ID: 1085705837

View in Genome Browser
Species Human (GRCh38)
Location 11:78786312-78786334
Sequence GCCTGTGGGGAGCTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085705832_1085705837 -6 Left 1085705832 11:78786295-78786317 CCAGATGTGGCCTTAGGGCCTGT 0: 1
1: 0
2: 3
3: 20
4: 219
Right 1085705837 11:78786312-78786334 GCCTGTGGGGAGCTCTCCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 230
1085705826_1085705837 11 Left 1085705826 11:78786278-78786300 CCCAGGCCTAATGGACTCCAGAT 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1085705837 11:78786312-78786334 GCCTGTGGGGAGCTCTCCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 230
1085705827_1085705837 10 Left 1085705827 11:78786279-78786301 CCAGGCCTAATGGACTCCAGATG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1085705837 11:78786312-78786334 GCCTGTGGGGAGCTCTCCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 230
1085705829_1085705837 5 Left 1085705829 11:78786284-78786306 CCTAATGGACTCCAGATGTGGCC 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1085705837 11:78786312-78786334 GCCTGTGGGGAGCTCTCCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085705837 Original CRISPR GCCTGTGGGGAGCTCTCCCC AGG Intronic
900484108 1:2913391-2913413 GCCTGTGCTGAGGTCTCCACAGG + Intergenic
900547595 1:3237233-3237255 GCCTGGGGGGAGCTCTGCCATGG - Intronic
900639324 1:3681313-3681335 GGCTGAGGTGACCTCTCCCCTGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900705636 1:4078411-4078433 GACTGTTGGGAGGTCTCACCGGG - Intergenic
900705660 1:4078527-4078549 GACTGTTGGGAGGTCTCACCGGG - Intergenic
900705694 1:4078701-4078723 GACTGTTGGGAGGTCTCACCGGG - Intergenic
901043240 1:6378659-6378681 TCCTGTGGGGACCTACCCCCAGG + Intronic
901629950 1:10643141-10643163 ACCTGGGGGGGGCTCTCACCTGG + Exonic
902120742 1:14163382-14163404 GCATGTGGACAGCTCACCCCAGG - Intergenic
902501485 1:16914285-16914307 GCCTGTTGGGAACGCTCTCCTGG - Intronic
903462233 1:23528090-23528112 GCCTGCAGGAAGCTCTGCCCAGG - Intronic
903961240 1:27059095-27059117 CCCTGTGGGGAGCCCTGCCAAGG - Intergenic
904301922 1:29559719-29559741 GGCCCTGGGGAGCTCTGCCCAGG + Intergenic
907717364 1:56939589-56939611 GCCTGTGGGGACTTCTGCACAGG - Intronic
915088760 1:153406750-153406772 GCCTGTTGTGAGCTCTCCTGGGG + Intergenic
915096137 1:153464085-153464107 GCCTGTTGTGAGCTCTCCTGGGG - Intergenic
915496347 1:156285278-156285300 GCCTGGGGTGAGCTCTTCTCTGG - Exonic
918074767 1:181161658-181161680 GCCTGGGGAGAGCTGTCACCCGG + Intergenic
922189513 1:223305242-223305264 TCCTGAGGGAAGCTCTCCACTGG + Intronic
922349193 1:224721947-224721969 GCCTCAGGGGTGCTCTCCCACGG + Intronic
923391317 1:233516002-233516024 GCCAGTGTGGGGCTGTCCCCAGG - Intergenic
