAAGCCAGG - Intronic
935666301 2:105516016-105516038 CAGCAGGGAGATAGGGAGCAAGG - Intergenic
936008582 2:108910533-108910555 CTGCAGGGAAATGGGGAGGTTGG + Intronic
937241846 2:120466875-120466897 CTGGAGGGACAGGCAGAGCTGGG + Intergenic
937309512 2:120893399-120893421 CAGCAGGGCCAGCGGGGGCTGGG - Intronic
937338729 2:121077486-121077508 CGGCAGGGGCAGAAGCAGCTGGG - Intergenic
937341712 2:121095579-121095601 CAGCAGGGACAGTGGGATGTGGG + Intergenic
937441474 2:121919607-121919629 CTGCAGGGGCAGAGAGGCCTTGG + Intergenic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
937913931 2:127089739-127089761 CTGCTGGGGCAGAAGGTGCTGGG + Intronic
937984995 2:127634413-127634435 CTGCTGGGACAGAGGTAGGTGGG + Intronic
938109967 2:128557304-128557326 CTGCAGGGCCGGTGAGAGCTGGG + Intergenic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
938694556 2:133823453-133823475 CTTCAGTGACACATGGAGCTGGG - Intergenic
938902055 2:135806882-135806904 TTGCAGGGCCAGATGGAGCAGGG - Intronic
940786759 2:157989569-157989591 CTGAAGGGACCTAGGGAGCCTGG + Intronic
941881236 2:170482454-170482476 CGGCAGGCAAAGAGAGAGCTTGG - Intronic
942509106 2:176677024-176677046 GTTCAGAGACAGAGGGAGCGGGG + Intergenic
942547983 2:177084335-177084357 CTGCAGAGAGGGAAGGAGCTGGG + Intergenic
943142953 2:184005718-184005740 TTCCATGGACAGAGGGAGTTAGG + Intergenic
945172852 2:207014923-207014945 CTTCAGGGACAGGTGGACCTAGG - Intergenic
945395250 2:209307889-209307911 CTGCAGAGCCAGCAGGAGCTGGG - Intergenic
946078630 2:217097183-217097205 CTGCAGTGATTGAGGGAGTTTGG + Intergenic
946157006 2:217813596-217813618 CTGGAGGGACCCAGGGTGCTGGG - Intronic
946404412 2:219484759-219484781 CGGCGGGGACGGAGAGAGCTCGG + Exonic
948848004 2:240692189-240692211 CTGCAGGGACACAGTGGGGTTGG - Exonic
948858924 2:240743545-240743567 CTGCGTGGACTGAGGGAGCTAGG + Intronic
949041507 2:241851967-241851989 CTGCAGGGACAATAGGAGCCAGG - Exonic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169159160 20:3361474-3361496 TTGCAGGGAAAGTGGGAGGTGGG + Intronic
1169193302 20:3670926-3670948 CTGCTGGGGCTGTGGGAGCTGGG - Intronic
1170678636 20:18505004-18505026 CCTCAGGGACAGAGAGATCTGGG + Intergenic
1170833485 20:19863492-19863514 CTGAAGGGGGTGAGGGAGCTGGG - Intergenic
1171245754 20:23608465-23608487 CTGGAGGGTCTGCGGGAGCTGGG - Intergenic
1171499159 20:25579707-25579729 ATCCATGGAGAGAGGGAGCTTGG - Intronic
1172428394 20:34871778-34871800 GTGCAGGGACAGAGGGATGGGGG + Intronic
1172588739 20:36102956-36102978 AGGGAGGAACAGAGGGAGCTAGG - Intronic
1172934456 20:38609745-38609767 CTCCAGGGCAAGAGGGAGCCTGG + Intronic
1173176850 20:40771250-40771272 CTGCAGGGACAGGAGGCACTTGG - Intergenic
1173252247 20:41370177-41370199 TTGCAGTGAAAGAGGGAGCATGG - Intergenic
1173838544 20:46141134-46141156 ATGGAGGGTCAGAGAGAGCTGGG + Intergenic
