ID: 1085708999

View in Genome Browser
Species Human (GRCh38)
Location 11:78812298-78812320
Sequence CAGAGCACGGGGCAGGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 854
Summary {0: 1, 1: 0, 2: 8, 3: 79, 4: 766}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085708991_1085708999 4 Left 1085708991 11:78812271-78812293 CCTTTCATGTATTGGCCATTTCC 0: 1
1: 0
2: 0
3: 15
4: 180
Right 1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG 0: 1
1: 0
2: 8
3: 79
4: 766
1085708988_1085708999 29 Left 1085708988 11:78812246-78812268 CCAGCCACTGTGGCACAAGCATC 0: 1
1: 0
2: 2
3: 20
4: 381
Right 1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG 0: 1
1: 0
2: 8
3: 79
4: 766
1085708989_1085708999 25 Left 1085708989 11:78812250-78812272 CCACTGTGGCACAAGCATCTGCC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG 0: 1
1: 0
2: 8
3: 79
4: 766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085708999 Original CRISPR CAGAGCACGGGGCAGGAGGC TGG Exonic
900096163 1:940990-941012 TCGGGCACGGGGCAGGAGGATGG - Intronic
900240466 1:1615127-1615149 CAGAACCCGGGGCGGGAGGACGG + Intergenic
900458595 1:2789537-2789559 CAGAGCGCAGGGCCGGAGGGAGG - Exonic
900488478 1:2934804-2934826 CAGGGCTGGGGGCTGGAGGCCGG - Intergenic
900519158 1:3097419-3097441 CAGGGCACGGGGCGGCAGCCTGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900584387 1:3425469-3425491 CTGTGCACGGGGCACGGGGCAGG + Intronic
900645749 1:3707927-3707949 AGGAGCATCGGGCAGGAGGCGGG + Intronic
900646847 1:3712932-3712954 CAGAGGGTGGGGCAGGGGGCAGG - Intronic
901001120 1:6149212-6149234 CAGAGCCCCGGGCTGGGGGCGGG - Intronic
901089213 1:6630221-6630243 CAGAGCTCGGGGCAGGCCTCGGG - Intronic
901196827 1:7445034-7445056 CCTAGCACGGGGTAGGAGGTGGG + Intronic
901236798 1:7671524-7671546 CTGGGCAGGGGGCAGAAGGCTGG + Intronic
901373138 1:8817533-8817555 AAAAGGACGGGGGAGGAGGCGGG + Intronic
901634477 1:10664238-10664260 CAGGGCACCGGGCACAAGGCTGG + Intronic
901642724 1:10701223-10701245 CAGGGACCCGGGCAGGAGGCAGG - Intronic
902049904 1:13554998-13555020 CCGGGCACGGGGCGGGAGGCGGG - Intergenic
902078652 1:13806235-13806257 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902078664 1:13806268-13806290 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902361484 1:15944661-15944683 CAGGGGCCGGGGTAGGAGGCCGG + Intronic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
902517335 1:16996490-16996512 CAGAACCCTGGGGAGGAGGCGGG + Exonic
902546522 1:17193849-17193871 GAGAGCAGGAGGCAGGAGGTGGG + Intergenic
902610651 1:17595406-17595428 CAGAGCAGGAGGCCAGAGGCTGG + Intronic
902713262 1:18255110-18255132 CAGAGGAAGGGGCTGGAGACTGG - Intronic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902840394 1:19070525-19070547 CAGGGCCCGGAGCAGGAGCCGGG + Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
903122945 1:21228068-21228090 CTCAGCACAGGGCGGGAGGCAGG + Intronic
903232991 1:21933279-21933301 AGGAGCAGGTGGCAGGAGGCCGG + Intronic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903811792 1:26038782-26038804 CTGAGAATGGGGCATGAGGCAGG + Exonic
904053551 1:27655718-27655740 CAGAGGAGGAGACAGGAGGCAGG + Intergenic
904285835 1:29452806-29452828 CAGAGCACGGGGATGCAGGAGGG + Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904616588 1:31753425-31753447 AAGAGCACTGGGCTGGGGGCTGG - Intronic
904789888 1:33011545-33011567 GAGAGCTCAGGTCAGGAGGCTGG + Intronic
905473033 1:38207347-38207369 CAGTGCCTGAGGCAGGAGGCAGG + Intergenic
905950914 1:41949828-41949850 CAGAGCATGGGCTAGCAGGCTGG - Intronic
906040508 1:42785013-42785035 CAGGAAACGGGGCAGGAGGGCGG + Intronic
906066036 1:42980752-42980774 CAGATCACAGGACAGGAGACTGG + Intergenic
