ID: 1085703204

View in Genome Browser
Species Human (GRCh38)
Location 11:78763480-78763502
Sequence GCTCACATGCTGCTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085703200_1085703204 1 Left 1085703200 11:78763456-78763478 CCCTTGAACTTGAAGCTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG 0: 1
1: 0
2: 1
3: 15
4: 203
1085703199_1085703204 6 Left 1085703199 11:78763451-78763473 CCTGACCCTTGAACTTGAAGCTC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG 0: 1
1: 0
2: 1
3: 15
4: 203
1085703198_1085703204 25 Left 1085703198 11:78763432-78763454 CCAAAGTGGTTCACATATTCCTG 0: 1
1: 0
2: 1
3: 8
4: 273
Right 1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG 0: 1
1: 0
2: 1
3: 15
4: 203
1085703202_1085703204 0 Left 1085703202 11:78763457-78763479 CCTTGAACTTGAAGCTCTGTGGT 0: 1
1: 0
2: 3
3: 12
4: 179
Right 1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG 0: 1
1: 0
2: 1
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085703204 Original CRISPR GCTCACATGCTGCTGGTGCA TGG Intronic
900473859 1:2867290-2867312 GCTCCCACGCAGCTGGGGCAGGG - Intergenic
900744058 1:4348982-4349004 GCACACAGGGTGCAGGTGCATGG + Intergenic
903421104 1:23218119-23218141 GCTCAAATGCTACTTTTGCAGGG - Intergenic
904607615 1:31706644-31706666 GCCTGCATGCTGCTGCTGCATGG + Intergenic
905581046 1:39082598-39082620 GCTCACACGCTGCTGGCACAAGG + Intronic
907483766 1:54762544-54762566 ACACAGATGCTGCTGGTCCAGGG + Intronic
908097555 1:60755236-60755258 ACTCATATGCTGCTGGTGGGAGG - Intergenic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
911522769 1:98948254-98948276 GCTCACAGGCTGCTGAGACAAGG - Intronic
911881817 1:103249240-103249262 GTTCACATGCTGGTAGTGTATGG - Intergenic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
919557930 1:199084407-199084429 GCTTTCATCCTGCTGGGGCAGGG - Intergenic
919664204 1:200276651-200276673 GGTCACCTGCTGGGGGTGCAGGG - Intergenic
921382058 1:214534122-214534144 CCTCACATCCTGCTAGTGCTGGG - Intronic
921800725 1:219399482-219399504 TCACACATGCTGGTGGAGCAAGG + Intergenic
922726760 1:227926376-227926398 GCTCACCTGCTGCTGCTGCTGGG + Intronic
922771257 1:228184558-228184580 ACTCACACACTGCTGGTGGAAGG - Intergenic
923547023 1:234930449-234930471 GCTCACATCCTCCTTGTCCATGG + Intergenic
924159797 1:241219063-241219085 GCTCACATCCAGCTGGTGTGAGG + Intronic
1063380654 10:5583532-5583554 AGGCACATGCTGGTGGTGCATGG + Intergenic
1067547384 10:47203598-47203620 ACTTACATGCTGTTGGTGCAAGG - Intergenic
1069860376 10:71467509-71467531 CCTCACAGGCTGGTGGTGCTGGG - Intronic
1069870708 10:71531173-71531195 GTTCACACGCTGCTGCTGCTGGG - Intronic
1070811598 10:79300872-79300894 GCACACGTGCTTCAGGTGCAGGG - Exonic
1071131632 10:82400486-82400508 ACACACATGCTGCTGATCCATGG + Intronic