1173923222 20:46761601-46761623 CTGTCGGGAAGGAGGGAGCTGGG - Intergenic
1174402319 20:50282713-50282735 CAGCAGGGACAGAGACAGGTGGG - Intergenic
1174416088 20:50368182-50368204 CAGCAGGGAGAGCGGGGGCTTGG - Intergenic
1174740362 20:53007270-53007292 GTGCATGGACAGAGGAAGGTTGG + Intronic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175195063 20:57237361-57237383 CTCCAGGGAAAGAGCGAGCCAGG - Intronic
1175256571 20:57651251-57651273 CTGCAGGGACAGTGGCCCCTCGG + Exonic
1175440796 20:58989827-58989849 TTGCAGGGAGAGAGGGGGCAGGG - Intronic
1175705095 20:61170952-61170974 CTGGATGGGCAGAGGCAGCTGGG - Intergenic
1175717692 20:61266327-61266349 CTCCAGAGACAAAGAGAGCTAGG - Intronic
1175909157 20:62396442-62396464 CTGCGGGGCCAGAGGGTCCTGGG - Intronic
1176024484 20:62978767-62978789 CTGCGGGAACAGAGGACGCTTGG - Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176379313 21:6103916-6103938 CAGCAGGGACAGTCGGAGCAGGG + Intergenic
1176839639 21:13828070-13828092 GGGCAGGGACAGTGGGTGCTGGG + Intergenic
1177275418 21:18906660-18906682 CTGCAGGGGGAGAGGGAGAGTGG + Intergenic
1178663084 21:34522946-34522968 CGGCAGGGAGAGGGGTAGCTGGG - Intronic
1178749118 21:35283865-35283887 GTGCATGGACAGAGGGAGAGAGG - Intronic
1179026443 21:37682842-37682864 CTGCAGGGACAGATGGCCCAGGG - Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1179744160 21:43434321-43434343 CAGCAGGGACAGTCGGAGCAGGG - Intergenic
1179988150 21:44932462-44932484 CTGCGGGGCCAGAGTGGGCTGGG + Intergenic
1180080800 21:45486804-45486826 TTGCAGGGCCAGCGGGGGCTGGG + Intronic
1180581972 22:16846179-16846201 CCACAGGGACAGGGGGAGCTTGG - Intergenic
1180673861 22:17573647-17573669 CTGCAGGGAAGGAGAGAGATGGG - Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181307290 22:21923986-21924008 GGGCAGAGAAAGAGGGAGCTCGG - Intronic
1181318198 22:21984847-21984869 CTGGAGGGAGAGGAGGAGCTCGG - Intergenic
1181453464 22:23039008-23039030 CAGCAGGCACTGAGGGAGCCTGG - Intergenic
1181614094 22:24040154-24040176 CTGGAGGGACAGAGGTAGCTGGG + Intronic
1181886109 22:26023584-26023606 CAGCAGTGGCAGTGGGAGCTAGG + Intronic
1182103600 22:27673843-27673865 CTGAAGGGACAGAGGGACCTGGG - Intergenic
1182282718 22:29226467-29226489 CTGCGGGGAGGGAGGAAGCTGGG - Intronic
1182444107 22:30380289-30380311 CGGCAGAGCCAGCGGGAGCTCGG - Exonic
1183122155 22:35738350-35738372 CAGCAGGGACAGAGGAGGCAAGG + Intergenic
1183164773 22:36139460-36139482 TTCCAGGGACTCAGGGAGCTAGG - Intergenic
1183461141 22:37951416-37951438 CTTCCTGGACAGAGGGATCTGGG - Intronic
1183989629 22:41589427-41589449 CTCCGGGGAGGGAGGGAGCTAGG + Intronic
1184130593 22:42514550-42514572 CAGCAGGGAAACAGGGAGCCTGG + Intronic
1184140772 22:42576380-42576402 CAGCAGGGAAACAGGGAGCCTGG + Intergenic
1184152840 22:42648655-42648677 TTGCAGGGTCAGTGGGAGCCTGG + Intronic
