ID: 1085703173

View in Genome Browser
Species Human (GRCh38)
Location 11:78763332-78763354
Sequence GGGGCCACTCGAGTGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085703173_1085703183 5 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703183 11:78763360-78763382 GGGAGTGGAGGGCAAAGAAAAGG 0: 1
1: 0
2: 7
3: 175
4: 1741
1085703173_1085703184 6 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703184 11:78763361-78763383 GGAGTGGAGGGCAAAGAAAAGGG 0: 1
1: 2
2: 10
3: 76
4: 791
1085703173_1085703178 -7 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703178 11:78763348-78763370 TGGCCCCTGATGGGGAGTGGAGG 0: 1
1: 0
2: 4
3: 80
4: 703
1085703173_1085703185 7 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703185 11:78763362-78763384 GAGTGGAGGGCAAAGAAAAGGGG 0: 1
1: 0
2: 7
3: 88
4: 772
1085703173_1085703187 20 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703187 11:78763375-78763397 AGAAAAGGGGGAAAAAAAGAAGG 0: 2
1: 5
2: 45
3: 485
4: 3085
1085703173_1085703179 -6 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703179 11:78763349-78763371 GGCCCCTGATGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 402
1085703173_1085703189 22 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703189 11:78763377-78763399 AAAAGGGGGAAAAAAAGAAGGGG 0: 2
1: 4
2: 27
3: 395
4: 2364
1085703173_1085703186 8 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703186 11:78763363-78763385 AGTGGAGGGCAAAGAAAAGGGGG 0: 1
1: 0
2: 10
3: 90
4: 855
1085703173_1085703190 23 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703190 11:78763378-78763400 AAAGGGGGAAAAAAAGAAGGGGG 0: 1
1: 3
2: 32
3: 302
4: 2603
1085703173_1085703177 -10 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703177 11:78763345-78763367 GAGTGGCCCCTGATGGGGAGTGG 0: 1
1: 0
2: 3
3: 42
4: 275
1085703173_1085703188 21 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703188 11:78763376-78763398 GAAAAGGGGGAAAAAAAGAAGGG 0: 1
1: 3
2: 44
3: 454
4: 2771
1085703173_1085703191 24 Left 1085703173 11:78763332-78763354 CCATGCTGCACTCGAGTGGCCCC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1085703191 11:78763379-78763401 AAGGGGGAAAAAAAGAAGGGGGG 0: 1
1: 3
2: 30
3: 341
4: 2956

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085703173 Original CRISPR GGGGCCACTCGAGTGCAGCA TGG (reversed) Intronic
900288013 1:1911017-1911039 GGGTCCACTCGACCGCAGCGAGG + Intergenic
900674381 1:3875460-3875482 TGGGACACTCGAGAGCAGCCTGG - Intronic
903590780 1:24454305-24454327 GAGGCCACTCAAGAGCAGCGCGG - Intronic
904456946 1:30653662-30653684 GGGGCACCTCGAGTGCAGATGGG - Intergenic
905553177 1:38859841-38859863 GCTGCTACTCGAGAGCAGCAGGG + Intronic
907306025 1:53513624-53513646 GGGGCCAGTGGTGTGCGGCAAGG - Intronic
907427228 1:54387847-54387869 GAAGCGACTCGAGTGCAGCAAGG - Intronic