923497439 1:234537695-234537717 GCCCTTGGGGAGGTTTCCCCGGG - Intergenic
1063366219 10:5492674-5492696 GCCTGTGAGCAGCTGCCCCCGGG + Intergenic
1063927714 10:10996838-10996860 GCCTGTGGGCAGCACCTCCCAGG - Intergenic
1064017533 10:11784116-11784138 GCCTGAGGGGAGGTCGGCCCAGG - Intergenic
1065976617 10:30847629-30847651 CCCTTTGGGGAGCTCTGTCCTGG + Intronic
1066703676 10:38156467-38156489 GCCTGTGGGTATCTCTCATCTGG - Intergenic
1066987054 10:42476485-42476507 GCCTGTGGGTATCTCTCATCTGG + Intergenic
1067563674 10:47321720-47321742 GGATGTGGGGAGCTCCCCACAGG + Intergenic
1067790575 10:49284474-49284496 GCCTGTGGGCAGGTTTCTCCTGG - Intergenic
1068007041 10:51403686-51403708 CCCTGTGGGGAGCTCTGTCTTGG - Intronic
1069837389 10:71318080-71318102 GATTCTGGGGACCTCTCCCCAGG - Intergenic
1069957595 10:72061449-72061471 GCCTGTGGGTGGCTCTCCCCTGG + Exonic
1073017846 10:100416024-100416046 GCCTGCGTGGACCTCTTCCCTGG - Intergenic
1073067671 10:100773040-100773062 GCCTTTGGGTGTCTCTCCCCTGG + Intronic
1074429922 10:113385767-113385789 CCCTGTGGAGAGGTGTCCCCAGG + Intergenic
1074884731 10:117684947-117684969 GCCTGCTGGGGGCTCTCTCCCGG - Intergenic
1076242022 10:128915746-128915768 CGCTGTGGGACGCTCTCCCCTGG + Intergenic
1076745480 10:132510597-132510619 CCCTGTGGGGAGGCCACCCCAGG - Intergenic
1076889996 10:133278759-133278781 GGTTGTGGGCAGCTCTCACCCGG - Exonic
1077432998 11:2525327-2525349 CCCTGTGGGGAGCCCTCCGTAGG - Intronic
1080096639 11:28416350-28416372 GTCTGTGTGGATCTCTTCCCTGG - Intergenic
1083264125 11:61538270-61538292 GCCTGTGGGCTGCCCTCCCCGGG - Intronic
1083308402 11:61772418-61772440 CCCTGTGGGGACCACTCCCCTGG + Intronic
1083402468 11:62433464-62433486 GCCTGTGGCCAACTCTCCCAGGG + Intergenic
1084119153 11:67058926-67058948 CCCTGTGTGGTGCTCTTCCCCGG - Intronic
1085463200 11:76707486-76707508 TCCTCTGGGGAGCACTCACCTGG + Intergenic
1085705837 11:78786312-78786334 GCCTGTGGGGAGCTCTCCCCAGG + Intronic
1089268703 11:117286069-117286091 GCCTGTCTGGAGCTCACCCAAGG - Exonic
1091238584 11:134037444-134037466 GGCGGCGGGGAGCTCTTCCCGGG + Intergenic
1091295608 11:134472119-134472141 GGCTGTGGGGACCTCGCACCCGG - Intergenic
1091638874 12:2219179-2219201 CCCTTTGTGGAGCTCTGCCCTGG + Intronic
1096193968 12:49637075-49637097 GCCTGTAGGGTGCTCTCTACTGG - Exonic
1097173051 12:57128217-57128239 GCCTGGGGCGCCCTCTCCCCTGG - Intronic
1097220758 12:57449596-57449618 GCCTATGGGCAGCTCCACCCAGG - Exonic
1098632433 12:72740575-72740597 GCCTCTGGGTGGCCCTCCCCAGG - Intergenic
1101918781 12:108916110-108916132 GTCTTTGGGGAGCCCCCCCCAGG - Intronic
1104775483 12:131388002-131388024 GCATGTGACGAGCTCTCACCTGG - Intergenic