1184942785 22:47781314-47781336 CACCAGGGACAGGGAGAGCTCGG - Intergenic
1184986553 22:48140047-48140069 CTCTAGGGCCAGAGGTAGCTGGG - Intergenic
1185174919 22:49321079-49321101 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174934 22:49321135-49321157 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174949 22:49321191-49321213 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185298042 22:50063866-50063888 CTGCAGGGGGAGGGGGTGCTGGG - Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950341616 3:12251126-12251148 CTAGGGGGAGAGAGGGAGCTAGG + Intergenic
951848524 3:27112020-27112042 CTTCTGGGAAAAAGGGAGCTAGG - Intronic
951848708 3:27114182-27114204 CTTCCGGGAAAAAGGGAGCTAGG - Intronic
952004395 3:28825781-28825803 CTGACGGGAAAGAGGGAGTTAGG - Intergenic
954085378 3:48240099-48240121 ATACAGAGACAGAGGGAGCGGGG + Intergenic
954135115 3:48578882-48578904 ATGCTGGGACAGAGGGGGCTCGG - Intronic
954144853 3:48629451-48629473 ATGAAGGGACAGAGGGAGAGTGG - Intronic
954364401 3:50138561-50138583 CTGCAGGGAGGCAGGGAGCTGGG - Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954712668 3:52512805-52512827 CTGCACGCACACAGGGAGCAGGG - Intronic
954798618 3:53174403-53174425 CTGCAGGGCCAGGGGGTGCCGGG - Intronic
955200871 3:56851128-56851150 CTGCAGGCACAGAGGAAGTGAGG - Intronic
955228517 3:57079582-57079604 CTGGCGGGACAGTGGGAGCGAGG - Intergenic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
955407337 3:58633732-58633754 GGACAGGAACAGAGGGAGCTAGG - Intergenic
956323056 3:68020286-68020308 CTGCAGGGACAGGGGAAACTTGG + Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956718385 3:72098156-72098178 CTGAAGGGACAAGGGGAGCAGGG + Intergenic
956890081 3:73604732-73604754 CTGGAGAGAAAGAGGGAGATAGG + Intronic
957752811 3:84444484-84444506 CTGCAGTGACTCAGGGACCTAGG - Intergenic
959336397 3:105070581-105070603 ATGGAGGGACAGAGGGAAGTGGG + Intergenic
960635738 3:119782647-119782669 CTCCAAGGACTGTGGGAGCTGGG + Intronic
961159421 3:124710322-124710344 TGGCAGGGACAGAGGGAGGAAGG + Intronic
961203315 3:125061498-125061520 CTGAAGGGGGAGAGTGAGCTGGG + Intergenic
961602525 3:128072580-128072602 CAGCAGGTGCAGAGGGAGCGCGG - Intronic
961822673 3:129583079-129583101 CTCCAGGGGCAGAGGGACTTGGG + Intronic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
963106116 3:141648666-141648688 CTGCAGGGAGGCTGGGAGCTTGG + Intergenic
964077537 3:152709831-152709853 CAGCAGGGAAAGGTGGAGCTGGG - Intergenic
964223650 3:154372355-154372377 CGGAAGGGAGAGAGGGAGCGAGG - Intronic
965519893 3:169661722-169661744 CTGCAGGGACGCAGTGAGCAAGG + Intronic
967189642 3:186974302-186974324 CTGCAGGAACCGACTGAGCTTGG + Intronic
967776960 3:193395018-193395040 CTGCAAAGCCACAGGGAGCTTGG - Intergenic
968455372 4:695763-695785 CTCCAGGGACAGAGGTAGGTGGG + Intergenic
968628180 4:1637417-1637439 CTCGAGGGACAGAGGGAGCCTGG + Intronic