1071491730 10:86140880-86140902 GCCCACCTCCTGTTGGTGCATGG + Intronic
1073188175 10:101629976-101629998 GCTCAGAGGCTGCTGGGGCCTGG - Intronic
1073412124 10:103350940-103350962 CCTCACCCGCTGCGGGTGCAGGG + Exonic
1075413455 10:122246108-122246130 ACGCAGATGCTGCTGGGGCAGGG - Intronic
1075477305 10:122746847-122746869 CCTCACTTGCTGCTGTTCCAGGG + Intergenic
1079020201 11:16904221-16904243 ACTCAGATGTTGCTTGTGCATGG - Intronic
1079130337 11:17743610-17743632 GATCAGAAGCTGCTTGTGCAGGG + Intronic
1079626134 11:22619082-22619104 GCTCAGAGGCTGCTGCTGCCTGG + Intergenic
1081746325 11:45474880-45474902 GCTCAGGTTCTGCTGGTGCCAGG + Intergenic
1082055235 11:47809308-47809330 TCTCATATACTGCTGGTGCTGGG + Intronic
1085200181 11:74697110-74697132 GTTCCCAGGCTGCTGGTGCCGGG - Intronic
1085459008 11:76681869-76681891 GCTGACATGCTGCCTGTGCCTGG + Intergenic
1085514011 11:77102027-77102049 GGTGACATGCTGCTGGGCCAGGG - Intronic
1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG + Intronic
1085856440 11:80181414-80181436 TCTCACATGCTGGTGGGGTAAGG + Intergenic
1092821661 12:12358614-12358636 GCTCGAATGCTGTTGGTTCATGG - Intronic
1097496711 12:60348503-60348525 GCTCACATTCTCCTGGTCAAAGG - Intergenic
1097573127 12:61357019-61357041 TCTCACATGCTGCTGCTGCGAGG - Intergenic
1098077599 12:66749664-66749686 GCTCACATCCAGTTGCTGCAGGG - Intronic
1098336314 12:69408567-69408589 CCTCACAGCCTGCTGGTGCCAGG - Intergenic
1099393343 12:82106881-82106903 GCTCACATGCTGTTGGCCAAAGG - Intergenic
1100334024 12:93612699-93612721 GCTGACATCCTCCTGGTGCCAGG - Intergenic
1100386984 12:94112753-94112775 GCTCATATGCTTCTGGAGCCTGG - Intergenic
1100879781 12:99003908-99003930 ACTCTCATGCTGCTGGGGGATGG + Intronic
1104915158 12:132260626-132260648 GGTCACATTCTCCTGGGGCAAGG + Intronic
1106528515 13:30565673-30565695 GCACTGATGCTGCTGGTCCATGG + Intronic
1106558171 13:30827846-30827868 GCGACCATGCTGCTGGTTCAGGG - Intergenic
1107481953 13:40792523-40792545 GAACACATGATGCTTGTGCACGG + Intronic
1109643940 13:65227788-65227810 GCTCACATGATGGTGATGCTGGG + Intergenic
1113328697 13:109308386-109308408 CCTCCCAAGCTGCTGGTGAAGGG - Intergenic
1116594980 14:46829607-46829629 GATCCAAGGCTGCTGGTGCAGGG + Intergenic
1118120944 14:62841745-62841767 GCCCACATGGTGCTTGCGCAAGG - Intronic
1121641817 14:95489817-95489839 TTTCACATGCTGCTGGCTCAGGG + Intergenic
1123223030 14:106874306-106874328 GCTCACATGTGTCTGGAGCAGGG + Intergenic
1125464058 15:39933940-39933962 GCCCACATCCTGCTGGGGGAAGG - Intergenic
1125922613 15:43534529-43534551 AATCACATGTTGCTGGTGGAAGG + Exonic
1126387811 15:48111909-48111931 CCTCAGTTGCTGCTGTTGCATGG - Intergenic
1128110759 15:65074802-65074824 GCCCGCACGCTGCAGGTGCACGG + Intronic
