ID: 1085701234

View in Genome Browser
Species Human (GRCh38)
Location 11:78747644-78747666
Sequence CAAGCAAATCCCACAGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085701234_1085701240 15 Left 1085701234 11:78747644-78747666 CCCCTCACTGTGGGATTTGCTTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1085701240 11:78747682-78747704 GCCTCTGAGATCTAATTGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 127
1085701234_1085701238 11 Left 1085701234 11:78747644-78747666 CCCCTCACTGTGGGATTTGCTTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1085701238 11:78747678-78747700 TAATGCCTCTGAGATCTAATTGG 0: 1
1: 0
2: 1
3: 4
4: 144
1085701234_1085701239 14 Left 1085701234 11:78747644-78747666 CCCCTCACTGTGGGATTTGCTTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1085701239 11:78747681-78747703 TGCCTCTGAGATCTAATTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085701234 Original CRISPR CAAGCAAATCCCACAGTGAG GGG (reversed) Intronic
901190435 1:7406914-7406936 CACGCACATCCAACTGTGAGAGG + Intronic
902804729 1:18853974-18853996 GAAGGAAATCCCACAGGCAGTGG - Intronic
906796830 1:48702935-48702957 GATGCACATCCCACAGTGAGGGG + Intronic
907014874 1:51002828-51002850 CAAGCACAGTCCAGAGTGAGAGG + Intergenic
913445358 1:118944839-118944861 CCAGCACATCTCACAGTGACAGG + Intronic
913688139 1:121253460-121253482 GAAGCACACGCCACAGTGAGGGG - Intronic
916948439 1:169755076-169755098 CAGGCAAATCCCAAAGAGAAGGG + Intronic
917492685 1:175511601-175511623 CAAGCACATCTTGCAGTGAGAGG + Intronic
918787849 1:188787972-188787994 CAAGCTAATCCCAAAGCCAGTGG - Intergenic
919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG + Intronic
920475461 1:206271959-206271981 GAAGCACACGCCACAGTGAGGGG - Intronic
921401989 1:214734700-214734722 CTTGCAAAGCCCAGAGTGAGAGG - Intergenic
1062820183 10:528871-528893 CTAGGAAGTTCCACAGTGAGAGG - Intronic
1069765558 10:70855045-70855067 CAAGCAAATCTCAGAGACAGTGG + Intronic
1074997463 10:118770306-118770328 TAAGGAAATCCCACAGTGAGAGG + Intergenic
1075288469 10:121207675-121207697 CATGCACAAACCACAGTGAGGGG - Intergenic
1076310438 10:129502461-129502483 AAAGCAAATACCACAGAGAAAGG - Intronic
1076978773 11:194327-194349 CAAGCAAGGCCCTCAGTGGGGGG - Intronic
1077079085 11:715573-715595 CAAATAAAACCCACAGTAAGTGG - Intronic
1077093881 11:791287-791309 CCAGAAAGTCCCACAGTGGGTGG + Exonic
1078540223 11:12207123-12207145 ATATCAAATCCCACAGAGAGAGG - Intronic
1079417303 11:20251176-20251198 TAAGCAAAACCTTCAGTGAGAGG - Intergenic
1081730644 11:45369653-45369675 CCAGCGAAGCCCACAGTGGGAGG - Intergenic
1084407260 11:68981460-68981482 CAAGCAAACCCCAAAGTGCTGGG - Intergenic
1084453420 11:69253306-69253328 CACTCAAATCCCAAAGTGAAGGG + Intergenic
1085701234 11:78747644-78747666 CAAGCAAATCCCACAGTGAGGGG - Intronic
1085954248 11:81371921-81371943 CAAGCAGATCCCACTTTGGGAGG + Intergenic
1087574019 11:99967493-99967515 CAGGCAAATCCCAGAGTGCGCGG - Intronic
1089119973 11:116126798-116126820 TATGCAAGGCCCACAGTGAGCGG + Intergenic