969230447 4:5826781-5826803 CTGCAGAGAAGGAGGGAGCCAGG - Intronic
969276698 4:6140535-6140557 CTGCAGGGTCAGAGGGAAGTCGG + Intronic
969448143 4:7257135-7257157 CTCCAGGGCCCGAGGGAGCCCGG - Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969581996 4:8071146-8071168 CTGCCCCCACAGAGGGAGCTGGG - Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
970155560 4:13138157-13138179 CTTCAAGGACAGAGAGATCTGGG + Intergenic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
971455061 4:26836415-26836437 TTGGAGGGGCAGAGGGAGGTGGG + Intergenic
974110070 4:57514986-57515008 CTGCAGCAATACAGGGAGCTGGG - Intergenic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976515822 4:85965227-85965249 CAGCAGGCAAAGAGAGAGCTTGG + Intronic
976619605 4:87114715-87114737 CTGCAGGGGGAAAGGGAGCCAGG + Exonic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
980480076 4:133376832-133376854 GTACAGGGACAGAGGGAGGGGGG + Intergenic
981118651 4:141021821-141021843 CTTCAGGGACAGAGGGGCTTTGG - Intronic
981660251 4:147158264-147158286 CTTCAGGGAGAGAGGGAACGCGG - Intergenic
981980383 4:150784674-150784696 GTACAGAGACAGAGGGAGCGGGG - Intronic
982957580 4:161791924-161791946 CCGCAGAGCCAGTGGGAGCTGGG + Intronic
983459155 4:168005684-168005706 TTGCAGGAACACAGGGAACTTGG - Intergenic
983510821 4:168607948-168607970 CTGCAGGAACAGAGTAAGATTGG - Intronic
984805312 4:183746530-183746552 CTGCAGGGCGGGAGCGAGCTCGG + Intergenic
985102418 4:186471589-186471611 CAGCAGGGCCAGAGGAATCTGGG - Intronic
986210164 5:5664568-5664590 CTGCCGGGACAGAGGCAGCCTGG - Intergenic
986215733 5:5717165-5717187 CTGCAGGAACACAGGAACCTGGG - Intergenic
986299639 5:6467797-6467819 CTGCAGGAACAAAGGGGGATGGG - Intronic
986667663 5:10117378-10117400 CAGCAGGGACACAGGGAGCTCGG - Intergenic
986759645 5:10868418-10868440 CCGCAGGGACAGAAAGAGGTGGG - Intergenic
988335898 5:29909006-29909028 CAGCAGGTAAAGAGAGAGCTTGG + Intergenic
988529932 5:32018415-32018437 GTTCAGGGACAGAGGGAGTGAGG + Intronic
990010628 5:50993530-50993552 CTGCAGGGACAAAGGTAGGAGGG + Intergenic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
990147273 5:52776202-52776224 GTGTAGGGTTAGAGGGAGCTAGG - Intergenic
991159268 5:63477761-63477783 CTGGAGGGACAGAATGAGTTTGG + Intergenic
991543195 5:67752254-67752276 CTGCAGGGAGAGAGTGAGACTGG + Intergenic
993527308 5:88981639-88981661 CAAGAGGGACAGAGTGAGCTAGG - Intergenic
994083390 5:95731836-95731858 CTGCACGGACAGAGGGGGCGAGG - Intronic
994300619 5:98142702-98142724 CAGCTGGGACAGAGTGAGCATGG - Intergenic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
995738568 5:115329789-115329811 GTACAGAGACAGAGGGAGCGGGG - Intergenic
996310283 5:122096606-122096628 CTGCAGAGACAGAGGGATGGGGG - Intergenic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998260932 5:140631568-140631590 CTGCGGGGATAGAAGGAGCCAGG - Intergenic
