ID: 1085706919

View in Genome Browser
Species Human (GRCh38)
Location 11:78794716-78794738
Sequence ATGTAGAAGGAGATTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085706915_1085706919 17 Left 1085706915 11:78794676-78794698 CCAGGGAGCTGTGAGTGATGGAC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 252
1085706917_1085706919 -5 Left 1085706917 11:78794698-78794720 CCAGCGGAAGAGCAGAAAATGTA 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085706919 Original CRISPR ATGTAGAAGGAGATTGAGCC AGG Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901159177 1:7162071-7162093 ATGTAGAAGGCCATTGGGCAGGG + Intronic
901818531 1:11810049-11810071 ATGTAGAAGGATATTTAGTAAGG + Intronic
902638270 1:17749555-17749577 ATGTGGGAGGAGATTGACCAAGG - Intergenic
903290648 1:22312001-22312023 TTGTGGGAGGAGATTGAGACAGG + Intergenic
904823306 1:33258576-33258598 AGGTAGAAGGAGACTGAGACCGG + Intronic
905665590 1:39761306-39761328 ATGGAGGTGGAGGTTGAGCCAGG - Intronic
907462396 1:54612642-54612664 ATGTAGAAGGTGGTCCAGCCTGG + Exonic
912976183 1:114332322-114332344 AGGTAGAAGGAGGTGGATCCAGG - Intergenic
913234221 1:116766180-116766202 AGGGAGAAGGACAATGAGCCTGG + Intronic
914773361 1:150712497-150712519 CTGTAGAAGGAGATTAAGATTGG - Intronic
915485566 1:156217869-156217891 ATGTACAAGGATATTCACCCTGG - Intronic
917489485 1:175485756-175485778 ATATAGAATAAAATTGAGCCAGG + Intronic
918017040 1:180645326-180645348 ATTTTGAAAGAGACTGAGCCAGG - Intronic
918750979 1:188268909-188268931 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
919091285 1:192981229-192981251 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
919841987 1:201616139-201616161 CTGTAAAATGAGATTGAGACAGG - Intergenic
919973061 1:202593146-202593168 AGGTAGAAAGAGATTGAGCCAGG - Exonic
920139570 1:203798383-203798405 ATGTAAAAGAAGTGTGAGCCGGG + Exonic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920308542 1:205034274-205034296 ATGGAGAGGGAGCATGAGCCAGG - Intergenic
920504136 1:206504879-206504901 ATGTGGGAGGAGATTGTGCAGGG - Intergenic
920610833 1:207436080-207436102 ATGCAGAAGAAGATTGAAACTGG + Intergenic
920721016 1:208386883-208386905 CCGTAGAAGGAGTCTGAGCCAGG - Intergenic
920870245 1:209788172-209788194 TAGTAGAAGGAGATTTGGCCTGG - Exonic
923043100 1:230333752-230333774 AGGGAGAAGGAGCTTGAGCTCGG + Intronic
923373869 1:233340492-233340514 ATTTAGAATGAGATTGAGAAGGG + Intronic
924015150 1:239713066-239713088 TTGCAGAAGCAGATTGTGCCCGG - Intronic
1063778087 10:9287599-9287621 ATGTAGAAGGAAACTCAACCTGG + Intergenic
1064211101 10:13361141-13361163 ATATAGAAGTAGATAGAGGCTGG - Intergenic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1065955567 10:30690791-30690813 ATGTAGAATGAGGCTGAGGCTGG + Intergenic
1066498728 10:35969796-35969818 ATGTAGACGGAGATAGAGCTTGG + Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1069322073 10:67184346-67184368 ATGTAAAAGGAGATGGAACATGG - Intronic