1131073098 15:89478039-89478061 GCTCACTTGCTGGCTGTGCAAGG + Intronic
1131968230 15:97867618-97867640 GCACCCATGCTGCTGGTGCAGGG + Intergenic
1132162767 15:99557962-99557984 GCACACGTGCGGCTGGAGCAAGG - Intergenic
1132211863 15:100029853-100029875 GCACTCATGATGCTGGTCCAGGG - Intronic
1133234508 16:4381671-4381693 GCTCACATCCAGCTCCTGCAGGG - Exonic
1133521536 16:6563043-6563065 ACTCAGATGCTGCAGGGGCAGGG + Intronic
1133806883 16:9132493-9132515 GCTCACATGCTGCTGCTGAGAGG + Intergenic
1134621558 16:15693329-15693351 TCTCATGTGCTGCTGGTGCATGG + Intronic
1135485642 16:22862491-22862513 GCTCACATGCTGCAGGAGCCGGG - Intronic
1137002861 16:35246420-35246442 GCTCACATGCTTCCTCTGCAGGG - Intergenic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1139276111 16:65728995-65729017 TCCCAGATGCTGCTGGTTCAGGG + Intergenic
1140329029 16:74035003-74035025 GCTCAAATGCTGCTGGGGACTGG + Intergenic
1140600918 16:76473978-76474000 GTTCCCAAGCTGTTGGTGCATGG + Intronic
1140789057 16:78372642-78372664 GCCCACTTCCTGCTGGTGCATGG + Intronic
1140997898 16:80278871-80278893 GGTCAACTGCTGCTGGTGCAGGG - Intergenic
1142221667 16:88857859-88857881 GCCCACACGCTCCTGCTGCACGG + Intronic
1144203643 17:12963658-12963680 GCTCACACGGCACTGGTGCAAGG - Intronic
1145273913 17:21418828-21418850 GGTCACTTGGTGCTGGTGTAGGG + Exonic
1148198870 17:45734639-45734661 TCTCCCGTGCTGCTGGTCCAAGG + Intergenic
1148460989 17:47838849-47838871 GCGCACAGGCTGCTGGGTCAGGG + Exonic
1148478476 17:47944632-47944654 GCTCGCATGTTGCTGCTGAAGGG + Exonic
1148819944 17:50354482-50354504 GCCTACATGCTGGTGGTTCACGG + Exonic
1150651222 17:67011516-67011538 GCTCTCATTCTGGTGGAGCAGGG - Intronic
1150652052 17:67016683-67016705 GCTCCCAGGCTGCAGGAGCAGGG + Intronic
1151422642 17:74008479-74008501 GATCACAAGCTGCAGGTGCTGGG + Intergenic
1154002848 18:10498589-10498611 GCTGCAATGCTGCTGGTCCAGGG - Intergenic
1154356805 18:13627801-13627823 GCAGAGAGGCTGCTGGTGCAGGG - Intronic
1155252547 18:23966108-23966130 TCTCAGATGCTTCTGCTGCAAGG - Intergenic
1157701623 18:49764488-49764510 GCACACATGCTGCAGGTGACGGG - Intergenic
1159930844 18:74311734-74311756 GCACACTGGCTGCTGCTGCAGGG + Intergenic
1160156842 18:76441239-76441261 GCTCACCTGGTGCAGGTTCAGGG + Exonic
1160402044 18:78618431-78618453 TCCCCCATGCTGCAGGTGCATGG + Intergenic
1163800015 19:19358979-19359001 CCTCATATGCTGATGGAGCATGG - Intergenic
1164439157 19:28258880-28258902 GGTCACAAGCTCCTGGAGCAGGG + Intergenic
1165480152 19:36058527-36058549 GCTCACATTCTACTGGTGATGGG - Intronic
1168268615 19:55237359-55237381 TCTCACATTCTGCTTGTGCCTGG - Intronic
925781518 2:7386416-7386438 TCTCACATGCTGCTAGTGTCTGG - Intergenic
926649499 2:15326855-15326877 ACTCACATGCTGCTGGAGAGAGG - Intronic