998345097 5:141455397-141455419 TTACAGAGACAGAGGGAGCGGGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999731940 5:154481727-154481749 CTGCAGGGGCAGTGTGGGCTAGG - Intergenic
1000210940 5:159105451-159105473 CCGCAGGGACAGAGCGCGCCAGG + Intergenic
1000300010 5:159947935-159947957 ATCCAGGGACAGCTGGAGCTTGG - Intronic
1001246687 5:170110150-170110172 CTGCAGGGTCAGACAGATCTAGG - Intergenic
1001255985 5:170183913-170183935 CTTCAGGGAGTGAGGGAGCCTGG - Intergenic
1001995710 5:176156013-176156035 CAGCAGGGACAGAGGAAGGGCGG - Intergenic
1002503664 5:179664344-179664366 TGGCAGGGGCAGTGGGAGCTGGG - Intergenic
1002523686 5:179804649-179804671 CTGCAGGGAAGGAAGGAGGTGGG - Intronic
1002565716 5:180112201-180112223 CTGCAGGGGCCCAGGGAACTGGG - Intronic
1002900697 6:1407528-1407550 CAACAGTGACAGAGGCAGCTTGG - Intergenic
1002915298 6:1524011-1524033 ATGCAGGGAAAGCGGGAGCGCGG + Intergenic
1003071554 6:2949151-2949173 CTGCAGGGAGAAACGCAGCTCGG + Intronic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1005048789 6:21665606-21665628 CTGTAGGGTCAGAGGGCGCCTGG + Intergenic
1006034717 6:31202447-31202469 CAGCCGGGTCAGAGTGAGCTTGG - Exonic
1006271948 6:32971861-32971883 CTCCAGGGAAAGAGGGTGGTTGG - Exonic
1006500864 6:34458016-34458038 CTGCAGGGACAGGGCAAGGTTGG - Intergenic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1007246535 6:40467339-40467361 CTCCAAGGACACAGGCAGCTGGG - Intronic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1007396709 6:41582184-41582206 CGGAAGGGACAGTGGGAGCAGGG - Intronic
1007479747 6:42142270-42142292 CTCCGGGGACGGAGGGCGCTGGG - Intronic
1007658827 6:43469632-43469654 GCTCAGGGAAAGAGGGAGCTGGG + Intergenic
1008621227 6:53273345-53273367 CTGCAGGAACAGAGGGATTTGGG + Intronic
1009307104 6:62103671-62103693 CTGCAGAGCCACAGGGAGCCAGG - Intronic
1009643222 6:66363322-66363344 CTGCAGAGTCATAAGGAGCTGGG - Intergenic
1010203077 6:73299628-73299650 ATGCAGGGGCGGAGGGGGCTCGG + Intronic
1011723294 6:90181887-90181909 CTGCAGAGTCAGAGAGACCTAGG - Intronic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1013314551 6:108929124-108929146 CTGGAGGGAAGGAGGGGGCTGGG - Intronic
1013317675 6:108957632-108957654 GTGCAGGGCTAGAGGGAGGTAGG - Intronic
1015972684 6:138758579-138758601 CAGAAGGGAGAGAGGGAGCAGGG - Intronic
1016825743 6:148386977-148386999 TTCCCAGGACAGAGGGAGCTGGG - Intronic
1017046297 6:150350045-150350067 CTGCAAGGACAAAGGGAGTGTGG - Intergenic
1017584344 6:155903947-155903969 TTCCAGGGACAGAGTGATCTGGG + Intergenic
1017767247 6:157616633-157616655 CTGAAGGGACAGAGGGATTGTGG + Intronic
1018190871 6:161308143-161308165 GTTCAGAGACAGAGGGAGGTGGG + Intergenic
1018394855 6:163370292-163370314 CAGCAGGGAGCAAGGGAGCTAGG - Intergenic