1069559124 10:69417150-69417172 ATACAGAAGGAGTTCGAGCCTGG + Intergenic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1071027900 10:81137769-81137791 AAGTTGAAGAAGATTCAGCCAGG - Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1072012171 10:91311979-91312001 ATGTAGAAAGAGATTTATTCTGG - Intergenic
1072426418 10:95334441-95334463 ATGGAGAAGGGGCTTGTGCCAGG + Intronic
1074115002 10:110449918-110449940 ATTAAGAAGGAAATTGGGCCGGG + Intergenic
1079147295 11:17864779-17864801 ATTCAGAAGGAGATGGTGCCTGG - Intronic
1079353035 11:19709245-19709267 ATCTAAAAGGAGATAGGGCCAGG + Intronic
1079424649 11:20328593-20328615 ATAAAGAAAGAGATTGATCCTGG - Intergenic
1079484625 11:20922475-20922497 AGGTGGAAGGAGATGGAGTCTGG + Intronic
1084726579 11:70946149-70946171 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726606 11:70946258-70946280 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726648 11:70946439-70946461 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726762 11:70946877-70946899 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726802 11:70947023-70947045 GTGCAGAGGGAGGTTGAGCCTGG - Intronic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1087245423 11:95829985-95830007 ATGTAGAAGGAGAGGGAGTTAGG + Intronic
1088189238 11:107209006-107209028 ATGTAAAAGGTGAGTGTGCCTGG + Intergenic
1090225441 11:125069406-125069428 ATAGATAAGGAAATTGAGCCTGG - Intronic
1091133920 11:133170808-133170830 ATCTAGAAGGAGCTGGATCCTGG + Intronic
1091611382 12:2013121-2013143 AGCTAGAGGGAGATTGAGACGGG - Intronic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095289531 12:40462073-40462095 ATGTATAAGGATTTTGAGCAGGG + Intronic
1096666979 12:53172437-53172459 CTGGAGAAGGAGAGTAAGCCAGG + Intronic
1099921013 12:88957155-88957177 AGTTAGAAGGAGGTGGAGCCAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102715007 12:114962964-114962986 ATTTAGTAAGAGATAGAGCCAGG + Intergenic
1103100567 12:118170814-118170836 ATGCAGAAAGAGCCTGAGCCTGG + Intronic
1104715793 12:131015402-131015424 ATGGAGATGGAGATGGAGACGGG + Intronic
1105478858 13:20754945-20754967 ATGTAGGGGAAGATGGAGCCAGG + Intronic
1106022902 13:25931659-25931681 AATTAGAAGGAGCTTGAGCTGGG + Intronic
1106623384 13:31393365-31393387 ATTTCGAAAGAGACTGAGCCAGG - Intergenic
1112211204 13:97379623-97379645 ATGTACAAGCAGAAAGAGCCAGG + Intronic
1115082173 14:29468050-29468072 ATGCAGTAGGAGATTGATCCAGG + Intergenic
1116140415 14:40986265-40986287 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
1116444915 14:44997711-44997733 ATTTAGAAAGAGGTTGAGGCCGG + Intronic
1116709311 14:48345208-48345230 ATTTAAAAGAAAATTGAGCCAGG + Intergenic
1118886407 14:69870478-69870500 ATGTAGAAGGAGACTGCACAAGG - Intronic
1119058941 14:71454197-71454219 ATGTACAAGGCAATTGAGGCTGG + Intronic
1120141190 14:80931820-80931842 ATTTTGAAAGAGACTGAGCCAGG + Intronic
1124521293 15:30408221-30408243 ATATAGAAGGAGAGAGGGCCCGG - Exonic
1124537369 15:30557996-30558018 ATATAGAAGGAGAGAGGGCCCGG + Exonic
1124761286 15:32449591-32449613 ATATAGAAGGAGAGAGGGCCCGG - Exonic
1124777348 15:32599472-32599494 ATATAGAAGGAGAGAGGGCCCGG + Exonic
1126457170 15:48876304-48876326 ATTTTGAAAGAGACTGAGCCAGG + Intronic