906155992 1:43614269-43614291 CAGAGCACAGGGCAGCAGGCAGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906836243 1:49086016-49086038 GAGACCACGGGGCTGGAGGCTGG - Intronic
907241969 1:53085895-53085917 GAGAGCAGGGGACTGGAGGCAGG + Intergenic
907290951 1:53412542-53412564 AAGAGCAGCGGGCAGGAGCCAGG - Intergenic
907414273 1:54303374-54303396 CAGCCCAGGGGGCAGGGGGCAGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
915146721 1:153799960-153799982 CAGGGCAGGAGGCAAGAGGCTGG + Intergenic
916641202 1:166730197-166730219 CAGAGCAGGGGTCAGGGGGAGGG - Intergenic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
918344381 1:183593449-183593471 ATGAGCACAGGGCAGCAGGCAGG - Intronic
918650159 1:186952696-186952718 GAGGGGACGGGGCAGGAGACAGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919728120 1:200896854-200896876 CAGAGCGCGGGGCCGCAGGGTGG - Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920376835 1:205513319-205513341 CAGAGCAAGGGGCAAGGGCCAGG - Intronic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
920987712 1:210906178-210906200 CCGAGCACGAGGCTTGAGGCAGG - Intronic
921117517 1:212107658-212107680 CAGAGCTGGGGGCAGCAGTCAGG - Intergenic
921672972 1:217946731-217946753 AAGAACTCGGGGGAGGAGGCAGG + Intergenic
922730548 1:227946928-227946950 CGGCGCTCGGGGTAGGAGGCTGG + Intronic
922822487 1:228493908-228493930 CAGAGCTGGAGGCAGGAGGATGG + Exonic
922975532 1:229780478-229780500 CAGAGCACTGGGTGGCAGGCAGG + Intergenic
923118578 1:230968565-230968587 TAGAGCAGGGGGCAGGTGGGAGG + Intronic
1062857055 10:784674-784696 CAGACCCCGGGGCGGGAGGTGGG - Intergenic
1062885945 10:1016047-1016069 GAGAGCACGGGTCAGGGTGCAGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063366414 10:5493614-5493636 GAGAGGAGGGGGCAGGAGGGAGG - Intergenic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1063534856 10:6873407-6873429 CAGACCACGGGTCAGGTGGGAGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063981215 10:11453325-11453347 AAGAGGCTGGGGCAGGAGGCTGG + Intergenic
1064742910 10:18451376-18451398 CAGAGCAGGGGCCAGGTGGGAGG - Intronic
1066485823 10:35843800-35843822 AAGACCACGGGGCAGCAGGCAGG - Intergenic
1067343025 10:45419524-45419546 TGGAGCACGGGGCATGTGGCTGG - Intronic
1067581877 10:47451446-47451468 CAGGGCCAGGGCCAGGAGGCGGG + Intergenic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1068525563 10:58125538-58125560 AAGGGCAGGGGGCAGGGGGCAGG + Intergenic
1069562717 10:69442034-69442056 GAGAGCAGGGGACAGGAGGAAGG + Intergenic
1069613697 10:69792641-69792663 TAGAGCACAGGGCAGTGGGCTGG - Intergenic
1069743599 10:70700760-70700782 CATAGCACCGGGCAGGACGTTGG + Intronic
1069797652 10:71063554-71063576 CAGGGCTTGGGGCGGGAGGCAGG + Intergenic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070705464 10:78634620-78634642 CCGGGCATGGGGCTGGAGGCTGG - Intergenic
1070788804 10:79177584-79177606 GACATCCCGGGGCAGGAGGCAGG - Intronic
1070791758 10:79193817-79193839 CAGAGCACAGTCCGGGAGGCAGG + Intronic
1071386119 10:85123075-85123097 CAGAGAAGGGGTGAGGAGGCAGG + Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072471466 10:95717832-95717854 CAGAGCATGGGCTAGCAGGCCGG + Intronic
1072541304 10:96399915-96399937 CTGAGTACTCGGCAGGAGGCAGG + Intronic
1072696765 10:97609630-97609652 TATAGCCAGGGGCAGGAGGCAGG - Intronic
1074190208 10:111128904-111128926 CGGAGCAGGGGGCAGGGGGGAGG - Intergenic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075726554 10:124613542-124613564 CAGGGCAGAGGGCAGAAGGCAGG - Exonic
1075798005 10:125134875-125134897 GGGGGCAGGGGGCAGGAGGCAGG - Intronic
1075840647 10:125499525-125499547 CAGAGCACAGAGCTGCAGGCAGG + Intergenic
1075897403 10:126008979-126009001 CACAGCAGGGGGCATGAGCCTGG - Intronic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076164099 10:128268263-128268285 CAGAGCAGGCGGGAAGAGGCAGG + Intergenic
