ID: 1085703295

View in Genome Browser
Species Human (GRCh38)
Location 11:78764038-78764060
Sequence TGTCTGCGTCCTTATCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085703287_1085703295 4 Left 1085703287 11:78764011-78764033 CCTTGGGCCCCTCATTTCCCTTT 0: 1
1: 0
2: 7
3: 31
4: 412
Right 1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 113
1085703290_1085703295 -5 Left 1085703290 11:78764020-78764042 CCTCATTTCCCTTTCTTGTGTCT 0: 1
1: 0
2: 2
3: 67
4: 807
Right 1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 113
1085703286_1085703295 5 Left 1085703286 11:78764010-78764032 CCCTTGGGCCCCTCATTTCCCTT 0: 1
1: 0
2: 2
3: 25
4: 275
Right 1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 113
1085703288_1085703295 -3 Left 1085703288 11:78764018-78764040 CCCCTCATTTCCCTTTCTTGTGT 0: 1
1: 0
2: 6
3: 57
4: 725
Right 1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 113
1085703284_1085703295 20 Left 1085703284 11:78763995-78764017 CCAGTGACTGGTGGGCCCTTGGG 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 113
1085703289_1085703295 -4 Left 1085703289 11:78764019-78764041 CCCTCATTTCCCTTTCTTGTGTC 0: 1
1: 0
2: 3
3: 76
4: 627
Right 1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085703295 Original CRISPR TGTCTGCGTCCTTATCAGGG AGG Intronic
900818650 1:4869682-4869704 TGTCTGGGTCCTTCTCAGTGGGG + Intergenic
900886824 1:5421143-5421165 TGCATGCCTCCTTATCATGGAGG + Intergenic
901659677 1:10790744-10790766 TGTGTGTGTCCTTACAAGGGGGG - Intronic
903438343 1:23369041-23369063 CGACTGCGTCCTTCTCAAGGGGG + Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
904621978 1:31781281-31781303 TGTTTGGGTCCTAAGCAGGGGGG + Intergenic
905969681 1:42132021-42132043 TGTCAGCTTCCTTCTCAGGCAGG - Intergenic
915909847 1:159908186-159908208 TGCCTCCCTACTTATCAGGGTGG - Intergenic
918877308 1:190064588-190064610 TGTCTGCTGACTGATCAGGGTGG + Intergenic
924259846 1:242218159-242218181 TGGCTGCTTACTGATCAGGGTGG - Intronic
924900249 1:248390082-248390104 TGTTTGAGTCCTTATCTGGTTGG + Intergenic
1063767533 10:9159940-9159962 TATCTGAGACCTTATCAGTGTGG - Intergenic
1066051015 10:31635610-31635632 TGTCTGCTGACTAATCAGGGTGG - Intergenic
1066403617 10:35098587-35098609 TGTCATCATCCTTATCTGGGTGG - Intergenic
1075389018 10:122078847-122078869 TGTCTGGGTTCTTATTTGGGAGG + Intronic
1076077365 10:127545110-127545132 TGTACGCTTCCTTATCAGGCAGG + Intergenic
1078245423 11:9570019-9570041 TGTCTGCGTCCCTAAATGGGAGG - Intergenic
1078805330 11:14694443-14694465 TGGCTGCTGACTTATCAGGGTGG - Intronic
1080049809 11:27847928-27847950 TGCCTGTTTCCTTTTCAGGGGGG - Intergenic
1083320290 11:61841890-61841912 GGTCTGCTTCCTTATCTAGGGGG - Intronic
1085233823 11:74995746-74995768 TGACTGCTGACTTATCAGGGTGG + Intronic
1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG + Intronic
1088463020 11:110102801-110102823 TGGCTGCTGACTTATCAGGGTGG - Intronic
1091838956 12:3605495-3605517 TTTCTACGTCCCCATCAGGGAGG - Intergenic
1099745822 12:86703459-86703481 TGTCTGCTGACTGATCAGGGTGG - Intronic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1104133093 12:125913527-125913549 TGGTTCCTTCCTTATCAGGGTGG + Intergenic
1105954823 13:25271166-25271188 TCTCTGCCTCCTTTTCAGGTAGG + Intronic