1018739735 6:166718224-166718246 CTCCAGGCACAAAGGGAACTAGG + Intronic
1018879889 6:167867088-167867110 CTGAAGGTAAAGAGGGAACTGGG - Intronic
1019309127 7:351770-351792 CTCCGGGGACGGAGTGAGCTGGG - Intergenic
1019575836 7:1737236-1737258 CTGCAGGGAAAGAGGAGGCTTGG - Intronic
1019618516 7:1978139-1978161 CTGCAGTGAGAGGGGGAGCTGGG - Intronic
1019632124 7:2055079-2055101 CAGCAGAGACAGAGGAAGCGGGG + Intronic
1019755178 7:2763465-2763487 CTGCCGGGGTTGAGGGAGCTCGG - Intronic
1019779223 7:2929808-2929830 CTGGAGGGAGAGAGGGTGGTGGG + Intronic
1019779239 7:2929857-2929879 CTGCAGGGGGAGAGGGTGGTGGG + Intronic
1020275328 7:6620928-6620950 CTGCAGGGGCAGGGGTGGCTTGG - Intronic
1022094478 7:27130299-27130321 CTGCAGGGGCGGCGGCAGCTGGG + Exonic
1022163485 7:27734932-27734954 CTGGAAGGAAACAGGGAGCTGGG + Intergenic
1022511655 7:30938646-30938668 CTGCAGAGACACAGGGGCCTGGG - Intergenic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1023966746 7:44966839-44966861 CTGCAGGGACAGAGGGGACTTGG + Intronic
1024174739 7:46827601-46827623 CTGCAGGCTCCGTGGGAGCTAGG + Intergenic
1024466098 7:49712510-49712532 CTGGAGGGACAGATGCACCTGGG - Intergenic
1024617426 7:51127447-51127469 CTACAGGGACAGACGCAACTGGG + Intronic
1025061374 7:55811427-55811449 CTGCAGGGAGCGATGGAGATGGG + Intronic
1025212178 7:57026064-57026086 CTGAAGGGAGGGAGGGAGCCAGG - Intergenic
1025254522 7:57374561-57374583 CAGCAGGGAGAGTGGGGGCTTGG + Intergenic
1025659776 7:63550764-63550786 CTGAAGGGAGGGAGGGAGCCAGG + Intergenic
1026870206 7:73846411-73846433 CCAAAGTGACAGAGGGAGCTTGG + Intergenic
1027362630 7:77425267-77425289 TTTCAGGGAAAGTGGGAGCTGGG - Intergenic
1028077443 7:86533953-86533975 CTGCAGGGGCAGTGGGAGAGGGG + Intergenic
1028243900 7:88452911-88452933 CTGCAGGGAGAGTTGGTGCTGGG + Intergenic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1029591570 7:101510537-101510559 CTGCAGAGACAGGGCGAGCCTGG + Intronic
1029625413 7:101717716-101717738 TTGCAGGGAGGGAGGGGGCTCGG - Intergenic
1029708167 7:102286352-102286374 CAGCAGGGACAATGGGAGCCTGG - Intronic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1031922095 7:127609500-127609522 CTGCAAGGACAGCGGGAACCCGG - Intergenic
1033029193 7:137808564-137808586 CTGCCTGGACAGTGGGGGCTAGG - Intronic
1033233980 7:139623780-139623802 CTCCAGAGTCAGAGGGGGCTGGG - Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1034960778 7:155362998-155363020 CTGCAGGGAAGGCGGCAGCTCGG + Intronic
1035060025 7:156062355-156062377 CTGCAGGAGCAGGGGGAGTTGGG - Intergenic
1035464322 7:159064809-159064831 CTGCAGGGACTGAAGGAGGGAGG - Intronic
1035684375 8:1512708-1512730 CTCCATGGACACAGCGAGCTGGG - Intronic
1036476755 8:9100401-9100423 CTGCAGGGTCAGAAAGACCTAGG - Intronic
1037743814 8:21627929-21627951 CTGCAGGGACAGACTGAGTGGGG - Intergenic
