ID: 1085696513

View in Genome Browser
Species Human (GRCh38)
Location 11:78709427-78709449
Sequence GACAGTCTAGTGAATGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085696513_1085696519 21 Left 1085696513 11:78709427-78709449 CCTGCTCCATTCACTAGACTGTC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1085696519 11:78709471-78709493 TGACCCAACTTGTGTGACCTCGG 0: 1
1: 0
2: 1
3: 11
4: 168
1085696513_1085696520 22 Left 1085696513 11:78709427-78709449 CCTGCTCCATTCACTAGACTGTC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1085696520 11:78709472-78709494 GACCCAACTTGTGTGACCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085696513 Original CRISPR GACAGTCTAGTGAATGGAGC AGG (reversed) Intronic
901326238 1:8367090-8367112 CACTGTCTTGTGAATGGAGGAGG + Intronic
903537910 1:24079499-24079521 GACAGTATAAAGAATGGAGATGG - Intronic
905456137 1:38089086-38089108 GACAGGTTAGTGAATGATGCAGG - Intergenic
905478605 1:38246090-38246112 GACACTTTGCTGAATGGAGCTGG + Intergenic
907591164 1:55673012-55673034 GACAGACCAGTGAATGTAGTTGG + Intergenic
908554255 1:65241296-65241318 GCCATTCTAGTAAATGGTGCTGG - Intergenic
910358658 1:86392982-86393004 CATAGTTTAGTGAATGTAGCTGG - Intronic
913713578 1:121511535-121511557 GACAGGACAGAGAATGGAGCAGG + Intergenic
915915418 1:159937674-159937696 GACAGTCAATTGTATGAAGCTGG - Exonic
918658874 1:187064575-187064597 GACAGTCTCTTGAATAGTGCAGG + Intergenic
923846539 1:237739371-237739393 GACATTCTAAGGAATCGAGCAGG - Intronic
1064821790 10:19344390-19344412 GACAGTCTTGTCAATGATGCTGG - Intronic
1072372480 10:94778382-94778404 GAAAGTATAGGGAAAGGAGCAGG - Intronic
1073693107 10:105833782-105833804 AAAGGTATAGTGAATGGAGCAGG + Intergenic
1079647791 11:22888992-22889014 TACAGTTTAATGAGTGGAGCAGG - Intergenic
1084474764 11:69382477-69382499 GAGAGTCATGTGACTGGAGCTGG - Intergenic
1085696513 11:78709427-78709449 GACAGTCTAGTGAATGGAGCAGG - Intronic
1090043748 11:123313239-123313261 GACAGTGTAGAGGATGCAGCAGG - Intergenic
1090852206 11:130580415-130580437 GCCAGTCCAGAGAATGGATCTGG - Intergenic
1102502012 12:113359228-113359250 CAAAGTCTAGGGAAGGGAGCAGG - Intronic
1103010622 12:117455707-117455729 GAGGGTGTAGTGAATGGGGCTGG + Exonic
1103452086 12:121036304-121036326 GAAAATCTAGTGAGCGGAGCTGG - Intronic
1105780956 13:23704941-23704963 GACAGTGGAGTGAAGAGAGCTGG - Intergenic
1106141062 13:27012069-27012091 GAGAGTGAAGTGAATGGAGGTGG + Intergenic
1107560170 13:41551165-41551187 GACTTTCTGGTGAAGGGAGCTGG + Intergenic
1108116245 13:47131016-47131038 GAAAGTGAAGTGAATGGAGAAGG + Intergenic
1109984995 13:69968672-69968694 GACAGACTGCAGAATGGAGCAGG + Intronic
1110913302 13:80990617-80990639 GACAGTGAAATGGATGGAGCAGG - Intergenic
1113810691 13:113140828-113140850 GACAGGCAAGTGGATGTAGCTGG + Intronic
1119128696 14:72152356-72152378 AACTGTCTAGTGAATGGTCCAGG + Intronic