1105068368 12:133218873-133218895 GCCTGGGCTGAGCTATCCCCAGG - Exonic
1106224386 13:27774082-27774104 GACTGTTGGGAGGACTCCCCAGG - Intergenic
1106411757 13:29515619-29515641 GCCTCTGGGCATCTCACCCCAGG - Intronic
1107997264 13:45873055-45873077 GCCTGTGGGGTGCTGTTTCCAGG - Intergenic
1108518490 13:51223602-51223624 CCCTGTGGGGAGCTTTGCCGGGG - Intronic
1108635942 13:52334259-52334281 GCCTGACGGGAGCTCTGCTCAGG - Intergenic
1108651868 13:52488989-52489011 GCCTGACGGGAGCTCTGCTCAGG + Intergenic
1109426189 13:62168290-62168312 GGCTGAGGGCAGCTCTCCACTGG + Intergenic
1112502699 13:99955217-99955239 GCCTGTCGCGAGCTCTCCTGAGG - Intergenic
1112605793 13:100904523-100904545 GCCTGTGGGAAGTTCTGCCAGGG + Intergenic
1113463984 13:110501418-110501440 TCCTGTGAGGAGCCCTCCACTGG - Intronic
1113489169 13:110677966-110677988 GCCAGTGGGCAGCACGCCCCAGG + Intronic
1113660848 13:112105518-112105540 GGCTGTGGGGCGCCTTCCCCAGG + Intergenic
1113668557 13:112159257-112159279 GAGGATGGGGAGCTCTCCCCAGG - Intergenic
1114278652 14:21169968-21169990 GCCTCTGGGGTTCTCTCCCCAGG - Intergenic
1117452456 14:55865072-55865094 GCCTCTGGGAGTCTCTCCCCAGG + Intergenic
1117583427 14:57175666-57175688 CCCTGTGGACAGCTCTCACCTGG + Intergenic
1120645296 14:87067077-87067099 GCCTCTGGGGAGCTCTGCACAGG - Intergenic
1121226123 14:92323205-92323227 CCCAGGGGCGAGCTCTCCCCGGG - Intronic
1121307421 14:92915815-92915837 GTCTTTGGGGAGCTCTGGCCTGG - Intergenic
1121312982 14:92945114-92945136 GACAGGGGTGAGCTCTCCCCAGG + Intronic
1122155178 14:99746477-99746499 GCCTCTGGGGAGGTTTCCACAGG + Intronic
1122597396 14:102902904-102902926 GACAGTGGAGACCTCTCCCCTGG + Intronic
1126458540 15:48890775-48890797 GCCTGTGTGAAGCTGTCCCCGGG - Exonic
1130651253 15:85763337-85763359 GCCTCTGGGGAGCTGGCCACGGG - Intronic
1131058778 15:89391799-89391821 GGCAGTGGGCAGCTCTCCCAAGG - Intergenic
1132335879 15:101048420-101048442 GCCTCTGCAGAGCTCTGCCCAGG + Intronic
1132420221 15:101659470-101659492 CCTTGTGGGGAAATCTCCCCAGG - Intronic
1134826361 16:17287613-17287635 GCCTCTGGGGAGCCCTCCCAGGG + Intronic
1137288743 16:47037628-47037650 GCCTCTGGCGGGATCTCCCCTGG + Intergenic
1137530498 16:49276083-49276105 GGCTGTGGATAGCTCTCCCCAGG - Intergenic
1142145925 16:88492955-88492977 GGGTGTGGGGAGCTGTCCCAGGG + Intronic
1142145937 16:88492995-88493017 GGGTGTGGGGAGCTGTCCCGGGG + Intronic
1142146091 16:88493455-88493477 GGCTGCGGGGAGCTGTCCCGGGG + Intronic
1143100463 17:4501727-4501749 GCCTGGGATGAGCACTCCCCTGG - Intronic
1143145663 17:4773529-4773551 GACCAAGGGGAGCTCTCCCCTGG - Intronic
1143642207 17:8205489-8205511 GCCTGGCTGGACCTCTCCCCTGG - Intronic
1145065395 17:19758215-19758237 CCCTGTGGAGACCTCTCCCAAGG - Intergenic