911424389 1:97687964-97687986 GGGGCCAGTTGAGTGGGGCAGGG + Intronic
913546139 1:119871085-119871107 GGGGCCACAAGAGTGCGCCATGG + Intergenic
917133513 1:171765434-171765456 GGGGCCACTGCACTCCAGCATGG + Intergenic
920569812 1:207008220-207008242 GGGGCCCCTAGAGGGCAGAATGG + Intronic
922767999 1:228165986-228166008 GGGGCCACGCACGCGCAGCAGGG - Exonic
1069543872 10:69315654-69315676 GGGGACACAGCAGTGCAGCATGG + Intronic
1070061011 10:72982395-72982417 GAGAGCACTAGAGTGCAGCAGGG - Intergenic
1084569701 11:69951906-69951928 GGGGTCACTCGAGTGACGCAGGG + Intergenic
1085703173 11:78763332-78763354 GGGGCCACTCGAGTGCAGCATGG - Intronic
1089500320 11:118928191-118928213 GGAGCCGCTCGATTCCAGCAAGG - Intronic
1093000474 12:13990482-13990504 GGGGCCACTGCAGTGTTGCATGG - Intergenic
1097317796 12:58190843-58190865 GGGGCATCCAGAGTGCAGCAGGG - Intergenic
1099422180 12:82474344-82474366 GAGAGCACTGGAGTGCAGCAGGG - Intronic
1110654624 13:77982854-77982876 GGTGACACTGCAGTGCAGCAAGG - Intergenic
1112402285 13:99086987-99087009 GGGTCCCCTCGAGCGCAGCCGGG - Intergenic
1114263863 14:21059536-21059558 TGGGCCACTGCACTGCAGCATGG - Intronic
1115119794 14:29926832-29926854 GGGGGCACTCTGGTGCAGGAAGG + Intronic
1121017421 14:90557016-90557038 GCGGCCACTGCAGTGCTGCACGG + Intronic
1122811325 14:104290849-104290871 GGGGCTTCTCGAGGTCAGCAGGG + Intergenic
1124418190 15:29491312-29491334 GGGGCTCCTACAGTGCAGCAGGG + Intronic
1126083142 15:44985212-44985234 GGTGCCACTGGACTGCAGCCTGG - Intergenic
1126713005 15:51482903-51482925 GAGAGCACTAGAGTGCAGCAGGG + Intronic
1128066220 15:64766280-64766302 GAGGCCTCTGGAGTGCAGCAGGG - Intronic
1128977622 15:72165093-72165115 GGTGCCACTGCACTGCAGCATGG + Intronic
1129427137 15:75471966-75471988 GGGGCCACTGGAGGGTGGCAAGG - Intronic
1131660046 15:94504888-94504910 GAGAGCACTGGAGTGCAGCAAGG + Intergenic
1133345649 16:5068580-5068602 GGGGCCACTGCACTGCAGCCTGG + Intronic
1134647140 16:15878008-15878030 GGGGCCACTGCACTCCAGCATGG + Intronic
1136136592 16:28260003-28260025 GGTGCCACTGCAGTGCAGGATGG - Intergenic
1136410602 16:30074789-30074811 GGCGCCACTGGACTGCAGCCTGG + Intergenic
1139504091 16:67390449-67390471 GTGGCCACCCGAGACCAGCAGGG + Intronic
1141245130 16:82298867-82298889 ATGGCCACTTGTGTGCAGCAGGG + Intergenic
1143472832 17:7186628-7186650 GAGGCCACTGGAGTGGAGTAGGG - Intergenic
1146581242 17:34040230-34040252 GGGGCCACTCGGGTGCGGCGCGG + Intronic
1146768110 17:35542477-35542499 GGGGCCACTACACTGCAGCTTGG - Intergenic
1148623255 17:49050420-49050442 GGGGCCACTCAAGTCCTCCATGG - Exonic
1150108516 17:62478907-62478929 GGGGCCACTCGGGTGCGGCGCGG - Intronic
1151686292 17:75648715-75648737 GGTGCCACTACAGTGCAGCCTGG - Intronic
1152408684 17:80111350-80111372 GGCCCAACTCGAATGCAGCACGG + Intergenic
1152764539 17:82128867-82128889 GGGGCCACTCGTGTCCATCTTGG - Intronic
