ID: 1085702441

View in Genome Browser
Species Human (GRCh38)
Location 11:78756917-78756939
Sequence TCTCCTGGATGATGTCCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085702441 Original CRISPR TCTCCTGGATGATGTCCAGA GGG Exonic
903068081 1:20711957-20711979 CCTCGTGGAGGATGTGCAGATGG - Intronic
903742734 1:25567670-25567692 TCTCCTGGAGGAAGGGCAGAAGG - Exonic
904866473 1:33583036-33583058 TATTCTGCAAGATGTCCAGATGG - Intronic
905414718 1:37795828-37795850 TCACCTGGATGCTGTACTGATGG - Exonic
907658954 1:56374220-56374242 GCAGCTGGAGGATGTCCAGATGG - Intergenic
911342221 1:96652844-96652866 TCTCCTGGATAATATCCTGAAGG - Intergenic
912431156 1:109629130-109629152 TCTCCTGGAAGTTGGCCAGCTGG - Exonic
915501390 1:156320901-156320923 TGCCCTGGATGCTGTCAAGATGG - Exonic
915673303 1:157508701-157508723 ACTCCTGTATGCTGTCCAAATGG + Intergenic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
918802093 1:188985539-188985561 TCTCCTGGATAATATCCTGAAGG + Intergenic
918987365 1:191650427-191650449 TCTACTGAAAGATTTCCAGATGG + Intergenic
921626354 1:217381220-217381242 TCTGCTGGATAATATCCCGAAGG - Intergenic
921842279 1:219840896-219840918 TCTCCTGGATAATATCCTGAAGG - Intronic
921846465 1:219888266-219888288 TCTCCTGGATAATATCCTGAAGG - Intronic
922158929 1:223063738-223063760 ATTCATGGATGATATCCAGAGGG + Intergenic
1063338151 10:5236343-5236365 TCTTCTGGATAATATCCTGAAGG - Intergenic
1063792728 10:9472823-9472845 ACTTCTGGATGATATCCAGATGG + Intergenic
1064150264 10:12857201-12857223 TTTCCTGGATAATATCCTGAAGG - Intergenic
1065283304 10:24162934-24162956 TCTCTTGGATCATGTCCTCAGGG - Intronic
1065318581 10:24487792-24487814 TCTCCTTGAAGATTACCAGAAGG + Intronic
1065811381 10:29447048-29447070 TCCCCAGGATGGTGCCCAGAGGG + Intergenic
1066699038 10:38106928-38106950 TCTCCTGGATAATATCCTGAAGG - Intronic
1066993326 10:42538276-42538298 TCTCCTGGATAATATCCTGAAGG + Intergenic
1067136911 10:43617398-43617420 TCTCCTCTATGATGGTCAGAAGG - Exonic
1069093319 10:64228553-64228575 TCTTCTGGATAATATCCTGAAGG + Intergenic
1070455460 10:76610070-76610092 TCTCCTGGATAATATCCTGAAGG - Intergenic
1072024622 10:91442651-91442673 TCTCCTGGATAATATCCTGAAGG + Intronic
1072025075 10:91446944-91446966 TCTCCTGGATAATATCCTGAAGG - Intronic
1072854678 10:98934851-98934873 TGCCCTGGATGATATCCTGAAGG + Intronic
1074467072 10:113692682-113692704 TTTGCTGGAAGATGTCCACAAGG + Intronic
1077178555 11:1202338-1202360 TCTGCTGGATGCTCTGCAGAGGG + Intergenic
1077730659 11:4725937-4725959 CCTCTTAGATGATGTCCAGTAGG + Intronic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1079195357 11:18322186-18322208 TCTCCTGGATGACGTCAGCAAGG - Intronic
1079244454 11:18742621-18742643 TCTCCTGGGAGTTGTCCACAAGG + Intronic
1079348016 11:19669857-19669879 TGTCCTGGGTGATGCCCAGTGGG + Intronic