1109595368 13:64546200-64546222 TCTCTGGGTCCTTATGAGGGTGG + Intergenic
1112569666 13:100582329-100582351 TGGCTGAGTCCTTGGCAGGGAGG - Intronic
1113855467 13:113442798-113442820 TGTCTGCGTCCTCAGCACAGAGG - Intronic
1117483577 14:56172258-56172280 TGTCTGCTGCCTTAGCGGGGTGG + Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118031987 14:61826913-61826935 TTTCCGTGTCCTTACCAGGGTGG + Intergenic
1122129124 14:99594906-99594928 TGTCTGCATATTTATCAGGTGGG + Intronic
1128345105 15:66848540-66848562 TGTCTGCATCCCTTTCAGAGCGG - Intergenic
1128928606 15:71682067-71682089 TGTCTTCATCCTTTCCAGGGGGG - Intronic
1136599385 16:31274555-31274577 TGTTTGCATCCTTATCTGGTTGG + Intronic
1137804658 16:51293158-51293180 TGGCTGCCTACTGATCAGGGTGG + Intergenic
1140951929 16:79826612-79826634 CTTCTGCTTCCTTATTAGGGAGG + Intergenic
1142394185 16:89822176-89822198 TGTCTGCTTCCTATTGAGGGTGG - Intronic
1144428593 17:15169857-15169879 TTTCTGCTTCCTTATCCAGGTGG - Intergenic
1148381784 17:47205011-47205033 TGTCTGTGTCCTGCTCAGAGAGG - Intronic
1150682166 17:67292973-67292995 TGTCTGCCTCCCTCTCAGGTGGG + Intergenic
1155957757 18:31967833-31967855 TGTCTGCTTCCTCCTCAGAGCGG + Intergenic
1156503751 18:37576127-37576149 TCTCTGCATCCTTATAAGGGAGG + Intergenic
1157602741 18:48904158-48904180 CATCTGCGTACTTGTCAGGGAGG - Intergenic
1158204507 18:54977122-54977144 TGGCTGCTGCCTCATCAGGGTGG + Intergenic
1161195599 19:2984397-2984419 TGTCTGTTTCCTTAGCAGGACGG - Intronic
1167424724 19:49424160-49424182 TGTCTAAGCCCTTATCTGGGAGG + Intronic
925156007 2:1649359-1649381 GGTCTCCGTCCCGATCAGGGTGG + Exonic
925664617 2:6239318-6239340 TGCCTGCTTCCCTCTCAGGGTGG - Intergenic
929301109 2:40304591-40304613 TGTCAGCCTCCTTTTCAGCGCGG + Intronic
932717402 2:74111601-74111623 TGCCTCTGTCCATATCAGGGAGG - Intergenic
933651427 2:84853121-84853143 TGACTGCGTCCTTATAAGAAAGG + Intronic
936266798 2:111017137-111017159 AGTCTGCTCCCTAATCAGGGGGG - Intronic
937336374 2:121064801-121064823 TGCCTTCTTCATTATCAGGGTGG - Intergenic
940447990 2:153800384-153800406 TGGCTGCTTACTGATCAGGGTGG + Intergenic
942999151 2:182302574-182302596 TGTCTGCTGACTAATCAGGGAGG + Intronic
943149321 2:184091491-184091513 TGTCTTCGTCATTGTTAGGGAGG - Intergenic
943451169 2:188044183-188044205 TGTCTGAGACCTTATCAGAATGG - Intergenic
944899057 2:204195976-204195998 TGTCTTCCTCCTTCTCAAGGCGG - Intergenic
945650593 2:212554048-212554070 TGGCTGCTTCCACATCAGGGTGG - Intergenic
1173972304 20:47162155-47162177 TGTCTGTGTCCTTATAAAGGGGG - Intronic
1175785871 20:61711555-61711577 TCACAGCGTCCTTATGAGGGAGG - Intronic
1176120240 20:63451186-63451208 TGTGTGTGTCCTTATCTGGTTGG - Intronic
1184966025 22:47972900-47972922 TGGCTGCGTCCTCATGTGGGGGG + Intergenic
951007270 3:17632640-17632662 TGTCTGCTGACTCATCAGGGTGG - Intronic
952365230 3:32668533-32668555 TGGCTGCTTACTGATCAGGGTGG + Intergenic
953486991 3:43309512-43309534 TGGCTGCTTACTAATCAGGGTGG - Intronic
953838088 3:46365287-46365309 TGGCTGCTTACTGATCAGGGTGG - Intergenic
956742306 3:72284859-72284881 CCTCTCCCTCCTTATCAGGGAGG - Intergenic
960540694 3:118858869-118858891 TGACTGCTGACTTATCAGGGTGG - Intergenic
963026603 3:140925294-140925316 TCTCTTTGTCCTTATAAGGGTGG + Intergenic
964736615 3:159924795-159924817 TGTCTGCTTCCTACTCAGGAAGG - Intergenic