1076599966 10:131650983-131651005 CCGAGCACAGGGCAGGAGCGGGG + Intergenic
1076610899 10:131725427-131725449 CACTGCACGGGGCATGATGCCGG + Intergenic
1076719077 10:132385109-132385131 CCACGCACAGGGCAGGAGGCAGG - Intergenic
1076812923 10:132898565-132898587 CAGAGGGCAGGGCAGGGGGCGGG - Intronic
1076840041 10:133041360-133041382 CAGGGCACCTGGCAGGAGTCTGG + Intergenic
1077299805 11:1841702-1841724 CAGAGCATGGCCCAAGAGGCTGG - Intergenic
1077438955 11:2559407-2559429 TAGAGCCCGGGGCAGGGGGAGGG + Intronic
1077540177 11:3142980-3143002 CAGAGCAGGGCAGAGGAGGCAGG + Intronic
1077582042 11:3422992-3423014 CGGAGAACGGCTCAGGAGGCGGG + Intergenic
1079933346 11:26591352-26591374 CAGAGCATGGGCTAGCAGGCTGG + Intronic
1080338981 11:31234707-31234729 CGGAGGAGGGGGCAGGAGGCAGG + Intronic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1081570884 11:44290071-44290093 CAGACCACAGGGCTGGATGCAGG - Intronic
1081851605 11:46278297-46278319 CACATCACTGGGCAGGAGCCGGG + Intronic
1081914432 11:46721644-46721666 CAGAACACAGTGCAGGAGGGAGG - Intronic
1082083712 11:48032047-48032069 CAGAGCACTGGGCACTGGGCTGG - Intronic
1082805329 11:57445625-57445647 CTGAGCACGGGGCCAGGGGCTGG - Intergenic
1083163332 11:60868891-60868913 CACAGCACACGGCAGCAGGCAGG - Intronic
1083196844 11:61093317-61093339 GAGGGCAAGGGGCAGGGGGCAGG + Intergenic
1083640296 11:64141769-64141791 CTGGGCACAGGGTAGGAGGCAGG + Intronic
1083832858 11:65244002-65244024 GAGGGCATGGGGCAGCAGGCTGG - Intergenic
1084006108 11:66324521-66324543 CACATCAGGGGTCAGGAGGCTGG + Intergenic
1084025009 11:66442582-66442604 AAGATCAAGGGGCAGCAGGCGGG - Intronic
1084548244 11:69825234-69825256 CAGAGCCAGAGGCAGGAAGCTGG - Intergenic
1084728173 11:70955631-70955653 CATAGGACAGGGCAGCAGGCTGG + Intronic
1084751069 11:71204797-71204819 CTGGGAAGGGGGCAGGAGGCAGG + Intronic
1085270117 11:75265270-75265292 CAGAGATGGGGGCAGGGGGCGGG - Exonic
1085521680 11:77142837-77142859 CAAGGCATGGGGCAGGAGGAGGG - Intronic
1085600626 11:77853403-77853425 CAGAGCAGGAGGCAGGAGAGTGG + Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086398721 11:86443277-86443299 CCAAGCACGTGGAAGGAGGCTGG - Intronic
1087236738 11:95727706-95727728 GAAAGCAGGGGGCAGGAGGCAGG + Intergenic
1088645214 11:111912262-111912284 CAGGGCACGAGGCAGATGGCTGG - Exonic
1089279974 11:117367090-117367112 CAGAGCCCAGGGCAGGAGACTGG + Intronic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089624597 11:119743120-119743142 CAGGGCTGGGGGCAGGAGCCAGG - Intergenic
1089689860 11:120180584-120180606 CAGAGCTTGGGGCAGGAGCCTGG + Intronic
1089879596 11:121760932-121760954 CAGAGCATGGGGCAGGAACAAGG + Intergenic
1090238548 11:125166144-125166166 CAGAGCAGAGGGCTGGAGGTCGG + Intronic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090460312 11:126885720-126885742 CAGAGCAGAGGGCAGCAGGCTGG + Intronic
1090731509 11:129576702-129576724 AAGAGCACAGGGTAGGAGGAAGG - Intergenic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1091401206 12:181871-181893 TAGAGCAGGGGGCAGCAGGCGGG + Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091635998 12:2197096-2197118 CACAGCACCTGGAAGGAGGCAGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091769416 12:3141447-3141469 CAGGGCCCGGGGCAGGAGGAAGG - Intronic
1091769653 12:3142635-3142657 AAGAGCATGGCGCAGGGGGCAGG - Intronic
1091915532 12:4269985-4270007 GAGAGCACGGGGGAGCAGGGTGG - Intergenic
1091931503 12:4399326-4399348 GAGAGCATGGGGCAGGGGGAGGG + Intergenic
1092020794 12:5200726-5200748 CAGACCACGGGGTCGGGGGCGGG + Intergenic
1092147803 12:6226858-6226880 CAGAGCAGGAGGGAGGAGCCGGG + Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092250274 12:6891189-6891211 CAAAGCTCGCGGCAGGGGGCGGG + Intronic