1082876957 11:57998729-57998751 TCTCCTGGATAATATCCTGCCGG + Intergenic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1086129369 11:83384544-83384566 TCTCCTGGATAATATCCTGAAGG - Intergenic
1091488247 12:910345-910367 TTTCCTTTATGATGTCCAAATGG + Exonic
1094120091 12:26963566-26963588 TCTCCTGGATGCTGTCTATGTGG + Intronic
1094758020 12:33494146-33494168 TCTCCTGGATAATATCCTGAAGG - Intergenic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1095270045 12:40207780-40207802 TTTCCTGGCAGATGGCCAGAGGG + Intronic
1096044753 12:48552767-48552789 TCTCCTGGATAATATCCTGCAGG + Intergenic
1096071637 12:48778617-48778639 TCTCCTGGGTGCTGTCCTTAAGG - Intronic
1097382801 12:58915768-58915790 TTTCCTTGATGAACTCCAGATGG - Intronic
1098181896 12:67856232-67856254 TTTCCAGGCTGATATCCAGAAGG + Intergenic
1098680707 12:73349921-73349943 TCTCCTGGATAATATCCTGAAGG + Intergenic
1099061689 12:77918718-77918740 CCTACTGGATGATGACCATATGG - Intronic
1101552739 12:105777503-105777525 TCTCCTGGATAATATCCTGCAGG - Intergenic
1107819306 13:44271979-44272001 GCTCCTGGAGGTTGACCAGATGG - Intergenic
1109034011 13:57231499-57231521 TCTCCTGGATAATATCCTAAAGG - Intergenic
1110809895 13:79800735-79800757 TATCCTAGGTGATTTCCAGAAGG + Intergenic
1110818678 13:79888627-79888649 TCTCCTGGATAATATCCTGAAGG - Intergenic
1111056199 13:82953807-82953829 TATCCTGGATAATATCCTGAAGG + Intergenic
1111269072 13:85856175-85856197 TCTCCTGGAATATATCCTGAAGG + Intergenic
1113052604 13:106230457-106230479 ACTCCTGCATGAAGTCCAGGAGG + Intergenic
1113078652 13:106493081-106493103 TCTCCTGGACGATGTACACCGGG + Exonic
1113651142 13:112035071-112035093 TCTCCTGGCAGATGCCCTGAGGG - Intergenic
1114501916 14:23176116-23176138 TCTACTGGATGTTGACCAGAGGG - Intronic
1115220466 14:31053354-31053376 CCCCCGGGATGATGGCCAGAGGG + Intronic
1116602851 14:46949264-46949286 TCTTCTGGATGATGTACTGTGGG - Intronic
1117859531 14:60075034-60075056 TCTCCTGGATAATATCCTGAAGG - Intergenic
1117900492 14:60527820-60527842 TCTCCTGGATAATATCCTGAAGG + Intergenic
1118104101 14:62638115-62638137 TCTCCTGGATAATATCCTGCAGG - Intergenic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1119433428 14:74583127-74583149 TGTCCTGGAGGAAGACCAGAGGG - Intronic
1120553952 14:85906485-85906507 TCTCCTGGATAATATCCTGAAGG + Intergenic
1121421394 14:93818229-93818251 TCTCCTGGATCATTCCCAGGAGG + Intergenic
1121943135 14:98092386-98092408 GCACCTGGATGCTTTCCAGAAGG - Intergenic
1124724532 15:32144483-32144505 TCTCCTGGATAATATCCTGAAGG + Intronic
1125250217 15:37693058-37693080 TGTGCGGGATGATGTGCAGAAGG - Intergenic
1126168730 15:45676181-45676203 GCTCCTGGATGATCTCCTGCAGG - Exonic
1126264901 15:46742588-46742610 TCTCCTGGATAATATCCCGAAGG - Intergenic
1126394342 15:48197262-48197284 TGCCCTGAATGATGTCTAGAAGG - Intronic
1126554247 15:49967697-49967719 TCTCCTGGATAATATCCTGAAGG - Intronic
1127049449 15:55065428-55065450 TCTCCTGGATAATATCCTGCAGG - Intergenic