1127616476 15:60690949-60690971 CTGTGGAAGGAGTTTGAGCAGGG - Intronic
1127647075 15:60969574-60969596 ATGGAGAAGGAGATGAAGACAGG + Intronic
1128984753 15:72211361-72211383 ATCTAGAAAGTGATTGAGGCCGG - Intronic
1129064905 15:72893839-72893861 ATGTAGAAAGAGATGGGGGCTGG - Intergenic
1132433125 15:101776350-101776372 ATGTGGAAGGAAGATGAGCCAGG - Intergenic
1133178520 16:4034712-4034734 ATGTAAAAGGACTTTGGGCCAGG - Intronic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1135160883 16:20095196-20095218 AGGTAGTAAGAGATGGAGCCAGG - Intergenic
1135510182 16:23075990-23076012 AGGTAGGAGGATCTTGAGCCCGG + Intronic
1135564267 16:23499755-23499777 ATGTAAAAGAAAACTGAGCCGGG - Intronic
1136538872 16:30917233-30917255 CTGGGGTAGGAGATTGAGCCTGG - Intergenic
1139660671 16:68418774-68418796 ATTTACAAGGAGACAGAGCCAGG - Intronic
1140710612 16:77673956-77673978 ATATAAAAGGAGTTTGAGGCCGG + Intergenic
1144653228 17:17019806-17019828 AGGGAGAAGGAAATTGAACCAGG + Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1148986009 17:51622018-51622040 ATGTTGAAGGAAATTTAGGCTGG - Intergenic
1149140014 17:53420991-53421013 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
1150138782 17:62711588-62711610 ATGTGGAATGGGATTGAGCCTGG - Intronic
1152287476 17:79421390-79421412 ATGTGGAAGGAGGCTGGGCCTGG + Intronic
1152883085 17:82831551-82831573 ATGTGGCTGGAGATGGAGCCAGG + Exonic
1156286835 18:35705038-35705060 ACGAAGAAGGAGAGAGAGCCAGG - Intronic
1156762284 18:40607377-40607399 ATATAGAAAGAGATTTAGCAAGG - Intergenic
1157418791 18:47527533-47527555 ATGGAGGAGGAGACTGAGCTGGG + Intergenic
1157419496 18:47533468-47533490 ATGTGGAGGGATATAGAGCCCGG + Intergenic
1157589879 18:48829935-48829957 ATCAAGAAGGAGCTGGAGCCTGG - Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1158284127 18:55860287-55860309 ATGTATCAGGAGATTGGGGCGGG + Intergenic
1158446669 18:57528178-57528200 ATGTAGAGGGAAACTGTGCCTGG - Intergenic
1159269318 18:66128495-66128517 ATGTAGCAGGAGTATGGGCCAGG - Intergenic
1161652821 19:5495898-5495920 TTGTGGAAGAAGATGGAGCCAGG + Intergenic
1163337407 19:16682299-16682321 CTCTAGAAGGACACTGAGCCTGG - Intronic
1163896777 19:20066212-20066234 ATATAGGAATAGATTGAGCCGGG - Intergenic
1164543804 19:29142537-29142559 ATGTGGAAGGAGAATAAGCTGGG - Intergenic
926824667 2:16892556-16892578 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
927000288 2:18787904-18787926 ATGTATGAGGAGAATGAGTCAGG + Intergenic
927734223 2:25503965-25503987 ATGTAGAAATAAATTTAGCCTGG + Intronic
928113009 2:28525621-28525643 GGGTAGAATGAGACTGAGCCTGG - Intronic
928715350 2:34054496-34054518 ATGTAGAAAGAGATAGATCTGGG - Intergenic
928786216 2:34888920-34888942 GTGTAGATGCAGATTGAACCTGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935002567 2:99033922-99033944 ATTTTGAAGGAGGGTGAGCCAGG + Intronic
935916284 2:107954476-107954498 ATGAGGAAGGAGGTTGAGGCTGG + Intergenic
936162560 2:110095779-110095801 TTGGAGAGGGAGGTTGAGCCTGG + Intronic