1037749176 8:21668983-21669005 TTACAGGGCCAGAGGGAACTTGG + Intergenic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1037881024 8:22573581-22573603 CTGGAGGAAATGAGGGAGCTGGG + Intronic
1038197926 8:25385101-25385123 CAGCAGGCACAGAGAGAGCTGGG + Intronic
1038328427 8:26589626-26589648 CCACAGGGACTCAGGGAGCTGGG - Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1039174884 8:34792630-34792652 CTGCCAGGACAAAGGGGGCTAGG - Intergenic
1039414933 8:37385760-37385782 ATCCAGAGAGAGAGGGAGCTGGG + Intergenic
1041421734 8:57674243-57674265 TTGCAGGGACAGAGATAGCTTGG + Intergenic
1041495676 8:58482951-58482973 TGGCAGGGAAAAAGGGAGCTGGG - Intergenic
1042877651 8:73454578-73454600 CTGTTGGGACAGAGTGACCTAGG - Intronic
1044780062 8:95734675-95734697 TTGCAGGGACTGGGGGAGGTGGG + Intergenic
1047692538 8:127371122-127371144 CTGCAGGGAGAGTGGCAGGTAGG + Intergenic
1047809101 8:128388623-128388645 CTTCAAGGACAGAGGTATCTTGG + Intergenic
1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG + Intergenic
1048970676 8:139643466-139643488 CTGCAGGGACTGAGGGACACAGG + Intronic
1049328588 8:142037867-142037889 CAGTAAGGACAGAGGGAGGTGGG - Intergenic
1049339827 8:142106103-142106125 GTGCAGGGACAGAGGGACATAGG + Intergenic
1049558147 8:143293863-143293885 CTGCAAGGGCAGAGAGAGGTGGG + Intronic
1049593154 8:143471667-143471689 CTTCAGGGACTGGGGAAGCTGGG + Intronic
1049642249 8:143720977-143720999 CTGCAGGGAGCCAGGGAGGTGGG - Intronic
1049811958 8:144579632-144579654 GTGCAGGCACAGAGGGAGGCGGG - Intronic
1050133849 9:2441230-2441252 CTGCACTGACAGAGGTAGCAGGG + Intergenic
1050830244 9:10001043-10001065 CTACAGAGATAGAGGGAGCGGGG - Intronic
1051068320 9:13131822-13131844 CTCCAAAGACTGAGGGAGCTGGG - Intronic
1053142192 9:35689269-35689291 CAGCTGGGACAGAGGGGACTTGG + Exonic
1053390383 9:37730930-37730952 CTGCAAGGACAAAGGCAGTTAGG + Intronic
1055175436 9:73313020-73313042 CAGCAGGCAAAGAGAGAGCTTGG + Intergenic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1056454435 9:86746325-86746347 CTCCAGGAACAGAGTGAGCGAGG + Intergenic
1056797818 9:89670654-89670676 CTGGAGAGACAGAGGCACCTAGG + Intergenic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1056954728 9:91072897-91072919 CTGCAGGGTGAGAGGGACTTTGG + Intergenic
1057820936 9:98330106-98330128 ATGCAGGGCTGGAGGGAGCTTGG - Intronic
1058075344 9:100644917-100644939 AGGGAGGGACAGAGGGAGCAAGG - Intergenic
1058691158 9:107521854-107521876 CAGCAAGGAAACAGGGAGCTAGG - Intergenic
1060405501 9:123371047-123371069 CTGCAGGGAGAGAAGGTGCCAGG - Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060430083 9:123543576-123543598 GAGCAGGGACAGAAGGAGCGTGG - Intronic
1060794935 9:126507101-126507123 CTGCTGGGGGAGAGAGAGCTTGG - Intergenic
1061036829 9:128118835-128118857 GTGCAGGGACAGAGGGATGCAGG + Intergenic
1061187145 9:129061226-129061248 CTGCAGGGACTCAAAGAGCTGGG - Exonic