1129530274 15:76259666-76259688 TCTCCTGGAAGATCTACAGCGGG - Intronic
1129777111 15:78244005-78244027 CCTCCTTGTTGATGTCCAGAGGG + Intronic
1132859760 16:2064406-2064428 CCTTCTCGATGATGTCCAGCAGG - Exonic
1134673746 16:16074874-16074896 ACTCCTGTATTATCTCCAGATGG + Intronic
1135283685 16:21174546-21174568 AATCCTAGTTGATGTCCAGAAGG + Intronic
1137326166 16:47439258-47439280 TCTCCTGGATAATATCCTGCAGG - Intronic
1138740176 16:59299108-59299130 TCTCTTTGATGATTTCAAGAAGG - Intergenic
1138879968 16:61001249-61001271 TCTCCTGGAAAATGTGCAGCTGG - Intergenic
1139470884 16:67177580-67177602 CCTCCCATATGATGTCCAGAAGG + Intronic
1139874570 16:70135150-70135172 TCCACTGGATTATGTCCTGATGG + Intronic
1140985325 16:80153085-80153107 TCTCCTGGATGCTGTTAAGAGGG - Intergenic
1143579834 17:7818943-7818965 CCTGCTGGATGATGTGCAGCTGG + Exonic
1145861367 17:28213149-28213171 TCTCCTGGATAATATCCTCAAGG - Intergenic
1145905727 17:28515132-28515154 TCTCCTTGAGGATGTCCTCAGGG + Intronic
1146660068 17:34659731-34659753 AGTCCTGGAAGAAGTCCAGAGGG + Intergenic
1150440924 17:65190731-65190753 TCTCCTAGATGATGTCCTATGGG - Intronic
1152547362 17:81008242-81008264 TCTCGAGGATGATGTCCCGCAGG + Intronic
1155516209 18:26625992-26626014 TGTCCTGGATGATGTACATATGG + Intronic
1156187632 18:34681746-34681768 TCTGGTGGAGGATGTCCATAGGG - Intronic
1156855499 18:41776452-41776474 TCTCCTGGATAATATCCTGCAGG - Intergenic
1157844132 18:50986821-50986843 AACCCTGGATGATGCCCAGATGG + Exonic
1158168882 18:54574067-54574089 TCTCCTGGATAATATCCTGCAGG + Intergenic
1158407182 18:57170222-57170244 CCTCCTGGATGATTTCCTCAAGG - Intergenic
1163995882 19:21046901-21046923 TCTTCTGGATGATATCCTGAAGG + Intronic
1164246480 19:23434700-23434722 TCTCCTGGATAATATCCTGCAGG + Intergenic
1165706215 19:37978013-37978035 TCTCCAGGATGAGGTTCAGAGGG + Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925251629 2:2443936-2443958 TGACCTTTATGATGTCCAGATGG - Intergenic
926573252 2:14553019-14553041 TTTCCTGGATGATGCTAAGATGG + Intergenic
926943812 2:18166754-18166776 TCTCCTGGATAATATCCTGAAGG + Intronic
927139070 2:20117703-20117725 CCTCCTGGCTCATGACCAGATGG + Intergenic
928127456 2:28626421-28626443 TCTCCAGGTTGATGTCCTGAGGG - Exonic
930290012 2:49481898-49481920 TCTCCTGGATAATATCCTGCAGG - Intergenic
931665518 2:64607592-64607614 CCTCCTGCAAAATGTCCAGATGG - Intergenic
932549994 2:72758974-72758996 ACTGCTGGAACATGTCCAGAGGG - Intronic
933158138 2:78996475-78996497 TCTGGTGGAGGATGTGCAGATGG - Intergenic
934102583 2:88666979-88667001 TCTCCTGGGTGATGTCTGGTAGG - Intergenic
934113565 2:88764577-88764599 TCTTTTGGATGCTGTCCAGGTGG - Intergenic
935042907 2:99451412-99451434 TCTACTGGATGAAGTTAAGAGGG + Intronic
937987544 2:127644927-127644949 TCTCTTGAAGGAAGTCCAGATGG + Intronic
939072132 2:137556115-137556137 TCTCCTGGATAATATCCTGCAGG - Intronic
939374184 2:141342796-141342818 TCTCCTGGATAATATCCTGAAGG - Intronic