1145974359 17:28975819-28975841 GACTGTGGGCAGCTGTGCCCAGG + Intronic
1146058169 17:29591382-29591404 GATTGTGGGGAACTGTCCCCTGG - Intronic
1148077572 17:44947706-44947728 GGGTGTGGGGCGCTCTCTCCCGG - Exonic
1150475906 17:65474804-65474826 GCCTATGGGGAGCTCTTGTCTGG - Intergenic
1150548959 17:66191832-66191854 GCCTGGGGGGCGCGCGCCCCTGG - Exonic
1150719910 17:67605446-67605468 GCCTGTGGCGAGTCCTCCCGGGG + Intronic
1151906607 17:77053279-77053301 GCCAGTGGGGAGGACTCACCTGG - Intergenic
1152557347 17:81060056-81060078 GCCTTTTGGAATCTCTCCCCGGG + Intronic
1152743995 17:82030978-82031000 GCCGGTAGGGAGCCCTTCCCAGG - Exonic
1152881381 17:82817993-82818015 GCCTGTGGGGAGCCAGCTCCAGG + Intronic
1153935322 18:9914898-9914920 GGCTGCAGCGAGCTCTCCCCGGG - Intronic
1155052182 18:22158093-22158115 GCCTGTGGCACACTCTCCCCAGG - Intergenic
1157660800 18:49441832-49441854 GCCTGGGGGTCTCTCTCCCCAGG + Intronic
1160457042 18:79008798-79008820 GTCTGTGGGGTGCTGTGCCCTGG - Intergenic
1160569130 18:79804474-79804496 GGCTGTGGGGGGCCCTCCCATGG + Intergenic
1160824914 19:1074965-1074987 GCGTGTGCGGAGCTCGCCGCAGG - Intronic
1161736507 19:5995203-5995225 CCCTGTGGGGAGCAGGCCCCAGG - Intronic
1161939048 19:7391189-7391211 GCCTGTGGGGAGTTATACCTTGG - Intronic
1162782129 19:13011904-13011926 GGTGGTGGGGAGGTCTCCCCAGG + Intronic
1166117300 19:40663661-40663683 GCCTGTGGGAGGTCCTCCCCGGG + Intergenic
1166807543 19:45496488-45496510 GCGCGCGGGGAGCTGTCCCCTGG - Intronic
1167326810 19:48831721-48831743 GCCTGAGGAGACCTCTGCCCAGG - Exonic
1167455499 19:49595338-49595360 GGTGGTGGGGAGCCCTCCCCGGG + Exonic
925057589 2:867014-867036 GCCTGCTGGGAGCTCCCTCCCGG - Intergenic
925122238 2:1428337-1428359 GCCTGTGGGGAGCTCAGTTCAGG - Intronic
925308903 2:2868104-2868126 GCCAGTGGGGAACACTCACCAGG - Intergenic
925717177 2:6795156-6795178 GGCTGTGGTGAGCTCTTCTCAGG - Intergenic
926089071 2:10038296-10038318 GGCTGTGGGCAGCTCCCACCAGG - Intergenic
928952263 2:36823578-36823600 GTTTGTGGGGAGCTGTCCCAAGG + Intergenic
929919510 2:46162259-46162281 GCCTCTTGGGAGCTCCCCCTTGG + Intronic
929996273 2:46828110-46828132 CCCAGTGGGCAGCTCTGCCCTGG + Intronic
933865339 2:86510855-86510877 GTGTGTGGGGAGCTCTGCTCGGG - Intronic
934130036 2:88939041-88939063 GCCTGTGTGAAGATCTCTCCAGG + Intergenic
935447592 2:103172973-103172995 GCCTGCTGGCAGCTCTCTCCAGG + Intergenic
937087226 2:119179429-119179451 GCCTGTGGCAAGCTCACCCTGGG - Intergenic
938244570 2:129766648-129766670 GCATGGGGTGAGCTCTCTCCCGG - Intergenic
938405587 2:131031512-131031534 GCCTGTGGGCAGCTCCCTGCAGG - Intronic
939346653 2:140974843-140974865 GCATTTGGGGATCTCTCCACAGG - Intronic
941527895 2:166628831-166628853 GCCTCTGGGAGCCTCTCCCCAGG + Intergenic