927163886 2:20297637-20297659 GCACAAATGCAGCTGGAGCAAGG + Exonic
930056604 2:47257174-47257196 GCTCAGATGCTGCAGGAGCCAGG + Intergenic
932260760 2:70325185-70325207 GAGCCCAGGCTGCTGGTGCATGG + Intergenic
934725668 2:96616776-96616798 CCTCCCATGCTGCTGGGCCACGG - Intronic
937077703 2:119118801-119118823 GCTCCCTTGCTGCTGGGGCTGGG - Intergenic
938161349 2:128987218-128987240 GCTCAACAGCTGCTGGTGCAGGG + Intergenic
939404268 2:141735786-141735808 GCTGACATGCTGCTCTTGCTAGG - Intronic
943449351 2:188028641-188028663 GCTCACACTCTGCTTGGGCAGGG + Intergenic
943711509 2:191100859-191100881 GTTGACATGCTGCTGATTCAGGG - Intronic
946723858 2:222641582-222641604 ATTCAGATGCTGCTGGTCCATGG + Intronic
946840233 2:223812510-223812532 GCTCACATGCTGGCTGGGCACGG - Intronic
948084772 2:235238290-235238312 GTGCTGATGCTGCTGGTGCAGGG - Intergenic
1169329459 20:4705162-4705184 GATGCAATGCTGCTGGTGCAAGG + Intergenic
1170084576 20:12514575-12514597 CCTGACAGGCTGCTGATGCAAGG + Intergenic
1170672103 20:18443943-18443965 GGCCAGATGCTGCTGGGGCAGGG - Intronic
1171044077 20:21794092-21794114 GCTCTCAGGCTGCTGGTGGGAGG + Intergenic
1173322305 20:41999001-41999023 GCCCGCCTGCTGCTGCTGCAGGG + Intergenic
1173549973 20:43925947-43925969 GCTCACTTCCTCCTGCTGCAGGG + Intronic
1175549627 20:59808698-59808720 GTTCTGATGCTGCAGGTGCAGGG + Intronic
1178027304 21:28482965-28482987 GTGCAGATGCTGCTGGTGCCAGG - Intergenic
1180132768 21:45837142-45837164 GCTAACACGCTGCTGGGGGATGG - Intronic
1180945266 22:19689037-19689059 GCTCACAGGCTGCGGGTGTGGGG + Intergenic
1181163586 22:20971759-20971781 CCTCCCAGGCTGCTGCTGCAGGG - Intronic
1182100060 22:27651358-27651380 GATCACATGAAGCTGGTGCCAGG - Intergenic
1184595357 22:45510565-45510587 GCTCACAGGCTGCTGGGGATGGG + Intronic
1185013452 22:48329790-48329812 GCTCACATGTTGCTGCTGGCAGG - Intergenic
949097796 3:106661-106683 ACTCACATGCTGCTGGTTGCTGG - Intergenic
950244261 3:11401072-11401094 GCACTGATGCTGCTGGTGCTCGG - Intronic
950754112 3:15158085-15158107 GCTCCCATGCTGCTGAAACAAGG - Intergenic
951264613 3:20551521-20551543 GATCCCATGCTGCTGGTCCAAGG - Intergenic
953017524 3:39092471-39092493 CATCCCATGCTGCAGGTGCATGG - Intronic
953224260 3:41001995-41002017 ATGCTCATGCTGCTGGTGCATGG + Intergenic
953277751 3:41519979-41520001 GTTCACATTCTGCTGGTGAGAGG - Intronic
953741412 3:45542149-45542171 GCTCACATGCTTCTGGTGTGTGG - Intronic
960323640 3:116267959-116267981 GCTTTCATCCTCCTGGTGCAAGG - Intronic
961639137 3:128353906-128353928 GCTCACCTGCTGCTGGGAAAGGG + Intronic
962240025 3:133744407-133744429 GCACACATACAGCTGATGCATGG - Intergenic
962951613 3:140224981-140225003 GCGCACTTGCTGGTGGAGCAGGG - Intronic
963855948 3:150253832-150253854 GCCCACAGGATGATGGTGCAGGG + Intergenic