940080436 2:149795178-149795200 TCTCCTGGATAATATCCTGCAGG + Intergenic
941239230 2:163016182-163016204 TCTCCTGCATAATATCCTGAAGG + Intergenic
942958573 2:181803115-181803137 TCTCCTGGATAATATCCTGAAGG + Intergenic
942989752 2:182185925-182185947 TCTGCTGAATGATGTCCACCAGG + Exonic
943233865 2:185292503-185292525 TCTCCTGGATAATATCCTGAAGG - Intergenic
945154636 2:206825770-206825792 TCTTATTGATGATGCCCAGATGG + Intergenic
945655031 2:212612558-212612580 TCTTCTTGATTAAGTCCAGAAGG - Intergenic
947086200 2:226455502-226455524 TCTCCTGGATAATATCCTGAAGG - Intergenic
947754881 2:232554855-232554877 TCTCCTGGATGAAATGCTGAGGG + Intronic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
1169001089 20:2168553-2168575 TCTCCTGGATCATCTCTAAAAGG + Intronic
1169419102 20:5444911-5444933 TCTCCTTGCTGTTCTCCAGAGGG - Intergenic
1173240084 20:41287584-41287606 TCTCTTGGATCATGCCCCGAGGG + Intronic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1174770338 20:53293549-53293571 AGTCTTGGATGTTGTCCAGAGGG + Intronic
1176256774 20:64157077-64157099 TATGGTGGGTGATGTCCAGACGG + Intronic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1177551753 21:22631986-22632008 TGCCCAGGCTGATGTCCAGATGG - Intergenic
1177936991 21:27361160-27361182 TCTCTTGTTTGATGTCCAAATGG - Intergenic
1177951697 21:27545991-27546013 TCTGATGGATGAAATCCAGATGG + Intergenic
1179538668 21:42069150-42069172 TTTCCTGCATGATGGCCGGAGGG - Intronic
1180619408 22:17150393-17150415 TGTCCTGCATAATTTCCAGAAGG + Intronic
1181310681 22:21943100-21943122 ACTCCTGGATGGCCTCCAGAAGG + Intronic
1183866158 22:40705898-40705920 TACCCGGGATGAGGTCCAGAAGG + Intergenic
949456485 3:4244815-4244837 TCTCCTGGATAATATCCTGAAGG + Intronic
949508927 3:4751744-4751766 TCTGCTGGAAGATTTCCAAAGGG - Intronic
951157658 3:19375174-19375196 TCTCCTGGATAATATCCTGCAGG + Intronic
951311064 3:21126437-21126459 TCTCCTGGATAATATCCTGAAGG - Intergenic
954987989 3:54812631-54812653 TCTTCTGGGTGATGCCCAGATGG + Intronic
955968821 3:64416276-64416298 TCCCAAGGCTGATGTCCAGATGG - Intronic
958168048 3:89902536-89902558 TCTTCTGGAATATCTCCAGAAGG + Intergenic
958579723 3:96002251-96002273 TCTCCTGGAGAATCTCCAAAAGG + Intergenic
959218400 3:103482742-103482764 TCTCCTGGATAATATCCTGCAGG + Intergenic
959290554 3:104468389-104468411 TCCCCTGGATAATATCCTGAAGG + Intergenic
960980795 3:123223631-123223653 TTTCCTGGATGAGCTTCAGAAGG + Exonic
961643388 3:128379199-128379221 TCTCCTGGAAGCCGTCCTGACGG + Intronic
962384156 3:134919622-134919644 ACTCCTGTATGATGCCCACATGG - Intronic
962989298 3:140564052-140564074 TCTCCTGGATGAAGTGCTGGTGG - Exonic
963912040 3:150823264-150823286 TCTCCTGTACTAGGTCCAGATGG + Intergenic
965323746 3:167276667-167276689 TCTCCTGGATAATATCCTGCAGG - Intronic
966007362 3:175032184-175032206 TCCCAGGGCTGATGTCCAGATGG + Intronic
967481128 3:189974593-189974615 TCTCCTGGATAACGTCCTGTCGG - Exonic