942604420 2:177675453-177675475 GCCTGTCTGGAGATCTCCCACGG + Exonic
947586228 2:231358538-231358560 ACCTGTGGGGAGCGCTGCCTGGG - Intronic
947716941 2:232345595-232345617 GCCTGTTGAGAGGCCTCCCCAGG + Intergenic
947735383 2:232451916-232451938 GCCTGTTGAGAGGCCTCCCCAGG + Intergenic
948362036 2:237428757-237428779 GGCTGTGGGGCTCTCTTCCCAGG - Intergenic
948363340 2:237437901-237437923 GGCTGTGGGGTTGTCTCCCCGGG - Intergenic
948874934 2:240821099-240821121 GCCTCTGGGCAGCTCGCCCATGG + Intergenic
1169046568 20:2538109-2538131 GCCAGTAGGGAGCTGGCCCCAGG + Intronic
1171185659 20:23122481-23122503 GGTTGTGGGGACCTCTGCCCAGG - Intergenic
1171461204 20:25298947-25298969 GTCTGTGGGGTGCCCTCCCAGGG + Intronic
1175418405 20:58816401-58816423 GCCAGTGGGGAGCTTCCCCAGGG - Intergenic
1175678839 20:60969537-60969559 GCCTCTGGGGAGCTCTGAGCAGG - Intergenic
1178741373 21:35205351-35205373 GGGTGTGGGGAGCTCTCTCCTGG - Intronic
1179315843 21:40243863-40243885 GCCTGTGTGGATCACTGCCCCGG - Intronic
1179819740 21:43929831-43929853 GCCAGGCGGGAGCTGTCCCCAGG - Intronic
1180170565 21:46056036-46056058 GCATGTGGGTGGCTCTGCCCAGG - Intergenic
1180595687 22:16971750-16971772 GCCTGTGGGGAGCTGTTCCTTGG + Intronic
1181050034 22:20234123-20234145 GCCTGTGGGTAGCTGTGCCCAGG - Intergenic
1181532232 22:23523160-23523182 GCTTGTGGGGAGGTCTCCACTGG + Intergenic
1182151498 22:28030201-28030223 GAGTGTGGGGCGCTTTCCCCAGG - Intronic
1182394972 22:30028656-30028678 GCCTCTGGGGAGCTCTGAGCAGG - Intronic
1183278057 22:36913779-36913801 TCCTGTGGGTAGCTGTGCCCTGG + Intronic
1183310457 22:37106851-37106873 GACTGTGGGGAACTCTTACCAGG + Intronic
1184690245 22:46114181-46114203 CCCCGTGGGGACCTCTCCACCGG - Intergenic
1185172751 22:49303294-49303316 GCCTCTGGGAGGCCCTCCCCAGG - Intergenic
1185212061 22:49575902-49575924 GCCTGTTGGGGACTCGCCCCCGG + Intronic
950653120 3:14419918-14419940 GCTTGTGGTGAGATCTCCCACGG + Intronic
954289080 3:49639611-49639633 GCCTTTGGGGGGCTCTGCCAGGG + Intronic
954754428 3:52831540-52831562 GCCTTTGGGCAGCGCTCCCCTGG - Intronic
957419885 3:79953892-79953914 GCCTTTGGGGAGCTCTAAACAGG + Intergenic
957723238 3:84031719-84031741 GCCTCACTGGAGCTCTCCCCAGG - Intergenic
959520264 3:107316916-107316938 GCCTCTGGGAGGCTCTCCCTGGG + Intergenic
959611574 3:108300715-108300737 GCCTCTGGCCAGCTCTACCCAGG - Intronic
961816840 3:129555459-129555481 GCCTCTCGGGACCCCTCCCCGGG + Exonic
962024487 3:131532830-131532852 GCCAGAGGTGAGCTCTCACCAGG + Intergenic
962363541 3:134761471-134761493 GCCTGTGAGCAGGTGTCCCCTGG + Intronic
963007622 3:140740779-140740801 TCCTATGGGCAGCTCTCCCAAGG + Intergenic
968522184 4:1039073-1039095 GCCTTCGGGAAGCTCTTCCCGGG + Intergenic