964989120 3:162784944-162784966 ATTCTGATGCTGCTGGTGCAGGG - Intergenic
965395571 3:168157188-168157210 GCTCACAGGCTGATGATGAAAGG - Intergenic
966317273 3:178661675-178661697 ATTCTAATGCTGCTGGTGCATGG - Intronic
967432907 3:189408227-189408249 GCTCATATACTGCTAGTGGAAGG + Intergenic
968431338 4:560931-560953 CCACACATGCTGCTGCTGGAAGG - Intergenic
968795965 4:2704657-2704679 ACTCAGATGCTGCTGGTGGGTGG - Intronic
968947000 4:3670414-3670436 TCTCACAGGCTGATGGTGCCTGG - Intergenic
970395320 4:15659493-15659515 GCTCACATTCTCCTGGTAGAAGG - Intronic
970424848 4:15936565-15936587 GCTCAGGTGCTCCTGGTGGAGGG - Exonic
971376027 4:26056405-26056427 GGTCTCATGATGCTGGTGCCGGG - Intergenic
972097314 4:35364393-35364415 GCTCAGACTCTGCTGGGGCAGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
979545190 4:121932491-121932513 GTGCACATGCTGCTGATGAAGGG - Exonic
980532200 4:134070578-134070600 ACTCACATGCCGCTGGAGGAGGG + Intergenic
980740811 4:136947426-136947448 GCACACTGGCTGCTGGAGCAGGG - Intergenic
981898756 4:149836073-149836095 TCTCACATTCTGTTGCTGCAAGG + Intergenic
984012222 4:174384113-174384135 GATCTCATGCTGCTGGAGGACGG - Intergenic
984029498 4:174585846-174585868 GCTCAACTGATGGTGGTGCATGG - Intergenic
985948098 5:3202231-3202253 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948110 5:3202295-3202317 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948122 5:3202359-3202381 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948134 5:3202423-3202445 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948145 5:3202487-3202509 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948157 5:3202551-3202573 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
989079937 5:37607885-37607907 GCTCAAATTATGCTGGTGAATGG - Intronic
989255769 5:39364457-39364479 GCTGACATGCTGCTCTTGCTGGG + Exonic
992286145 5:75237186-75237208 GCTCACAAGCATCAGGTGCATGG - Intergenic
993018029 5:82558710-82558732 GTTCACTTTCTGCTGGTCCAGGG + Intergenic
994870984 5:105350599-105350621 GCTCAGATGCTCCTTGGGCATGG + Intergenic
1005692937 6:28324419-28324441 CCTCAGATGCTGCTGGTTCATGG - Intergenic
1006730497 6:36232540-36232562 GCTCAGATCCTGCTGTGGCACGG + Exonic
1006917199 6:37602281-37602303 AAGCACATGCTGCTGGGGCAGGG - Intergenic
1007791304 6:44310398-44310420 GTCCACATGCCGCTGGGGCAGGG + Exonic
1008406013 6:51119407-51119429 GCCCACATTTTTCTGGTGCAGGG + Intergenic
1008621539 6:53276275-53276297 GCTCAGATGCTGTTGGTGACTGG - Intronic
1009773469 6:68175297-68175319 GCTTGCATGCTGGTGGTGAAGGG - Intergenic
1010392063 6:75349307-75349329 GCTGAAATGCTTCTGGTGCCCGG + Intronic
1010413393 6:75586321-75586343 GTTCTCATGCTGATGGTGTAAGG - Intergenic
1017400272 6:154053336-154053358 GGTCACATGCAGTGGGTGCAGGG - Intronic