1089199732 11:116716833-116716855 CATGCCAATCCCACAGTGATTGG - Intergenic
1092564846 12:9653891-9653913 CAAGCATTTCACACAGTGACAGG - Intergenic
1096512400 12:52138278-52138300 CAGGAAAATCCCAGAGGGAGAGG - Intergenic
1100984093 12:100188418-100188440 CAGCCCCATCCCACAGTGAGGGG + Intergenic
1101392173 12:104311489-104311511 CAAATAAATTCCACAGAGAGAGG - Intronic
1101872384 12:108576916-108576938 CAAGCTCATCCCACAGCGAGTGG + Intergenic
1103404462 12:120665607-120665629 CAACCACATCCCACACAGAGTGG - Intronic
1104212580 12:126703806-126703828 CAATCAAATCTTCCAGTGAGAGG + Intergenic
1104931596 12:132342028-132342050 CAATCAAATCCCACGGGGTGGGG + Intergenic
1106381832 13:29246681-29246703 CAAGCAAAGGCAATAGTGAGAGG + Intronic
1106665642 13:31847427-31847449 CAAGCAAAACCCACACTGGGCGG - Intergenic
1107277891 13:38697428-38697450 CATGCAAATACCACTGGGAGGGG + Intronic
1108682764 13:52793545-52793567 CATGAAAACCCCACAGTGGGAGG - Intergenic
1110229472 13:73153304-73153326 CAAGCAATCCCCAAACTGAGTGG - Intergenic
1112792065 13:103014127-103014149 AAAGGAAATCCCACAGAGGGAGG - Intergenic
1116764767 14:49056772-49056794 CAAGAAAATCCCAGAGGTAGTGG + Intergenic
1118490329 14:66252907-66252929 AAAGCAAATAGAACAGTGAGTGG - Intergenic
1118540387 14:66816758-66816780 CAAACAAATCCCAAAGCTAGTGG + Intronic
1119477972 14:74942112-74942134 CAAGCAAATGGCAAAGTGTGAGG + Exonic
1119701643 14:76759978-76760000 CAAGTACATCCCACATTCAGGGG + Intergenic
1119732508 14:76959773-76959795 CAAGCAATTTAAACAGTGAGGGG - Intergenic
1121412694 14:93758915-93758937 CAGGCCAAGCCCACAGAGAGCGG - Intronic
1122508704 14:102248886-102248908 CAAGCAAGTCAGACAGTCAGAGG - Intronic
1123154693 14:106212813-106212835 TAAGCAAAAGACACAGTGAGGGG - Intergenic
1127629369 15:60812563-60812585 AAAGCAAATTCCCCAGTGACTGG + Intronic
1130941096 15:88509887-88509909 CAAGACAATACCACAGTGAATGG + Intergenic
1131568529 15:93507827-93507849 CAAGCATTTCACACACTGAGAGG - Intergenic
1133381815 16:5337178-5337200 AAAGCCAAAACCACAGTGAGGGG - Intergenic
1135830461 16:25768409-25768431 CAAGCAAAACAAACAGAGAGAGG - Intronic
1137395892 16:48115906-48115928 AATGCAGATCCCACAGGGAGGGG + Intronic
1138977045 16:62220567-62220589 CAAACAAATCAAACAGTGAGGGG - Intergenic
1142466203 17:138819-138841 CAAGCAAGGCCCTCAGTGGGGGG - Intronic
1142624287 17:1181855-1181877 CAGGAAAACCCCACAGTGTGGGG - Intronic
1143009897 17:3860442-3860464 CAACCAAAACCCTCAGTGACAGG + Intronic
1146487715 17:33257411-33257433 CTAAGAAATTCCACAGTGAGAGG + Intronic
1148164832 17:45476078-45476100 GAAGCAAAGGTCACAGTGAGCGG + Intronic
1149618163 17:58019523-58019545 CTTGCAAATTCCATAGTGAGTGG - Intergenic
1151117425 17:71753255-71753277 CAAGCAAATTCCAAAAGGAGCGG + Intergenic
1152856343 17:82666806-82666828 CAAGCAAATCCCACAAAGGCTGG - Intronic
1155162660 18:23208274-23208296 GAGGCACATCCAACAGTGAGGGG + Intronic
1156670335 18:39461696-39461718 CAAGCATATACCACAGTGCCTGG - Intergenic
1157081530 18:44530519-44530541 AAAGAAAATCCCATAGTGTGAGG + Intergenic