969713388 4:8857362-8857384 GCCCGTGGGGCCCCCTCCCCAGG + Intronic
970585259 4:17509210-17509232 GCCAGTGGTCACCTCTCCCCAGG + Intronic
977004909 4:91554312-91554334 GCCTGTAGTGAGCACTCTCCAGG - Intronic
984734703 4:183098753-183098775 GCGGGCGGGGAGCTCTCCTCCGG - Intergenic
985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG + Intronic
985665616 5:1180383-1180405 GACTGTGGGGTCCTCTCCACAGG + Intergenic
985690879 5:1311607-1311629 ACCTGTGGGGAGCCCTGCCCTGG - Intergenic
986151871 5:5137326-5137348 GCCTGCTGGGAGCTCTCCCTGGG + Intergenic
986438670 5:7759477-7759499 GCCTGTCAGGACCTCTCCACAGG - Intronic
986700321 5:10401082-10401104 GCCTGTGGGAAACTTTCCCACGG - Intronic
989609666 5:43278915-43278937 GGCTGTGGTGAGCTTTCCCAGGG + Intronic
990175367 5:53102419-53102441 TCCTTTGGGGAGCACTCCCTCGG + Intronic
993018634 5:82564319-82564341 GCCTCAGGGGGCCTCTCCCCAGG - Intergenic
993225540 5:85164733-85164755 GCCTCTGGGGACTTCTCCTCAGG + Intergenic
995852417 5:116559952-116559974 GCTTGTGGAGGGCTCTGCCCAGG - Intronic
996598772 5:125236528-125236550 GCCAAGGGGGAGATCTCCCCTGG + Intergenic
997209313 5:132068175-132068197 GCCTGTGTAGACCCCTCCCCAGG - Intergenic
998174533 5:139893752-139893774 GGATGTGGGGAGGTCTCCCTTGG + Intronic
998681590 5:144473781-144473803 GTCTGAGGCCAGCTCTCCCCAGG + Exonic
999148739 5:149412886-149412908 GCCTCTGTGGATCCCTCCCCAGG - Intergenic
1001789635 5:174444914-174444936 GGCTGAGAGCAGCTCTCCCCAGG - Intergenic
1006079715 6:31558307-31558329 TCCTCTGGGGTGCTCTTCCCTGG - Exonic
1006876544 6:37302301-37302323 GCAGGTGGGGAGGTCACCCCTGG + Intronic
1007635567 6:43297947-43297969 GCCTGGGGCCAGCTCTCCCAGGG - Intronic
1008647557 6:53530507-53530529 GCCTGTGTCGATCTCTTCCCAGG - Intronic
1013916656 6:115347483-115347505 GCCTGTTGGGATTTCTCCCAAGG - Intergenic
1024634400 7:51275527-51275549 GTCTGGGGGGAATTCTCCCCTGG + Intronic
1026605748 7:71814425-71814447 GACTGTTGGGAAGTCTCCCCTGG + Intronic
1029172346 7:98639953-98639975 GGCTGTGAGGAGCAGTCCCCAGG - Intergenic
1032255542 7:130294452-130294474 GCCTGTGGGAAAATCTTCCCTGG - Intronic
1033540041 7:142348265-142348287 GCCTGCTGGGATCTCACCCCAGG + Intergenic
1033681696 7:143601439-143601461 GTCCGTGGCCAGCTCTCCCCAGG - Intergenic
1033686274 7:143644053-143644075 GTCCGTGGCCAGCTCTCCCCAGG + Intronic
1033689464 7:143723262-143723284 GTCCGTGGCCAGCTCTCCCCAGG - Exonic
1033698339 7:143813568-143813590 GTCCGTGGCCAGCTCTCCCCAGG - Intergenic
1033703195 7:143860374-143860396 GTCCGTGGCCAGCTCTCCCCAGG + Exonic
1034411689 7:150945477-150945499 GCGTGTGAGGAGCTGCCCCCGGG - Exonic
1035322749 7:158044255-158044277 GCGTCTGGGGAGCTCACCTCTGG + Intronic
1037884698 8:22589833-22589855 GCCTGTGAGGTGCTCACCCCAGG + Intronic