936714366 2:115168049-115168071 ATGTAGCAGGAGAGTGTGCTTGG + Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939618511 2:144389279-144389301 ATGTAGACGGAGTTGGAGCTGGG - Exonic
941342396 2:164323605-164323627 ATGTAGTAGGTGCTTGAGACTGG - Intergenic
944256267 2:197626263-197626285 ATGTAAAAGGAGAATAAGCATGG + Intronic
945413535 2:209542144-209542166 ATGTACAAGGAGATTGATGTTGG - Intronic
946111671 2:217425127-217425149 ATGAAAAAGGGGAATGAGCCAGG - Intronic
947082254 2:226411800-226411822 AGGTAGAAGGAATTTGAGCGAGG - Intergenic
947700707 2:232231907-232231929 ACACAGAAGGGGATTGAGCCTGG + Intronic
1168946935 20:1768873-1768895 ATTTTGAAGGAGCTTGAGCCAGG + Intergenic
1169649288 20:7849127-7849149 ATGTAGAATCAGAGTGATCCTGG - Intergenic
1170471912 20:16676168-16676190 ATTTAGAAGGTGATTAAGTCAGG + Intergenic
1170733633 20:18994879-18994901 ATGTAGCAGGGGATTGTGGCTGG + Intergenic
1170767656 20:19304543-19304565 ATGTACAAGGAGGTGGAGCCAGG - Intronic
1174792915 20:53497176-53497198 GTGTTGAAGGACCTTGAGCCAGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177273906 21:18882028-18882050 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
1178383527 21:32131380-32131402 ATGTTGAAGGCGTTGGAGCCGGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183456197 22:37924633-37924655 ATGGGAAAGGAGAGTGAGCCAGG - Intronic
1184113061 22:42406436-42406458 AAGTGGAAGGAGATGCAGCCAGG - Intronic
1184513997 22:44949378-44949400 ATTTTGAAAGAGATAGAGCCAGG - Intronic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
949895775 3:8766838-8766860 AAGTTGAAGGAGCTTGAGCTTGG + Intronic
950675241 3:14550601-14550623 ATGCATGAGGAGATTGAGGCCGG - Intergenic
950758465 3:15198321-15198343 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
950924064 3:16722636-16722658 ATGTGGTAGGAGAGAGAGCCTGG + Intergenic
953039016 3:39238257-39238279 AGGAAGAAGGAGATTGAGAAAGG - Intergenic
953160686 3:40416494-40416516 ATCTAAAAGGAGGCTGAGCCTGG - Intronic
953563967 3:44015290-44015312 ATCTAGAAAGAGGTAGAGCCAGG + Intergenic
953862740 3:46558902-46558924 GTGTAGAAAGAGATTGGGGCCGG + Intronic
953956449 3:47235538-47235560 TTGTAGAAGGAGATGGAATCAGG + Exonic
954373865 3:50184190-50184212 AGGAAGGAGGAGAGTGAGCCTGG + Intronic
954904273 3:54046514-54046536 ATCTAGAAGGAGATAGAACTAGG + Intergenic
955633726 3:61002843-61002865 ATGGAGCAGGAAATTGGGCCGGG - Intronic
956041694 3:65151820-65151842 ATGTTGAAGGAGTCAGAGCCTGG - Intergenic
956720406 3:72112569-72112591 TTGTAGAAGGAAAATGAGACTGG + Intergenic
957798628 3:85044968-85044990 ATATAGAAGTAGAGTGTGCCAGG - Intronic
962635924 3:137331388-137331410 ATGGAAAAGAAGAGTGAGCCAGG - Intergenic
964202878 3:154137899-154137921 ATGGAGAAGGGGATAGAGACTGG - Intronic
967828787 3:193901001-193901023 AAGTAGATGGAGAATGACCCAGG + Intergenic
969268147 4:6079404-6079426 AGGTAGAGGGAGATGGAGGCAGG + Intronic
969923351 4:10561194-10561216 ATGAAGAGGGAGTTTTAGCCAGG - Intronic
973174564 4:47188992-47189014 TTTTAGAAGGAGATAGAGTCTGG + Intronic
974093286 4:57334929-57334951 AGGCAGAAGGAGATTGTGCACGG + Intergenic
974957560 4:68661163-68661185 ATGTAAAAGGAAAATAAGCCTGG + Intronic