1158885062 18:61819256-61819278 ATAGCAGATCCCACAGGGAGGGG + Intronic
1159641603 18:70869503-70869525 CAAACAAAGCCCACAGTGATAGG - Intergenic
1160248523 18:77180551-77180573 AATGCAGAACCCACAGTGAGTGG + Intergenic
1161831559 19:6608845-6608867 CCAGCTAATCCCACAGTGCAGGG + Intergenic
1163332118 19:16646326-16646348 CAAGCAAATCACACAGTTGTGGG + Exonic
1164473443 19:28554706-28554728 CATGCAAAGGCCACAGTGAGGGG + Intergenic
1165466893 19:35980055-35980077 CAAGCAATTCCCAAAGTGTTGGG - Intergenic
1167617091 19:50541220-50541242 CAGGCACACCCCACTGTGAGCGG - Intronic
1167949250 19:53013189-53013211 CAAACTAAACCCACACTGAGGGG - Intergenic
1168713488 19:58514465-58514487 CAGGAAGATCCCATAGTGAGGGG - Intronic
926384127 2:12319103-12319125 CCAGTAAATACCAGAGTGAGAGG + Intergenic
926405825 2:12551667-12551689 CAAGCAGATTTCACAGTGAGAGG - Intergenic
926674556 2:15610075-15610097 CAAGCAAGTGCCACAGTGCTTGG + Intronic
927599369 2:24427105-24427127 GAAGCAATTCCCACTCTGAGGGG - Intergenic
927866518 2:26591404-26591426 GAAGGAAAGCCCACAGAGAGAGG + Intronic
928736428 2:34296151-34296173 CAAGCTAATCTCAAAGTTAGAGG - Intergenic
929823738 2:45293665-45293687 CAAGCAAATCACAGAGTAAATGG + Intergenic
930671869 2:54159966-54159988 GAAGCAGAGCACACAGTGAGGGG - Intronic
931947447 2:67325691-67325713 TAATCAAAACTCACAGTGAGAGG + Intergenic
932015346 2:68020810-68020832 CAAAGAGATCACACAGTGAGAGG - Intergenic
934538813 2:95158635-95158657 CAAGCAAACCCAAGAGGGAGTGG - Intronic
935654201 2:105407843-105407865 CAAGGAAGTCCCTCAATGAGTGG - Intronic
936402628 2:112176920-112176942 AAAAAAAATCCCACAGTGGGAGG - Intronic
936889767 2:117355494-117355516 CAAGCAATTCCCACAGAGCCTGG - Intergenic
937106362 2:119318370-119318392 CAAGGAATTCCAACAGTGACAGG + Intronic
938210801 2:129464569-129464591 CTGGCAAAACCCACAGTGGGAGG - Intergenic
939090234 2:137771763-137771785 CAAACAAATGCCACATTAAGTGG - Intergenic
939792575 2:146597287-146597309 AAAGCAGATCACACACTGAGAGG + Intergenic
940226861 2:151409829-151409851 CGAGCCAATCCAACAGTCAGCGG - Intergenic
940979245 2:159983016-159983038 CAAGAACATTCCAAAGTGAGAGG + Intronic
941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG + Intergenic
942963119 2:181856393-181856415 CAAGCAAATTCAACTCTGAGGGG + Intergenic
943871625 2:193007848-193007870 CAAGCAAACCCAACATTCAGTGG + Intergenic
948033215 2:234836737-234836759 CAAGAAAACCCCAGAGGGAGAGG + Intergenic
948096982 2:235343354-235343376 CAAGCAGCTCCCCCAGGGAGAGG - Intergenic
948454854 2:238100236-238100258 CAAGCCACTCCCACAGTGTGAGG - Exonic
1168923687 20:1562132-1562154 AAACCAAAACCCACAGTGACTGG - Intronic
1172392520 20:34575468-34575490 CCAGCCAAGCCCACAGTGGGAGG - Intronic
1173068158 20:39734740-39734762 CAAACAAACCCCACATTGATGGG + Intergenic
1175375517 20:58521086-58521108 CAAGTAAAGCCCTCAGTGTGGGG + Intergenic
1175391085 20:58627932-58627954 GAAGCAAAAACCACAGTGAGAGG - Intergenic
1175654794 20:60760693-60760715 AAAACAAATGCCACAGGGAGGGG - Intergenic