1017761910 6:157575664-157575686 GCTCAAATGCTGCTGCTTCTGGG + Intronic
1018839294 6:167507180-167507202 GCTCACATCCTGCAGGTGTGGGG - Intergenic
1020152861 7:5696936-5696958 GATCACATGCTGCTTGTGGGAGG - Intronic
1020444951 7:8259288-8259310 GGCCACATGCTACTGGTCCATGG + Intronic
1021146451 7:17095078-17095100 GCTCACAGGCTGCTCACGCAAGG - Intergenic
1021289670 7:18827455-18827477 GCTCATATGCTGCTTGTAGAAGG - Intronic
1021881953 7:25103620-25103642 GCTGACTTGCTGATGGGGCAAGG - Intergenic
1027678386 7:81188063-81188085 GTTCTAATGCTGCTGGTCCAGGG - Intronic
1029261277 7:99304437-99304459 GCTGACATGCTGCTGGGGTTTGG - Intergenic
1029863463 7:103600570-103600592 GCTTAAATGGGGCTGGTGCAAGG - Intronic
1031556221 7:123179987-123180009 GCTGACATTCTGCTGCCGCATGG - Intronic
1035068311 7:156123539-156123561 GCTCACACGCAGCTGTTGCGTGG + Intergenic
1037478081 8:19277260-19277282 GCTCACACGATGCTGGGACAGGG + Intergenic
1037927762 8:22857922-22857944 ACTTACATGCCCCTGGTGCATGG + Intronic
1041823158 8:62062761-62062783 GCTCTCACGCTGCTGCTGCCAGG - Intergenic
1042048214 8:64678650-64678672 GGTCACATACTGCTGCTGCTGGG + Intronic
1044845879 8:96380764-96380786 GCTTACCTCCTTCTGGTGCATGG + Intergenic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1046648690 8:116813341-116813363 TGTCACATGCTGATGCTGCAGGG + Intronic
1047644914 8:126860269-126860291 GCTTACCTGAAGCTGGTGCATGG - Intergenic
1048004721 8:130409936-130409958 GCTCACAGTCTGGTGGGGCAGGG + Intronic
1049596430 8:143485971-143485993 GCTCACATGCTGCTGCTGGCAGG + Intronic
1050204541 9:3182764-3182786 TCTCACATTCTGTTGCTGCATGG + Intergenic
1051438964 9:17062618-17062640 CCTCAAATGCTGCTGGTGTCTGG + Intergenic
1053390308 9:37730180-37730202 GCTCAAAGGCAGCAGGTGCAAGG - Intronic
1053507611 9:38657027-38657049 TCTCACACACTGCTGCTGCACGG + Intergenic
1056531446 9:87491953-87491975 GCTCATATGCTACTGTTCCAAGG + Intergenic
1056889930 9:90482431-90482453 AATCCCATGCTGCTGGTGCCTGG - Intergenic
1060549727 9:124479211-124479233 GCTCACATCTTGCTGGGGCCAGG + Intergenic
1061239499 9:129361144-129361166 GTTCACGTTCTGCTGGTGAATGG - Intergenic
1061818296 9:133208836-133208858 GCTCACCTGGTGCTGGGGCCCGG - Intronic
1062242156 9:135546522-135546544 GCTCACCTGGTGCTGGGGCCCGG + Intronic
1187480113 X:19647783-19647805 TCTCAGGTGCTGCTGGTGCAGGG - Intronic
1187508588 X:19897462-19897484 TCCCACATGCTGCTGCTGCTGGG - Intergenic
1188493056 X:30756165-30756187 ACACACATGCTGGTGGGGCAGGG - Intergenic
1192510295 X:71717231-71717253 GCTCAGGAGCTGCTGCTGCAGGG - Exonic
1192516402 X:71764322-71764344 GCTCAGGAGCTGCTGCTGCAGGG + Exonic
1193255380 X:79342546-79342568 GCTCACACTCTCCTTGTGCAGGG - Intergenic
1199714776 X:150499482-150499504 GCTCAAATGGCTCTGGTGCAAGG - Intronic