ID: 1085707426

View in Genome Browser
Species Human (GRCh38)
Location 11:78799186-78799208
Sequence GGCCACTGACCTAGTTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085707423_1085707426 -10 Left 1085707423 11:78799173-78799195 CCCTTGTGCTGTGGGCCACTGAC 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1085707426 11:78799186-78799208 GGCCACTGACCTAGTTGTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1085707422_1085707426 -3 Left 1085707422 11:78799166-78799188 CCTAACTCCCTTGTGCTGTGGGC 0: 1
1: 0
2: 3
3: 26
4: 249
Right 1085707426 11:78799186-78799208 GGCCACTGACCTAGTTGTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1085707420_1085707426 -2 Left 1085707420 11:78799165-78799187 CCCTAACTCCCTTGTGCTGTGGG 0: 1
1: 1
2: 72
3: 983
4: 2498
Right 1085707426 11:78799186-78799208 GGCCACTGACCTAGTTGTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085707426 Original CRISPR GGCCACTGACCTAGTTGTTT GGG Intronic
901149746 1:7093316-7093338 GGCCACTGGCCTAGTTTTCTGGG + Intronic
901595565 1:10382817-10382839 GGCCACTGTCCTGGGTGTTTGGG + Intergenic
902942974 1:19813839-19813861 GGCAAGTGTCCTGGTTGTTTAGG - Intergenic
904676190 1:32200697-32200719 GGCTACTGACCTGGAGGTTTGGG - Exonic
911070316 1:93827035-93827057 GGACTGTGACCTATTTGTTTTGG + Intronic
915348654 1:155211315-155211337 GGCCACTGCCCTGATTGCTTAGG + Intronic
915351847 1:155231943-155231965 GGCCACTGCCCTGATTGCTTAGG + Intergenic
916720509 1:167481915-167481937 GGCCTCTGACCAAGTTGATCTGG + Intronic
919238170 1:194873444-194873466 TGCCACTGTGCTATTTGTTTGGG + Intergenic
920641388 1:207754681-207754703 TGCCACTGCCCTAGCTTTTTAGG - Intronic
921762437 1:218931548-218931570 GGCCTCTAACGTATTTGTTTAGG - Intergenic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
1068355757 10:55906853-55906875 GGCCTGTGACCTCTTTGTTTTGG - Intergenic
1069347893 10:67491310-67491332 TGGCACTGTCCTAGTTGTTGGGG + Intronic
1069638359 10:69939400-69939422 GGCCACTGACATATTTTTTATGG - Intronic
1070727438 10:78802101-78802123 TGCCCCTGACCTAGCTGGTTTGG - Intergenic
1085707426 11:78799186-78799208 GGCCACTGACCTAGTTGTTTGGG + Intronic
1088503165 11:110504482-110504504 TGCCTCTGACCCAGTTATTTGGG + Intergenic
1091629857 12:2151787-2151809 GTCCACTGACCTATGTATTTGGG - Intronic
1092048423 12:5450007-5450029 GGCCACTGCCCTAGTGGTTGGGG + Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1096463140 12:51833883-51833905 GGGCACTGTCCTAGGTGCTTGGG - Intergenic
1100006980 12:89906321-89906343 GGCCACTTACCTACTGTTTTAGG + Intergenic
1102880487 12:116481337-116481359 GGCCACAGAGCTATTTGTCTTGG + Intergenic
1104426456 12:128682225-128682247 GGCCACAGCCCTAGTTTCTTTGG - Intronic
1107215714 13:37916198-37916220 GGCCACTGATGTTGTTGCTTAGG + Intergenic
1108560311 13:51636739-51636761 TTCCACTGACCTATTTGTCTAGG - Intronic
1111476936 13:88761972-88761994 TGCCTGGGACCTAGTTGTTTAGG + Intergenic
1111679680 13:91427473-91427495 GGCCAGTAACCTCTTTGTTTTGG + Intronic
1121855896 14:97269910-97269932 GCCCTGTGACCTAGTTCTTTTGG - Intergenic
1125451910 15:39817259-39817281 GGGCACTGCTCTATTTGTTTAGG + Intronic
1134756303 16:16670504-16670526 GGGCACTGTGCTAGGTGTTTTGG - Intergenic
1134989767 16:18688660-18688682 GGGCACTGTGCTAGGTGTTTTGG + Intergenic
1135241271 16:20808482-20808504 GGGCACTGACCTAGGTGCTTGGG + Intronic
1135938970 16:26804334-26804356 GGCCACTGCCCTACCTGGTTGGG - Intergenic
1135960063 16:26987827-26987849 GGACACTGACTCAGTTTTTTTGG - Intergenic
1137014993 16:35365719-35365741 GGCCAATCACCTAGGTGTTGGGG - Intergenic
1141599521 16:85117008-85117030 GGACTCTGAGCCAGTTGTTTTGG + Intergenic
1145997408 17:29112612-29112634 GGCCACAGGCCTAGTTTGTTTGG - Intronic
1148022329 17:44561648-44561670 GGCCACTGACACAGATGATTTGG - Intergenic
1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG + Intronic
1151440807 17:74127831-74127853 GGGCACTGAACTAGCTTTTTGGG - Intergenic
1153491090 18:5648562-5648584 GGCCACTGACCTCCATTTTTTGG - Intergenic
1156584817 18:38420496-38420518 TGCCACTGTCTTAGTTGGTTTGG - Intergenic