967638772 3:191836026-191836048 TCTCCTGGATAATATCCTGAAGG - Intergenic
968272174 3:197411481-197411503 TCTCCTGGATAATATCCTGCAGG - Intergenic
968444263 4:641471-641493 TCTCCTTGGTCATGTCCAGGGGG + Intronic
968446284 4:653968-653990 TCTCCTTGGTCATGTCCAGGAGG - Exonic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969391120 4:6892037-6892059 TCTCCTAGATAAACTCCAGAGGG + Intergenic
969517086 4:7653884-7653906 TCTCCAGGGTGAAATCCAGAGGG - Intronic
969909026 4:10426676-10426698 TCTCCTGGATAATATCCTGAAGG + Intergenic
970864233 4:20740158-20740180 TCTCCTGGATAATATCCTGAAGG - Intronic
971441843 4:26695432-26695454 TCTCCTGGATAATATCCTGCAGG - Intronic
972255718 4:37353411-37353433 TCTCCTGGATAATATCCTAAAGG + Intronic
975154673 4:71058402-71058424 TCTCCTGGATAATATCCTGCAGG + Intergenic
976837396 4:89390767-89390789 TCTCCTGGATAATATCCTGCAGG - Intergenic
976848039 4:89512426-89512448 TGTCCTGTAAGATATCCAGATGG + Intergenic
977110159 4:92943138-92943160 TCTCCTGGATAATATCCTGCAGG + Intronic
977668884 4:99672382-99672404 TCTCCTGGATGATATACTGACGG - Intergenic
977816471 4:101418907-101418929 TCTCCAATATGATCTCCAGAAGG - Intronic
979693037 4:123580988-123581010 TCTCCAGGATGATGGCCTCATGG - Intergenic
980069139 4:128224367-128224389 TTCCCTGGATGATGGCTAGAAGG - Intergenic
980858962 4:138476157-138476179 ACTCCTGGAAGATGTCCATGGGG + Intergenic
981618262 4:146665048-146665070 TCTCCTGGATAATATCCTGCAGG - Intergenic
981798881 4:148633128-148633150 TCTTCTGGAACATGTCCTGAAGG + Intergenic
982593410 4:157346827-157346849 TCTCCTGGATCATCTAGAGAAGG - Intronic
982651089 4:158088812-158088834 TCTCCTGGATAATATCCTGCAGG + Intergenic
983173101 4:164558065-164558087 TCTCCTGGATAATATCCTGCAGG + Intergenic
983326724 4:166266961-166266983 TCTCCTGGATAATATCCTGCAGG - Intergenic
983716464 4:170787555-170787577 TCTCCTGGATAATATCCTGCAGG + Intergenic
983879211 4:172913815-172913837 TCTCCTGAATAATATCCTGAAGG - Intronic
983896065 4:173083393-173083415 TCTCCTGGATAATTTCCTGAAGG + Intergenic
984307160 4:178008062-178008084 TCTCAAGGCTGATGTCAAGAAGG - Intergenic
985533930 5:452170-452192 CCTGCTTGATGATGTCCACAAGG + Intronic
985852521 5:2398933-2398955 TCACCTGGATTATGGCCACATGG - Intergenic
987593208 5:19960499-19960521 TCTCCTGGAATATCTCCTGAAGG + Intronic
988221975 5:28357909-28357931 TCTGCTGGATTTTGTGCAGAAGG - Intergenic
988340239 5:29960982-29961004 TGTCTTGGATAATATCCAGAAGG - Intergenic
990369051 5:55098094-55098116 TCTCCTGGATAATATCCTGAAGG - Intergenic
990681914 5:58254548-58254570 TCTCCATGATCATGCCCAGATGG + Intergenic
990837970 5:60043369-60043391 TCTACTGGATAATATCCTGAAGG - Intronic
991538959 5:67705232-67705254 TCTCCTGGATTATATCCTGCAGG - Intergenic
991543817 5:67759110-67759132 TCTCCTGGATAATATCCTGCAGG - Intergenic
992284124 5:75215118-75215140 TCTCCCGGATGATTTCCTGCTGG - Intronic