1176717558 21:10365986-10366008 CCAACAAATCCCACAGAGACAGG - Intergenic
1177934785 21:27330870-27330892 CAAGAACCTCCAACAGTGAGAGG - Intergenic
1178189126 21:30260281-30260303 CAAGTAGGCCCCACAGTGAGAGG + Intergenic
1178738165 21:35171541-35171563 CAGGCACACCCCTCAGTGAGAGG + Intronic
1178873587 21:36395501-36395523 CAGGCAAATCCCACATGGTGGGG + Intronic
1180298785 22:11018906-11018928 CCAACAAATCCCACAGAGACAGG - Intergenic
1181502098 22:23321812-23321834 CAAGCACGACCCACAGTGCGCGG + Intergenic
951938514 3:28051294-28051316 CAAGCAAAAGAGACAGTGAGGGG + Intergenic
952390228 3:32873681-32873703 CAAGCACACCCCAAAGGGAGAGG - Intronic
954713401 3:52515800-52515822 CACCCAGATCCCACAGTGAGGGG - Intronic
955694997 3:61626924-61626946 TCAGCAAAACCCACAATGAGGGG + Intronic
956472299 3:69580002-69580024 GAAGCAAATCCAAAAGTGAATGG + Intergenic
956797795 3:72732052-72732074 CAAGGAAAGCGCTCAGTGAGGGG - Intergenic
958731771 3:97967562-97967584 AAAGCAAAGCCTACAGGGAGTGG - Exonic
960843160 3:121980645-121980667 CAAGCACATGCCACCGTGATTGG + Intergenic
961042199 3:123685448-123685470 CAAGCACATGCCACAGTGCCTGG - Intronic
964444773 3:156747539-156747561 CAAGGAAATCCAACACTGAGGGG - Intergenic
967037704 3:185660339-185660361 TGAGCAAATCTCACAGTGACAGG + Intronic
969439601 4:7209289-7209311 CAAGCAAGGCCCAAGGTGAGCGG - Intronic
970104992 4:12572117-12572139 CAAGCAAAGCCAACAGGGACAGG - Intergenic
970491634 4:16581377-16581399 CAAGCCCATGTCACAGTGAGAGG + Intronic
971451804 4:26807595-26807617 CAAGCAAGTGGCACACTGAGGGG - Intergenic
972082539 4:35171708-35171730 CAAGCAAGTCCAAGACTGAGGGG - Intergenic
974062696 4:57050113-57050135 GAAGCAAATCCCACCGAGATGGG + Intronic
975420155 4:74154619-74154641 CAAATAAATCCCACATTGATGGG - Intronic
975610488 4:76197815-76197837 CAAACAAAAGCAACAGTGAGTGG - Intronic
979169421 4:117582042-117582064 CAAGGAATCCCCACAGTGACAGG - Intergenic
981254573 4:142646711-142646733 CAAAGAAATCCCTCAGGGAGAGG + Intronic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
983706542 4:170667151-170667173 TGGGCAAATCCCACAGTCAGTGG + Intergenic
986172905 5:5328169-5328191 GAAGCTCAGCCCACAGTGAGGGG - Intergenic
986865917 5:11986917-11986939 AAAGCAAATCCAAAAGTAAGAGG + Intergenic
987047148 5:14118871-14118893 GAAGGAAATCCCACTGTGAAAGG + Intergenic
990199826 5:53358945-53358967 AAAGCAAATACCAGAGTTAGAGG + Intergenic
990826226 5:59901702-59901724 CAAATAAAGACCACAGTGAGAGG + Intronic
992285383 5:75229916-75229938 CATACAAATTCCACAGAGAGTGG - Intronic
992290596 5:75275480-75275502 CAAGCAAATCCTACTGTGGTGGG - Intergenic
992599846 5:78388215-78388237 TAACCAAATCACACAGTGAGAGG - Intronic
994251626 5:97542569-97542591 CAAGCCAACCCAACAGTGAAAGG + Intergenic
995453618 5:112329826-112329848 CAAGCCATTCCCACAGTGGGTGG + Intronic
995691645 5:114832637-114832659 CAAACAAATCCCAAAGCTAGTGG + Intergenic
998344000 5:141444695-141444717 CAAGCAAATTCAACAGAAAGAGG - Intronic
998491928 5:142554608-142554630 CAACAAAATCCCAGATTGAGTGG + Intergenic