977776627 4:100928717-100928739 ATGTCCAAGGAGGTTGAGGCAGG + Intergenic
978414039 4:108456918-108456940 ATGGTGGAGGAGATTAAGCCCGG - Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
979598858 4:122564266-122564288 ATGAAGAAGGAAACTGAGCCAGG - Intergenic
979623247 4:122819106-122819128 ATTTGGAAAGAGACTGAGCCAGG - Intergenic
979829196 4:125279813-125279835 ATTTGGAAAGAGACTGAGCCAGG + Intergenic
980333835 4:131443254-131443276 ATATAAAATGACATTGAGCCAGG + Intergenic
980900656 4:138902101-138902123 GTGTACAAGGAGATTAAACCAGG + Intergenic
981322428 4:143408122-143408144 ATGTGGAAGGAGTCTCAGCCAGG - Intronic
981518598 4:145636646-145636668 ATGTTGAAGAAGGTTGAGGCAGG - Intronic
982727602 4:158921860-158921882 ATGTAGAAGGAATGGGAGCCAGG - Intronic
983954192 4:173677734-173677756 ATATAGAAGGTGAATGAGCAAGG + Intergenic
988136037 5:27173239-27173261 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
988136081 5:27173546-27173568 ATCTTGAAAGAGACTGAGCCAGG + Intergenic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
993045688 5:82863787-82863809 ATATATAAGGAGAAGGAGCCAGG - Intergenic
994909625 5:105885983-105886005 ATGTAGAAGGATATAGAGAAGGG - Intergenic
995214309 5:109577402-109577424 ATGTACAAGGAGATTGATGTTGG - Intergenic
995611004 5:113910269-113910291 AATTAAAAGGAGATTGAGGCTGG - Intergenic
996128914 5:119757409-119757431 ATGGAAAAGTAGAGTGAGCCAGG + Intergenic
996128964 5:119757914-119757936 ATTTATAAGGAAATTCAGCCAGG - Intergenic
999577838 5:152999704-152999726 ATTTAGTAGGGGGTTGAGCCTGG + Intergenic
1000864300 5:166493469-166493491 ATGGTGAAGGAGATTGAGTCTGG + Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003905668 6:10697444-10697466 ATGAAAAAGAAGATTGAGCATGG + Exonic
1004991279 6:21141208-21141230 ATGTAGAAGTAGACAGAGCTTGG - Intronic
1005499948 6:26421099-26421121 ATGTAGAGGGAGATTTTGCTGGG - Intergenic
1009523620 6:64715673-64715695 ATTTTGAAAGAGACTGAGCCAGG - Intronic
1010854313 6:80818662-80818684 AGGTAGAAGAAGGTTGAGGCTGG + Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011146407 6:84222445-84222467 ATGTAGAATGAGATTGAAAAAGG - Intronic
1011350205 6:86414714-86414736 CTGTAGAAGGAGACTGTGGCAGG + Intergenic
1012614505 6:101260349-101260371 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
1013940897 6:115660588-115660610 AAGTTGAACAAGATTGAGCCTGG + Intergenic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1016442518 6:144098347-144098369 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
1016736401 6:147484844-147484866 ATGTACACTGAGACTGAGCCTGG + Intergenic
1017195574 6:151696611-151696633 TTGTAGAGTGAGATTGAGCCTGG + Intronic
1019853919 7:3585582-3585604 ATGAAGAAGGAAATTGATCAGGG + Intronic
1021274146 7:18628254-18628276 AGGTAAAAGGAGATGAAGCCAGG - Intronic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1022809956 7:33859216-33859238 ATGAAGAATAGGATTGAGCCTGG + Intergenic
1023851627 7:44153378-44153400 ATGCAGAAGGAGATGGACCGCGG - Exonic
1024222106 7:47297183-47297205 ATGTTGAAGGACAAGGAGCCGGG - Exonic
1026235844 7:68526717-68526739 ATGTAGAAGGAAATAGAACAAGG - Intergenic