1153174598 18:2356823-2356845 GGGACCACTATAGTTCAGCATGG - Intergenic
1156390726 18:36648297-36648319 GAGGTCACTGGAGTTCAGCAAGG + Intronic
1160394416 18:78561365-78561387 AGGCCCACGTGAGTGCAGCAAGG - Intergenic
1162746602 19:12802053-12802075 GGGGCCGTTGGAGTCCAGCATGG + Intronic
1163935428 19:20438337-20438359 GGTGCCACTGCAGTCCAGCATGG - Intergenic
1165245776 19:34497721-34497743 GGGGCCACTCGCCTGCACCCAGG - Intronic
1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG + Intronic
1168171789 19:54594526-54594548 GGGGCCACCCCCGTGCAGCTGGG + Intronic
1168241488 19:55091284-55091306 GGGGCCACCCGAGGCCAGGATGG - Exonic
925174356 2:1771814-1771836 GGGGCCTCTGGGGTGCAGCCTGG - Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
927155140 2:20216995-20217017 AGGACCACTCGTGTGCACCATGG - Intronic
930639284 2:53838853-53838875 GGTGCCACTGGAGTCCAGCCTGG + Intergenic
934976162 2:98803946-98803968 GGGGCCACACCACTGCGGCAGGG + Intronic
935357321 2:102214908-102214930 GAGGGCGCTGGAGTGCAGCATGG + Intronic
936016349 2:108961827-108961849 GGGGCCATTAGTGTGAAGCAAGG - Intronic
943349217 2:186778458-186778480 GAGAACACTGGAGTGCAGCAGGG + Intergenic
1168835241 20:873308-873330 GGGGCCTCTAGAGGGCAGCAAGG + Intronic
1172208593 20:33181884-33181906 GGGACCCCTAGAGGGCAGCAGGG - Intergenic
1173270773 20:41532939-41532961 AGGCCCACAGGAGTGCAGCAGGG + Intronic
1174543386 20:51306962-51306984 GTGGCCACTCTAGGGCAGCCCGG + Intergenic
1176916604 21:14633389-14633411 GGAGCCATTTTAGTGCAGCATGG + Intronic
1179799611 21:43804810-43804832 GGGGACACTCGAATGCAGCAGGG - Exonic
1179833854 21:44015499-44015521 GGGGTCACTTGAGCCCAGCAAGG - Intronic
1182226413 22:28801838-28801860 GGGGCCCCCAGAGAGCAGCACGG + Intergenic
1182305387 22:29364460-29364482 GGGGCCACTGCACTCCAGCATGG - Intronic
1185074791 22:48677402-48677424 CGGGCCACGCGATTGCAGAAGGG + Intronic
950638441 3:14332613-14332635 AGGGCCCCCCTAGTGCAGCAGGG - Intergenic
950995870 3:17495027-17495049 GGGGCCACCCGGGAGCCGCACGG - Intronic
958627702 3:96646831-96646853 GGGGCCCCCACAGTGCAGCAGGG + Intergenic
960997026 3:123347027-123347049 GCGGCCACTTGGGTGCAGCCTGG + Intronic
969614922 4:8246729-8246751 GGGGCCTCTCGAGGGCACCCAGG + Intergenic
970792801 4:19879172-19879194 GGGACCACTTCAGTGCAGGAGGG + Intergenic
973091038 4:46137019-46137041 CGGGCCACTGGACTCCAGCATGG - Intergenic
975305685 4:72846663-72846685 GGAGCCACTGCAGCGCAGCAAGG + Intergenic
978168239 4:105634653-105634675 GGGGCCTCTGAAATGCAGCAGGG - Intronic
978409502 4:108411708-108411730 GGGACCTCTGGAGTGCATCATGG + Intergenic
985807081 5:2053772-2053794 GGGCCCACCCCTGTGCAGCAAGG - Intergenic
987163607 5:15171153-15171175 CGCGCCACTCGACTGCAGCCTGG + Intergenic
991310622 5:65237342-65237364 TGGGCCACTGCAGTGCAGCCTGG + Intronic
994822524 5:104671940-104671962 GGGGCCACTGCACTGCAGCCTGG + Intergenic