998959185 5:147466681-147466703 CAAGCCAACCCCAAAGTGTGAGG + Intronic
1000252635 5:159510199-159510221 CCATTAAATCCCTCAGTGAGGGG + Intergenic
1004877019 6:19966370-19966392 CTATCTAACCCCACAGTGAGGGG + Intergenic
1005345637 6:24887236-24887258 CAAGCTACACCCACCGTGAGAGG + Intronic
1005427366 6:25716856-25716878 CAAGCAAATCCCCCCCAGAGGGG + Intergenic
1005589179 6:27307210-27307232 CAGGAAAGTCCCATAGTGAGGGG + Intronic
1010556636 6:77288745-77288767 AAATCAAACCCCACAATGAGTGG - Intergenic
1012256071 6:97033735-97033757 CAAGTAAAAACCACAATGAGGGG - Intronic
1013829215 6:114252944-114252966 CAAGCAATTCCCAAAGTGCTAGG - Intronic
1015330419 6:131972182-131972204 CAAGCTATTACTACAGTGAGGGG - Intergenic
1016890927 6:149006042-149006064 CAAGAAACGCCCACTGTGAGTGG - Intronic
1017542800 6:155420357-155420379 CAAGTAAATCCCACTCAGAGAGG - Intronic
1018946871 6:168353684-168353706 CAAGAAATTACCACAGTGTGGGG + Intergenic
1018967099 6:168497544-168497566 CACGCAGATCCCTCAGTGACGGG + Intronic
1019779338 7:2930290-2930312 CCAGCAGATGCCACAGAGAGTGG - Intronic
1020083032 7:5296662-5296684 CCAGCAATTCCTACAATGAGTGG - Intronic
1023440479 7:40180259-40180281 CATGCACATCCCACAGTGCCTGG + Intronic
1024029631 7:45447911-45447933 CAAACTAAACCCACAGTTAGGGG + Intergenic
1025144669 7:56493235-56493257 CCTGCTGATCCCACAGTGAGGGG + Intergenic
1025211248 7:57020529-57020551 CCAGCAATTCCTACAATGAGTGG + Intergenic
1025260255 7:57413692-57413714 CCTGCTGATCCCACAGTGAGGGG + Intergenic
1025660706 7:63556318-63556340 CCAGCAATTCCTACAATGAGTGG - Intergenic
1036941685 8:13058183-13058205 CAAAGAAATGTCACAGTGAGAGG - Intergenic
1037940692 8:22948803-22948825 CAAGGAAATGGCACAGAGAGTGG + Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1041290469 8:56303366-56303388 AAAGGAAACCCCACAGTGGGAGG - Intronic
1042217267 8:66439013-66439035 CAACCAAAGCCCACCGTGAAGGG + Intronic
1045891484 8:107163167-107163189 TAAGCATATCACCCAGTGAGTGG - Intergenic
1047503396 8:125459809-125459831 CAAGCAAAGCACACAGAGGGTGG - Intergenic
1047657389 8:126992745-126992767 CAACCAAAGCACACAGTGAGGGG - Intergenic
1048191502 8:132293818-132293840 CAAGCAAATCACACAGGCAAGGG + Intronic
1048253507 8:132886933-132886955 GAATCTAATCCCACAGAGAGTGG - Exonic
1049993194 9:1009499-1009521 CACCCACATGCCACAGTGAGAGG - Intergenic
1060588600 9:124802035-124802057 CAGGCAGCTGCCACAGTGAGGGG + Intronic
1061190344 9:129079120-129079142 CCAGGAAATCCCACTGAGAGTGG - Intergenic
1061616734 9:131785283-131785305 CAAGCTAATCCCTCATGGAGGGG - Intergenic
1185522652 X:753077-753099 AAAGCAAATCCTACAGTCACGGG + Intergenic
1186659762 X:11657791-11657813 CAAGACAATCCCAGAGTCAGAGG + Intronic
1186828072 X:13361872-13361894 CAAGGTAAGCCCACAGTGAAAGG - Intergenic
1192032804 X:67532901-67532923 CAAGCACATGCCACTGTGCGCGG - Intergenic
1196691180 X:118560538-118560560 CAAGCAATTGTCACAGTGAAAGG - Intronic
1198947962 X:142036607-142036629 ATAGAAAATCCCACAGGGAGAGG - Intergenic
1200417936 Y:2932422-2932444 TAAGAAAATACCACACTGAGTGG - Intergenic