993380692 5:87203760-87203782 TCTCCTGGATAATATCCTGAAGG + Intergenic
993388639 5:87290709-87290731 TCTCCAGGATGTTGTATAGATGG + Intronic
994142694 5:96359901-96359923 TCTCCTGGATAATATCCTGAAGG + Intergenic
994635145 5:102336763-102336785 TATCCTGGAAAATGTCCATATGG - Intergenic
994721408 5:103384758-103384780 TCTCCTGGATAATGTCCTTAAGG + Intergenic
995790485 5:115881767-115881789 CCTCCTGGATAATATCCTGAAGG + Intronic
995815885 5:116167418-116167440 TCTTCAGGATGTTATCCAGAAGG + Intronic
995826010 5:116300281-116300303 TCTCCTGGATGATGAATAAAAGG - Intronic
997308894 5:132863196-132863218 TCTCTTGGATAATCTCTAGAGGG + Intronic
997512672 5:134464277-134464299 TCTCCAGGAGGAAGTCCACAGGG + Intergenic
999348958 5:150848627-150848649 TGTCCTGGAAAATCTCCAGAAGG + Exonic
1001021927 5:168190419-168190441 CCTGCTGAATGATGTCCAGTGGG - Exonic
1001225289 5:169939390-169939412 TCTTCTGGAATATGTCCTGAAGG + Intronic
1005208370 6:23431329-23431351 TCTCCTGGAAAATATCCGGAAGG + Intergenic
1007686288 6:43669169-43669191 TCTTCTTGATGTTGTCCAGCAGG + Intronic
1007703425 6:43777521-43777543 ACTCCTGGAAGATGTCCACCAGG - Exonic
1008789647 6:55214934-55214956 TCTACTTGATGATGTCCTTAGGG - Intronic
1009290259 6:61871431-61871453 TCTCCTGGATAATATCCTGAAGG - Intronic
1010319050 6:74485441-74485463 TCTCCTGGATAATATCCTGCAGG - Intergenic
1010755538 6:79662714-79662736 TCTCCTGGATAATATCCTGAAGG + Intronic
1011112825 6:83856469-83856491 TTTCCTTGATGAAGACCAGAAGG + Intronic
1013939758 6:115646737-115646759 TCTCCTGGATAATATCCTGAAGG - Intergenic
1014084942 6:117331415-117331437 TCTCCTGGATAATATCCCGAAGG - Intronic
1015291247 6:131540132-131540154 TCTCCTGGATAACATCCTGAAGG - Intergenic
1018416737 6:163608122-163608144 ACACCAGGATGATGTCCACAGGG - Intergenic
1028061670 7:86326188-86326210 TTTCCTGGATAATGTAAAGAAGG - Intergenic
1028508045 7:91591215-91591237 TCTCCTGGATAATATCCTGCAGG - Intergenic
1029967708 7:104757276-104757298 TCCCAAGGCTGATGTCCAGATGG - Intronic
1032445827 7:131982909-131982931 TCTCCTGGATAATATCCTGCAGG + Intergenic
1033709807 7:143930897-143930919 TCGCCTGGATACTGTACAGAAGG + Intergenic
1034330069 7:150274888-150274910 TCTCCTGGATGACGTTCTGGCGG + Intronic
1034667985 7:152834970-152834992 TCTCCTGGATGACGTTCTGGCGG - Intronic
1034703754 7:153121600-153121622 TCTCCTGGATAATATCCTGCAGG + Intergenic
1034973672 7:155435776-155435798 AAGCCTGGAGGATGTCCAGAAGG - Intergenic
1036214414 8:6866969-6866991 TCTTGTGGATGATGACCAGCGGG + Intergenic
1037966811 8:23141093-23141115 TGCCATGGCTGATGTCCAGAGGG - Intronic
1038380791 8:27091356-27091378 AATCCTGGATGCTGTCCAGCTGG - Intergenic
1039319449 8:36412686-36412708 TCTCCTGGATAATATCCTGCAGG + Intergenic
1040518193 8:48151529-48151551 TCTCCTCAAGGATGGCCAGAAGG + Intergenic
1041217291 8:55613477-55613499 TATCCTGGAGGATGTCGTGAGGG + Intergenic