1000382356 5:160640555-160640577 GGGGCCACTGTTGTTCAGCATGG + Exonic
1002064682 5:176646191-176646213 GGGGCCACAGGACAGCAGCAGGG + Exonic
1002156401 5:177284322-177284344 GGTGCCACTGTAGTGCAGCCTGG - Intronic
1002530373 5:179840986-179841008 GGTGCCACTGGAGAGTAGCACGG - Intronic
1006385132 6:33726613-33726635 GGGGCCAATGGAGGGTAGCAGGG - Intronic
1012878459 6:104757077-104757099 GTGGCCACTGGAGCTCAGCAAGG + Intronic
1015078441 6:129192716-129192738 GGAGCCACTCGAATGCGGCCAGG - Exonic
1016459853 6:144271029-144271051 GGGGCCACTGCACTCCAGCATGG - Intergenic
1018596183 6:165483122-165483144 GGGGCCACTGGAGCTCAGCCTGG + Intronic
1019565845 7:1678679-1678701 GGGGCCAGGCAAGGGCAGCAGGG - Intergenic
1019667594 7:2259538-2259560 GGGTCCCCTGGGGTGCAGCAGGG - Intronic
1021996856 7:26187408-26187430 GGGGCCACTGCACTTCAGCATGG - Intergenic
1023364904 7:39453962-39453984 GTGGCAACTCAAGTCCAGCAAGG - Intronic
1024261774 7:47578825-47578847 GGGGCTTTTCGAGTGCAGCTCGG - Intronic
1029286243 7:99468138-99468160 GGGGCCACTGCACTGCAGCCTGG + Intergenic
1029559252 7:101291597-101291619 GGTGCCACTGCATTGCAGCATGG + Intergenic
1032037552 7:128531448-128531470 GGGGCCACTCGGGTGCGGCGCGG - Intergenic
1032382982 7:131503484-131503506 GGGGACACTCGAGTCCAGGCTGG - Intronic
1032855419 7:135829813-135829835 AGAGCCCCTGGAGTGCAGCACGG + Intergenic
1034775999 7:153827643-153827665 GCGGCCACTCTAGTCCAACAAGG + Intergenic
1036540259 8:9700975-9700997 GGGGCCACTGCACTGCAGCCTGG - Intronic
1038178833 8:25206953-25206975 GGGGCCACTCTAGGGCTGTAGGG - Intronic
1045163856 8:99580806-99580828 GGTGCCACTCCACTCCAGCATGG + Intronic
1045231439 8:100310292-100310314 GGGGCCACCCGGGTGCAGCGGGG - Intronic
1049730485 8:144175209-144175231 GGGGCAGCTTGGGTGCAGCAGGG - Intronic
1049730501 8:144175267-144175289 GGGGCAGCTTGGGTGCAGCAGGG - Intronic
1050630802 9:7556404-7556426 GGGACCACTCAAGAGCATCATGG + Intergenic
1052933413 9:34074181-34074203 GGGGCCACTCCACTCCAGCCTGG + Intergenic
1057055289 9:91955858-91955880 GGTGCCACTGGAGTCCAGCCTGG + Intergenic
1057222183 9:93263367-93263389 CGTGCCACTTGGGTGCAGCAGGG + Intronic
1059492055 9:114676205-114676227 GGTGCCACTACAGTCCAGCACGG - Intergenic
1062101421 9:134730573-134730595 GGGGCCACCCGAGGACACCAAGG - Intronic
1062626950 9:137447722-137447744 GGGGCCACTGGTGCGCAGCCTGG - Exonic
1185820914 X:3203645-3203667 GGGGCCACTGCACTGCAGCTTGG - Intergenic
1191250449 X:58257649-58257671 GGGGCCACTCCAAGGCAGCAAGG + Intergenic
1193271117 X:79530916-79530938 GGGACCCCTCGCGTGGAGCAGGG - Intergenic
1196503702 X:116415321-116415343 AGCGCCACTGCAGTGCAGCAGGG + Intergenic
1200117858 X:153777003-153777025 GGGGCCACTGGAGTCCAGGCTGG + Intronic
1200748448 Y:6923009-6923031 GGGGCCCCCACAGTGCAGCAGGG + Intronic
1202045304 Y:20731517-20731539 GGTGCCACTGCAGTGCAGCCTGG - Intergenic