1125683120 15:41545326-41545348 GACAGTCTATTCAAGGGAACAGG - Intergenic
1133358429 16:5154262-5154284 GACAGCCAAGTGACTGGAGTAGG + Intergenic
1136091850 16:27926343-27926365 GACAGTCTAGTGGGTGGAGGCGG + Intronic
1140436918 16:74954696-74954718 GACTGGCTATTGAATAGAGCTGG - Intronic
1147572448 17:41579738-41579760 CACAGTCTAGTGGAGGCAGCTGG - Intergenic
1149657635 17:58318736-58318758 GACTGTCAAGTGAGTGGAGCTGG + Intronic
1150207180 17:63417887-63417909 CACAGTGTAGTGCATGTAGCAGG + Intronic
1154069175 18:11137658-11137680 GACAGTCCAGGGAAAGCAGCAGG + Intronic
1159688384 18:71453211-71453233 GACAGACTAGTAAATTGATCTGG - Intergenic
1159913532 18:74168422-74168444 GTCAGTTCAGTAAATGGAGCTGG - Intergenic
1167220875 19:48197201-48197223 GCCAGTCTAGGGAGTGCAGCGGG + Intronic
927672483 2:25080632-25080654 GACTGTCTAGTAAATGGTGCTGG - Intronic
932936269 2:76106360-76106382 GGCTGTCTAGTAAATGGTGCTGG - Intergenic
935093838 2:99924650-99924672 GACAGACTGGAGAATGGTGCTGG - Intronic
939048498 2:137278993-137279015 GAGAGTTTAGTGAAGGGACCTGG + Intronic
942067439 2:172284982-172285004 GCCAGTCTAGACAATAGAGCAGG - Intergenic
944648943 2:201809407-201809429 GAAAATCTAATAAATGGAGCTGG - Intronic
948062571 2:235052512-235052534 GACAGTGTAGGGAGTGGGGCAGG - Intronic
1172541920 20:35725091-35725113 GACAGTCTTCTGTATGCAGCTGG - Exonic
1172628512 20:36362704-36362726 GACACTTTAGTGAGAGGAGCAGG + Intronic
1172671276 20:36635817-36635839 GACAGTGTAGTGTATGCAGCTGG - Intronic
1174616995 20:51843338-51843360 CACAGTCTAGTGGAGGGAGGTGG + Intergenic
1179047688 21:37861143-37861165 GACAGTCTAGGGTAGGGAGTCGG - Intronic
1182158196 22:28096119-28096141 GAAAGTCTAATGAATAGAGGTGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
959028265 3:101267448-101267470 GACAGTTTAGTAAATATAGCAGG - Intronic
967825559 3:193874553-193874575 GACAGTGTATTGAATGGAATGGG - Intergenic
972640056 4:40917110-40917132 GACTGTCTTCTGAATGGACCTGG + Intronic
973748173 4:53984944-53984966 TACAGTCTAGTGAGGGGAGGGGG - Intronic
977679178 4:99780123-99780145 TACAGGCAAATGAATGGAGCTGG + Intergenic
984360798 4:178729373-178729395 GACAGTCTAACAAATGGTGCTGG - Intergenic
986178120 5:5369198-5369220 GGCTTTCTAGTGAAAGGAGCAGG - Intergenic
987056111 5:14193934-14193956 CTGAGTCTAGTGAAAGGAGCAGG - Intronic
988130970 5:27105975-27105997 CTCAGGTTAGTGAATGGAGCTGG + Intronic
990286827 5:54309223-54309245 CATAGCCTTGTGAATGGAGCTGG - Intronic
992388586 5:76309786-76309808 TACAGTTGAGTGAATGGAGATGG + Intronic
992673649 5:79083994-79084016 GACAATTTTGGGAATGGAGCTGG - Intronic
993662724 5:90658771-90658793 GACAGCCTAATGAATTAAGCTGG - Intronic
993794887 5:92254918-92254940 GGCAGTAATGTGAATGGAGCTGG + Intergenic
994126767 5:96176282-96176304 GGCAGTCTAGAGAAAGGAGCAGG + Intergenic
995084063 5:108087081-108087103 AACACTCTGGTGAATGGAGCTGG + Intronic