1044726051 8:95195107-95195129 TTTCCCGGAAGCTGTCCAGAGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045177421 8:99740396-99740418 TCTCCTGGATAATATCCTGCAGG - Intronic
1046606835 8:116381036-116381058 TCTACAGAATGATGTGCAGAGGG + Intergenic
1047331925 8:123897227-123897249 TATCCTGGTTGGTATCCAGAGGG - Intronic
1047927472 8:129695601-129695623 TCTCCTGCATGCTGACCACAGGG - Intergenic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1051958412 9:22727505-22727527 TCTCCTGGATAATATCCTGCAGG - Intergenic
1053807521 9:41817909-41817931 GCTCCTGGAAGATCTTCAGAGGG - Intergenic
1054623071 9:67369518-67369540 GCTCCTGGAAGATCTTCAGAGGG + Intergenic
1055179779 9:73371183-73371205 TCTTCTGGAATATGTCCTGAAGG - Intergenic
1057642231 9:96835643-96835665 TCCCCTGGCTTATGTCTAGAGGG + Intronic
1058224107 9:102338782-102338804 TCTCCTGGATAATATCCTGCAGG - Intergenic
1058408624 9:104705030-104705052 TCTCCTGGATGATATCGTGAAGG - Intergenic
1059513526 9:114871254-114871276 TCTCCTGGATAATATCCTGAAGG - Intergenic
1185926268 X:4150445-4150467 TCTCCTGCATTAGGGCCAGATGG + Intergenic
1187363772 X:18650391-18650413 TCTCCTGGAAAATATTCAGAGGG - Exonic
1188790690 X:34404919-34404941 CCACTTGGATGATGTCCAGAGGG + Intergenic
1189367593 X:40400955-40400977 TCACTGGGACGATGTCCAGAAGG - Intergenic
1190120136 X:47652226-47652248 TATCCTGGATGATTTCCACCTGG + Intronic
1190341290 X:49298580-49298602 TCTACTGGATAATATCCTGAAGG + Intronic
1190882563 X:54502982-54503004 TCTACTGGATCATTCCCAGAAGG - Intergenic
1191163576 X:57362670-57362692 TCCAAAGGATGATGTCCAGATGG + Intronic
1191701626 X:64048184-64048206 TCCCTTGGATGAAGACCAGAGGG + Intergenic
1192701880 X:73482701-73482723 TCTCCTGGATAATATCCCTAAGG - Intergenic
1192712466 X:73606061-73606083 TCTCCTGGCTTATATCCTGAAGG + Intronic
1192984424 X:76381294-76381316 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193243172 X:79196846-79196868 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193510171 X:82389656-82389678 TCTCTTGGATAATATCCTGAAGG - Intergenic
1193528256 X:82620149-82620171 TCTCCTGGATGATACCCTGAAGG - Intergenic
1195810467 X:108823781-108823803 TCTCCTGGATAATATCCTTATGG + Intergenic
1196474624 X:116068464-116068486 TCTCCTGGATAATATCCTGCTGG + Intergenic
1196944803 X:120813084-120813106 TCTCCTGGATAATATCCTGCAGG - Intergenic
1197183459 X:123561987-123562009 TGTCCTGGACGTGGTCCAGAAGG + Intergenic
1197649164 X:129045803-129045825 TCTCCTGGATAATATCCTGCAGG - Intergenic
1197813405 X:130471101-130471123 TCTCCAGCATGGTGTCCAGGGGG - Intergenic
1198193451 X:134334806-134334828 TCTTCTGGAATATCTCCAGAAGG + Intergenic
1199500752 X:148503117-148503139 TTTCCTGGATCATGTACAGAGGG - Intronic
1200365250 X:155656165-155656187 TCTCCTGGATAATATACTGAAGG + Intronic
1201541430 Y:15109350-15109372 TCTCCTGGATAATATCCTGAAGG + Intergenic
1202020666 Y:20461841-20461863 TCTCCTGGGTAATATCCTGATGG + Intergenic
1202041888 Y:20694445-20694467 TCTCCTGGATAGTATCCTGAAGG + Intergenic