1061377251 9:130233911-130233933 ATGCGGGGACAGAGGCAGCAGGG - Exonic
1061600600 9:131667456-131667478 GTACAGGGACAGAGGTGGCTGGG + Intronic
1061680771 9:132241509-132241531 TTGCGGGGACAGAGGGAGGGAGG + Intronic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1062093145 9:134689058-134689080 CTGGAGGGACAGGGAGTGCTGGG + Intronic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1062331269 9:136045950-136045972 CAGCAGGGACACCGGGAGCCGGG - Intronic
1062331906 9:136048637-136048659 CTGCAGGCGGAGAGGGAGCCAGG + Intronic
1185570112 X:1128211-1128233 CTGCAGGGACAGGGACAGGTGGG + Intergenic
1185570171 X:1128499-1128521 CTGCAGGGACAGGGACAGGTGGG + Intergenic
1185889562 X:3812407-3812429 CTGCAGAGAGAGAGGGAGGGAGG - Intergenic
1186350041 X:8731587-8731609 CTGCTGGGAAGGAGGGAGTTGGG + Intronic
1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG + Intronic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1187447695 X:19373206-19373228 ATGCAGGGACAGAGGGGGCAAGG + Intronic
1187929069 X:24277383-24277405 ATGCGGGGAGAGAGGGAGCATGG - Intergenic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1188756390 X:33968924-33968946 CTGCAGAGCCAGTGGGAGCTGGG + Intergenic
1189800374 X:44686341-44686363 CTGCAGGGAAAGACATAGCTGGG - Intergenic
1189989690 X:46582483-46582505 CTGTAGGGTCAGAGAGAGCCAGG - Intronic
1190144236 X:47876094-47876116 CTCCAGGGTTACAGGGAGCTAGG + Intronic
1190327047 X:49212913-49212935 ATGGAGGGACAGAGGGACATGGG + Intronic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1194323465 X:92480932-92480954 CAGCAGCGACAGAGGCAGCATGG + Intronic
1194364547 X:92997235-92997257 CAGCAGGCAAAGAGAGAGCTTGG - Intergenic
1195342519 X:103919153-103919175 CTTCAGGGCCAGAGGCTGCTTGG - Intronic
1196008862 X:110865172-110865194 CTGCAGGCAAGAAGGGAGCTTGG + Intergenic
1197796086 X:130299772-130299794 CTGCGGGGACACAGGGGGCTAGG + Intergenic
1198074668 X:133182913-133182935 CTGCTAGGCCAGAGGCAGCTAGG + Intergenic
1198492178 X:137152764-137152786 CTGTAGGGACTCAGGGAGCTAGG + Intergenic
1199814376 X:151384937-151384959 CAGCTGGCACAGAGGCAGCTAGG - Intergenic
1200206767 X:154321891-154321913 TTGCAGGGGCAGAGGGGCCTAGG + Intronic
1200213909 X:154359042-154359064 CTGGAAGGACTGAGGGAGGTTGG + Exonic
1200631566 Y:5594098-5594120 CAGCAGCGACAGAGGCAGCATGG + Intronic
1200672772 Y:6113500-6113522 CAGCAGGCAAAGAGAGAGCTTGG - Intergenic
1200882855 Y:8237533-8237555 ATGGAGGGACAGAGGGAGAGGGG + Intergenic
1201757524 Y:17502451-17502473 CGGCAGGGCTAGAGGGAGCCTGG - Intergenic
1201844030 Y:18403531-18403553 CGGCAGGGCTAGAGGGAGCCTGG + Intergenic
1202194677 Y:22287078-22287100 AAGCAGGGACAGAGGGAGAGGGG + Intergenic
1202372134 Y:24205758-24205780 CAGCAGGGAGAGGCGGAGCTGGG - Intergenic
1202498651 Y:25464358-25464380 CAGCAGGGAGAGGCGGAGCTGGG + Intergenic