965352424 3:167630211-167630233 TGTCTGCTGACTGATCAGGGTGG - Intronic
968135081 3:196215189-196215211 AGTCTGCGTCTTTGTCAGGGTGG + Intronic
971564711 4:28123005-28123027 TGTCTGCCGGCTGATCAGGGTGG + Intergenic
973165016 4:47066294-47066316 TGTCTGCTGACTGATCAGGGTGG + Intronic
976600489 4:86934219-86934241 TTTCTGCGTCCCTTTCAGGAAGG + Intronic
977590352 4:98819410-98819432 TGTGTGTGTGCTTGTCAGGGAGG - Intergenic
981459252 4:144992952-144992974 TGGCTGCTGACTTATCAGGGTGG - Intronic
985338932 4:188927159-188927181 TGTTTGTGTCCTTATCTGGTTGG - Intergenic
986626665 5:9729173-9729195 TGTGTGTGTGCTTAGCAGGGGGG + Intergenic
990190973 5:53259946-53259968 TGACTATGTCCTTATCAGGCTGG + Intergenic
990228230 5:53680944-53680966 TCTCTGCCTACTTCTCAGGGAGG + Intronic
995897644 5:117033251-117033273 TGTCTGCATTCTTGTCAGGATGG - Intergenic
996851461 5:127957626-127957648 TGTCAGCTGCCATATCAGGGTGG + Intergenic
997828196 5:137126425-137126447 TGTCTGAGTCCTCATCAGAATGG - Intronic
997840590 5:137236017-137236039 TGACTGCGTCCCTCCCAGGGCGG + Intronic
998847149 5:146322049-146322071 TGGCTGCTTACTGATCAGGGTGG - Intronic
1001914022 5:175544343-175544365 TGTTTGTGTCCTTATCTGGTTGG - Intergenic
1002549706 5:179978134-179978156 TGTATGCCTCCTTTTCAGGGTGG - Intronic
1006982712 6:38158733-38158755 TGTCTGTGTCCTTCTTAAGGTGG + Intergenic
1008182371 6:48347487-48347509 TGTTTGTGTCCTTATCTGGTTGG - Intergenic
1010067558 6:71702587-71702609 TGGCTGCTGACTTATCAGGGTGG - Intergenic
1011650038 6:89497086-89497108 TGTTTCCCTCCTTATCAGGTAGG + Intronic
1012836349 6:104274296-104274318 TCTCTGCTGACTTATCAGGGTGG + Intergenic
1014990408 6:128068072-128068094 TGTCAGAATCCTTATTAGGGTGG - Intronic
1017095829 6:150804621-150804643 CTTCTGTGTCCTTATCAAGGTGG - Exonic
1022152349 7:27620988-27621010 TGTATGTGTCCTTATTAGTGAGG - Intronic
1022899247 7:34785964-34785986 TGACTGCTGACTTATCAGGGTGG + Intronic
1028029057 7:85886196-85886218 TGGCTGCTAACTTATCAGGGTGG + Intergenic
1030257281 7:107524479-107524501 TGTCAGTGTCTTTATCAGTGTGG - Intronic
1030990401 7:116292077-116292099 AGACTGTGTCCTTCTCAGGGTGG - Intronic
1032852846 7:135809921-135809943 TGTCTTCCTCATTATCAGGTTGG - Intergenic
1035459888 7:159032125-159032147 TGGCTGGGTCCTTCTCAGGAGGG + Intronic
1039983998 8:42432695-42432717 TGTCTGCTGACTCATCAGGGTGG - Intronic
1042162711 8:65912960-65912982 GGTTTGTGTCCTTTTCAGGGTGG - Intergenic
1043090994 8:75903826-75903848 TGTCTGCTAACTGATCAGGGTGG - Intergenic
1051950095 9:22620837-22620859 TGTCTGAGACCTCATCAGAGTGG - Intergenic
1052688837 9:31789257-31789279 TGGCTGCGGACTGATCAGGGTGG - Intergenic
1056594575 9:87996204-87996226 TGTCTGTTTTCTTATCATGGTGG + Intergenic
1056670535 9:88624029-88624051 TGTCTGGGACCTTATCAGCTTGG + Intergenic
1062513397 9:136920410-136920432 TGTCTGCGTCCTGAACCGGGAGG + Exonic
1187662803 X:21569266-21569288 TGTCTGCTGACTAATCAGGGTGG + Intronic
1188934308 X:36154418-36154440 TGTCTGAGACCTCATCAGGATGG + Intergenic
1190619472 X:52270706-52270728 TGTTTGTGTCCTTATCTGGTTGG + Intergenic
1193329194 X:80216891-80216913 TGTCTGAGACCTTATCAGCCTGG - Intergenic
1198647519 X:138825518-138825540 GGTCTGTGTGCTTATCATGGGGG - Intronic
1200367542 X:155683367-155683389 TGTCTGCTGACTGATCAGGGTGG - Intergenic