926774345 2:16407297-16407319 GGCCACTCAGTCAGTTGTTTGGG - Intergenic
930917669 2:56713538-56713560 AGCGACTGACCTAGTAGATTAGG - Intergenic
933915126 2:86983139-86983161 GGACACTGTCCTAGTTTTGTAGG + Intronic
934007868 2:87786761-87786783 GGACACTGTCCTAGTTTTGTAGG - Intronic
935771507 2:106427679-106427701 GGACACTGTCCTAGTTTTGTAGG - Intronic
935908566 2:107868268-107868290 GGACACTGTCCTAGTTTTGTAGG + Intronic
935994964 2:108760486-108760508 GGACACTGTCCTAGTTTTATAGG + Intronic
936130353 2:109833392-109833414 GGACACTGTCCTAGTTTTGTAGG + Intronic
936214344 2:110538093-110538115 GGACACTGTCCTAGTTTTGTAGG - Intronic
936423480 2:112392656-112392678 GGACACTGTCCTAGTTTTGTAGG - Intronic
936716826 2:115196700-115196722 GGCCTCTGACCATGTTCTTTTGG + Intronic
945336543 2:208599451-208599473 GGCCTCTGACCACTTTGTTTTGG - Intronic
946986080 2:225274978-225275000 GGCCACTGGCCAAGATGTTCTGG - Intergenic
1172047565 20:32091376-32091398 GGCCACTTACCTATTTCTCTGGG + Intronic
1172746077 20:37210190-37210212 GGGCGCTGACCTCTTTGTTTTGG + Intronic
1172843665 20:37916677-37916699 GGCCACTTCCCAGGTTGTTTTGG + Intronic
1175601176 20:60274405-60274427 GGCCCCTGGCCTAGAAGTTTTGG + Intergenic
1178626011 21:34219467-34219489 GGCCACTTGCCTAGTGATTTGGG + Intergenic
1179064798 21:38015019-38015041 GGACACTGACCTGGTGGTTAAGG + Intronic
950167243 3:10810759-10810781 GTCCACTGACCCAGTGGTTCTGG + Intergenic
950852035 3:16071034-16071056 GGACACTGACCTACTTCTTATGG + Intergenic
961837098 3:129671214-129671236 GGCCACTGCACTGGATGTTTGGG + Exonic
963815346 3:149824784-149824806 GACCTCTGACCTAGTTCTTTTGG - Intronic
963927037 3:150961431-150961453 GACCACTGATCTAATAGTTTTGG + Intronic
967574838 3:191077395-191077417 GGCCACCACCTTAGTTGTTTGGG + Intergenic
972558110 4:40200480-40200502 GACCACTTTCCAAGTTGTTTTGG - Intronic
976916245 4:90378730-90378752 GGTTTCTGACATAGTTGTTTAGG + Intronic
980644078 4:135619133-135619155 GGCCACTGTCCTAGTTGGAAAGG - Intergenic
983488739 4:168362553-168362575 GGGCACTGAGCTGGTTATTTGGG - Intronic
983557702 4:169073051-169073073 GGAAACTGACATAGTTGCTTGGG - Intergenic
988740039 5:34061098-34061120 GGCCTGTAACCTTGTTGTTTTGG - Intronic
990610117 5:57448462-57448484 GGCCACGGCCCAAGTTGTTTGGG + Intergenic
994113273 5:96032651-96032673 GGCAACAGACCTAGGGGTTTTGG - Intergenic
995119832 5:108523981-108524003 CTTCACTGACCTAGTTTTTTTGG + Intergenic
999082786 5:148859960-148859982 TGTCACTGACCTAGTTTTCTTGG + Intergenic
1004539834 6:16539347-16539369 GGCCTCTGAGCTAGTTGGCTGGG - Intronic
1014647810 6:123996391-123996413 GGACAATAACCTAGTTATTTGGG - Intronic
1015045110 6:128767729-128767751 GGCCTCTGACCCATTTGTTTTGG - Intergenic
1015450802 6:133364202-133364224 TGCCAATGACCTAGGTGTTTGGG + Intronic
1016257075 6:142120176-142120198 GTCCAATCATCTAGTTGTTTAGG - Intergenic
1018707791 6:166475569-166475591 GGCCACTGATCTATTTGAGTGGG - Intronic
1020577632 7:9954709-9954731 GGCCACAGATCTAGTGGTGTAGG + Intergenic
1023354956 7:39357327-39357349 AGGCACTGTCCTAGGTGTTTTGG + Intronic
1038399616 8:27273070-27273092 GTCCACTGACTTTGTTGTTGTGG + Intergenic
1040615467 8:49032560-49032582 GGGCTCTGACAAAGTTGTTTTGG + Intergenic
1047001605 8:120578798-120578820 AGCCACTGACCCAGATGATTTGG - Intronic
1057536295 9:95910846-95910868 TGCCACTGACTTAGTTGTGAAGG - Intronic
1057711068 9:97445324-97445346 AGCCACTGACCTGGGTGTTAGGG + Intronic
1059982126 9:119784643-119784665 TGCCACTGAGCTAGTTTTCTGGG + Intergenic
1060120740 9:120987239-120987261 GGCCATTGGCCTAGATGTTATGG + Intronic
1188247319 X:27852334-27852356 GGACACTGATCTATTTATTTGGG - Intergenic
1189011423 X:37049211-37049233 GGCCTCTGGCCTCTTTGTTTTGG + Intergenic
1189439551 X:41022528-41022550 TGGCACTGTCCTTGTTGTTTTGG + Intergenic
1195241821 X:102960058-102960080 TGCCACTGACTTAAATGTTTGGG + Intergenic
1195673531 X:107488648-107488670 AGCCACTGGGCTAGGTGTTTTGG + Intergenic
1200802401 Y:7398650-7398672 GGCCACTCAAATTGTTGTTTTGG - Intergenic
1200822500 Y:7601421-7601443 GGCAACTGAACTCTTTGTTTGGG - Intergenic
1201973402 Y:19819535-19819557 GGCCACAAATTTAGTTGTTTAGG + Intergenic