998216177 5:140240017-140240039 GCCAGTCTAGGGACCGGAGCTGG - Intronic
1002971751 6:2030035-2030057 GACAGTCCAGAGAAGGGGGCAGG + Intronic
1004274935 6:14227695-14227717 TACAATCTAGTGAAAGGAGGTGG - Intergenic
1004286207 6:14322967-14322989 GACAATCCTGTGAATGGAGGAGG + Intergenic
1006358633 6:33575255-33575277 GACAGAGGAGTGACTGGAGCTGG + Intronic
1007273493 6:40656426-40656448 GACTGCCTAGTGAAAGGGGCAGG - Intergenic
1007908366 6:45487584-45487606 GACAATCTAGTGAATCTAGTGGG - Intronic
1008935516 6:56987671-56987693 GACATTCTGGTGCATGGAGGAGG - Intronic
1010466386 6:76171624-76171646 TGCAGCCTTGTGAATGGAGCTGG + Intergenic
1018969379 6:168515645-168515667 GACAGCCTAGAGGAAGGAGCCGG - Intronic
1020493315 7:8816508-8816530 GACAGACTAGTAAAAGGACCAGG - Intergenic
1032538943 7:132687501-132687523 GACAGTGCAGTGGCTGGAGCAGG - Intronic
1032557614 7:132853695-132853717 GACAGTCTTGGGATTGGTGCAGG + Intronic
1035577384 8:716419-716441 GCCAGGTGAGTGAATGGAGCAGG + Intronic
1036414170 8:8531294-8531316 GAGAGTTTCGTGAATGGAGGCGG + Intergenic
1037599643 8:20383247-20383269 TACATTCTAGTGAAGGGAGGAGG - Intergenic
1041359429 8:57036459-57036481 GAGAGTCTTGTGACTGCAGCTGG + Intergenic
1041394403 8:57376469-57376491 GACAGTGTTCTGACTGGAGCAGG - Intergenic
1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG + Intergenic
1044327965 8:90881962-90881984 GACACTCTAGGAAATGAAGCTGG + Intronic
1044436454 8:92169750-92169772 GACAGGCTAATGAATACAGCAGG + Intergenic
1045568651 8:103347313-103347335 GACAGACAAATGAATGTAGCAGG + Intergenic
1046558896 8:115813831-115813853 GACAGTCTAGGCTGTGGAGCAGG + Intergenic
1046985430 8:120382507-120382529 TACATTCTAGTGAAGGGAGGTGG - Intronic
1047302662 8:123627390-123627412 GACAGTCAGGTAAATTGAGCAGG + Intergenic
1050396960 9:5208671-5208693 GACAGTCTAATGAATGATGCTGG + Intergenic
1051101841 9:13530985-13531007 CACAGTTTGGTGAATGGAGTGGG + Intergenic
1052089857 9:24314834-24314856 GACCTTCTAGGAAATGGAGCTGG - Intergenic
1055602115 9:77930844-77930866 AACAGTCCAGTGACTGGTGCTGG - Intronic
1057475404 9:95396629-95396651 GACAGTCTCTTAAATGGCGCTGG + Intergenic
1058398189 9:104580508-104580530 GACATACTAGTGAATGTTGCTGG + Intergenic
1186964007 X:14767918-14767940 GACTGTCTAATAAATGGTGCTGG - Intergenic
1187282540 X:17868924-17868946 GACACTTTAGTGAATTGGGCTGG - Intergenic
1189731912 X:44029789-44029811 GACAGTCTTCTGTATGCAGCTGG + Intergenic
1190889054 X:54553281-54553303 GGCAGTGTAGAGAATGAAGCAGG - Intronic
1192506881 X:71691708-71691730 GATAGTCTAGTTATTGGATCGGG + Intergenic
1192519816 X:71789838-71789860 GATAGTCTAGTTATTGGATCGGG - Intergenic
1195298698 X:103505962-103505984 GACAGTGCAGTGAAGGGAGAAGG - Intronic
1197041107 X:121936841-121936863 GACAGTTTAGAGAATGGAAAAGG - Intergenic
1197360447 X:125495636-125495658 GACTGTCTAATGAATCTAGCAGG - Intergenic
1201908182 Y:19106244-19106266 GACAGGGTAGAAAATGGAGCGGG - Intergenic