1037902541 8:22695932-22695954 ACCTGTCAGGATCTCTCCCCAGG + Intergenic
1038515450 8:28183865-28183887 GCCTGTGGGCGCCTCTCCTCTGG + Intronic
1039433036 8:37540510-37540532 GCCTGTGTGGTGCTCTCCTCTGG + Intergenic
1039903788 8:41771707-41771729 GCCTGTGGGGTTCTGTCCTCTGG + Intronic
1040319436 8:46285261-46285283 GCCTATGGAGAGGTCTCCCTGGG + Intergenic
1048898343 8:139015104-139015126 GGCTGTGGGCAGCTCCTCCCTGG + Intergenic
1049280466 8:141741531-141741553 TCCTGTGGGCTGCTTTCCCCTGG + Intergenic
1049508058 8:143014306-143014328 GCCTGTGGGGAGAAGTCCCACGG - Intergenic
1049573457 8:143380068-143380090 GTGCGTGGGGAGCTCTCCCTCGG - Exonic
1049604183 8:143521430-143521452 GCCTCTGGGGAGCTCCCAGCAGG + Intronic
1049612266 8:143561160-143561182 GCTGGCGGGTAGCTCTCCCCAGG - Intronic
1049749103 8:144275141-144275163 GCCTGTCAGGAACTGTCCCCGGG - Intronic
1049800707 8:144516295-144516317 ACCTGTGCGGGGCTCTCCCAGGG + Exonic
1051726175 9:20089649-20089671 GCCTCTGGGAGCCTCTCCCCAGG - Intergenic
1051827234 9:21233913-21233935 GGCTGTGGGAGCCTCTCCCCAGG - Intronic
1055373413 9:75624468-75624490 GCCTCTGGGAGCCTCTCCCCAGG + Intergenic
1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG + Intergenic
1057852965 9:98579423-98579445 CCCTGTGGTCATCTCTCCCCTGG + Intronic
1059446192 9:114339549-114339571 GCCTGTGGGCAGAACTCACCAGG - Intronic
1060462940 9:123875691-123875713 GCCTGTGTGAGTCTCTCCCCTGG - Intronic
1060939527 9:127535573-127535595 GCCTGTGGGCAGCACTGCGCTGG - Intronic
1061014701 9:127975029-127975051 GCCTGTGAGCAGGCCTCCCCCGG + Intronic
1061224796 9:129275015-129275037 CACTGTGGTGGGCTCTCCCCAGG + Intergenic
1061248303 9:129412938-129412960 TCCTGTGGGGAGGTGTCCACCGG - Intergenic
1061390400 9:130314596-130314618 GGCTGTGGAGACCCCTCCCCGGG + Intronic
1061626257 9:131842410-131842432 GCCTGTGGGGAGATGACTCCAGG + Intergenic
1062161618 9:135083513-135083535 GTCTGTGGGATGCTCTCCCCAGG + Intronic
1062389758 9:136329280-136329302 GCCTGTGACGAGGTCCCCCCGGG + Intronic
1062447952 9:136603588-136603610 GCCAGTGTGGGGCTCTCCTCTGG + Intergenic
1062503527 9:136861439-136861461 GGCTGTGGGTGGCTGTCCCCAGG + Intronic
1062681860 9:137786506-137786528 GCCTGTGGTGTCATCTCCCCCGG + Intronic
1190261539 X:48800852-48800874 GCGTCTGGGGAGCTGTCCCTAGG - Intergenic
1190597804 X:52064800-52064822 GCTTGAGGGGAACTCTTCCCAGG + Intronic
1190611020 X:52189273-52189295 GCTTGAGGGGAACTCTTCCCAGG - Intronic
1191123031 X:56925922-56925944 GCCTCTGGGAGCCTCTCCCCAGG + Intergenic
1193496444 X:82219366-82219388 GCCTCTGGGAGCCTCTCCCCAGG + Intergenic
1197914012 X:131514871-131514893 GGTAGTGGGGAACTCTCCCCTGG + Intergenic
1200910232 Y:8525369-8525391 GCCTGTGGGTAGCTCTGCTTGGG + Intergenic