1026275659 7:68873507-68873529 ATGTAGATTGAGATTGAGGTTGG + Intergenic
1026941562 7:74290305-74290327 GGGTAGGAGGAGATTGAGGCGGG + Intronic
1026948493 7:74331871-74331893 ATGTAGAATGAAACTGATCCCGG - Intronic
1029576598 7:101407497-101407519 AAGCAGAAGGTGATTGAGCTGGG - Intronic
1030356109 7:108544229-108544251 ATAAAGAAGGACATTGGGCCAGG + Intronic
1031736520 7:125369300-125369322 ATGGAGAAGTACATTGAGCTTGG + Intergenic
1031858956 7:126957138-126957160 ATGTAGAGGGAGCTTGTGCCTGG + Intronic
1032392508 7:131565146-131565168 ATAAAGAAAGAGATTTAGCCTGG + Intergenic
1034051587 7:147989717-147989739 ATGTGGAAGGACATTGTCCCTGG - Intronic
1037783936 8:21891257-21891279 ATGTAGCAAAAGAGTGAGCCAGG + Intergenic
1038088101 8:24222459-24222481 AGCTAGAAGGGGATTGACCCAGG - Intergenic
1041098526 8:54373455-54373477 GTGTTGAAGGGGAGTGAGCCCGG + Intergenic
1041854837 8:62439429-62439451 ATTTAGCAGGTGTTTGAGCCTGG + Intronic
1043729834 8:83662778-83662800 GTGTAGAAAGAGAATGAGACGGG + Intergenic
1044342697 8:91065740-91065762 ATGTAGAGTGAAAATGAGCCTGG + Intergenic
1044691559 8:94885142-94885164 TTGGAGAAAGAGATTTAGCCAGG + Exonic
1046238099 8:111453738-111453760 ATTTTGAAAGAGAATGAGCCAGG + Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1048879992 8:138864194-138864216 CTTTAGAAGGAGAATGGGCCAGG - Intronic
1050946247 9:11523125-11523147 CTGTAGAGGGAGATATAGCCTGG - Intergenic
1051538696 9:18190010-18190032 ATCTAGAACAAGAATGAGCCTGG + Intergenic
1053601986 9:39620130-39620152 ATGTAGAAAGAGTTAGTGCCTGG - Intergenic
1053859643 9:42373895-42373917 ATGTAGAAAGAGTTAGTGCCTGG - Intergenic
1054251550 9:62722305-62722327 ATGTAGAAAGAGTTAGTGCCTGG + Intergenic
1054565661 9:66756817-66756839 ATGTAGAAAGAGTTAGTGCCTGG + Intergenic
1054949688 9:70836101-70836123 ATGTTGAAGGAGTTTTAACCTGG - Intronic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055245389 9:74235419-74235441 ATTTAGAAGGAGATAGTCCCTGG - Intergenic
1055590056 9:77802947-77802969 ATGTGGAAGAATATTGAGCTCGG - Intronic
1055657178 9:78462587-78462609 ATGTGGAAGTATATTGAACCTGG + Intergenic
1055973249 9:81931892-81931914 ATGGAGATTGAGGTTGAGCCAGG - Intergenic
1055975002 9:81946984-81947006 ATGGAGATTGAGGTTGAGCCAGG - Intergenic
1055980041 9:81992210-81992232 ATGGAGATTGAGGTTGAGCCAGG - Exonic
1057131816 9:92659555-92659577 ATGTAGGAGGAGAATGCGCCTGG + Intronic
1058507798 9:105684016-105684038 AGATAAAAGGAGATTGAGACTGG - Intergenic
1058866190 9:109164324-109164346 TTGTAAAAGGAAGTTGAGCCAGG + Intronic
1059260305 9:112969890-112969912 CTGCAGAAGGAGATTGCTCCAGG + Intergenic
1059714170 9:116898108-116898130 ATGTGGAAGGAGTTTGAAGCTGG + Intronic
1060743767 9:126116641-126116663 ATGAACAAGTAGATTTAGCCTGG - Intergenic
1195090985 X:101458780-101458802 AATTAGTAGGATATTGAGCCGGG - Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1198708690 X:139477799-139477821 ATGTAGCTGGAAATTGAGCAGGG - Intergenic
1199426927 X:147712939-147712961 ATGAAGAATGAAATTGGGCCGGG - Intergenic
1201564825 Y:15354906-15354928 ATGTAGAAGGATATTGGGCCGGG + Intergenic