1092409646 12:8243440-8243462 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1092731090 12:11535198-11535220 AAGAGCACAGGGCAGGGGCCGGG - Intergenic
1093090037 12:14910725-14910747 GAGGGGACTGGGCAGGAGGCTGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1095125731 12:38473932-38473954 CAGAGCATGGGCTAGCAGGCCGG - Intergenic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096389468 12:51217706-51217728 CACAGCCCGGGCCAGGGGGCCGG + Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096694287 12:53338939-53338961 CAGGGCACTGGGAAGGAGACTGG - Intronic
1097007778 12:55931521-55931543 TAGAGCCCGGGGCGGGAGGGAGG + Intronic
1098040998 12:66353968-66353990 CAGAGCACCAGGCAGGAGTGGGG - Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099845881 12:88027921-88027943 CATAGCACGGGTTAGTAGGCAGG + Intronic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1102255136 12:111410683-111410705 CAGGCCACGGGGCAGCTGGCTGG - Intronic
1102469832 12:113153409-113153431 GTGAGTCCGGGGCAGGAGGCTGG + Intronic
1102492332 12:113296814-113296836 CGGAGGAAGGGGCATGAGGCAGG + Exonic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103057768 12:117835183-117835205 CGGAGCTCAGGGCTGGAGGCAGG - Intronic
1103562792 12:121800859-121800881 GGGAGCCCGGAGCAGGAGGCGGG - Intronic
1103583911 12:121936919-121936941 AAGAGCAGGTGGCAGGAGGCAGG + Intronic
1103742725 12:123102173-123102195 CAGAGCAGGAGGGAGAAGGCTGG + Intronic
1103803840 12:123557242-123557264 CAGAGCATAGGCTAGGAGGCCGG - Intergenic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1104018308 12:124975145-124975167 CAGAGCAGGGGGCCAGATGCAGG - Intronic
1104232311 12:126897321-126897343 CAGAGCACGTGGCCTGAGACTGG + Intergenic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1104804413 12:131575896-131575918 CTGAGCCCAGGGCAGGTGGCAGG - Intergenic
1104861822 12:131928022-131928044 CAGTGCAAGAGCCAGGAGGCAGG - Intergenic
1104917709 12:132274416-132274438 CAGAGCAGCAGGCTGGAGGCCGG - Intronic
1105215958 13:18285533-18285555 ATGAACACGGGGCAGGGGGCAGG - Intergenic
1105260744 13:18777476-18777498 CAGAGCACAGAACTGGAGGCTGG - Intergenic
1105420427 13:20247450-20247472 CAGAGCGCAGGGCAGCAGCCAGG + Intergenic
1105600836 13:21885664-21885686 CTGAGCACCTGGCAGGTGGCAGG + Intergenic
1106182676 13:27381897-27381919 GGGGGCACGGGGCAGGAGCCCGG + Intergenic
1106193826 13:27476476-27476498 AGGAGCATGGGGCTGGAGGCAGG + Intergenic
1106244773 13:27939815-27939837 CTCAGCACGGGCCAGGAGGGAGG + Intergenic
1106888549 13:34217114-34217136 CAGGGAACAGGACAGGAGGCAGG - Intergenic
1113612657 13:111658411-111658433 CAGTGCGTGGTGCAGGAGGCAGG + Intronic
1113727919 13:112618780-112618802 AAGAGCAAGGGGCCTGAGGCCGG + Intergenic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1116446691 14:45019956-45019978 CAGAGCATGGGCTAGCAGGCTGG + Intronic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117721989 14:58637754-58637776 AAGAGAGCGGGGGAGGAGGCGGG + Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117898387 14:60509998-60510020 GAGCGCACCGGGGAGGAGGCGGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG + Intronic
1119223369 14:72926606-72926628 CAGAGCTCGGGGTGGGAGACAGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1120188323 14:81417276-81417298 CAGAGCTGGGGGCCGGGGGCGGG - Intronic
1120998475 14:90434692-90434714 CAGAGGAAGGGGCAGCAGGGCGG + Intergenic
1121096238 14:91219897-91219919 CAGAGCTCTGGGCAGGGGGTGGG + Intronic
1121168697 14:91835873-91835895 CCGAGCACGGAGCAGGGAGCCGG + Intronic
1122135878 14:99632691-99632713 TACAGCACAGCGCAGGAGGCAGG - Intergenic
1122270212 14:100565619-100565641 CAGTCCAGGGGCCAGGAGGCAGG + Intronic
1122275688 14:100589598-100589620 CAGAGCCTGGGGCATCAGGCAGG + Intergenic
1122276305 14:100592496-100592518 CAGAGCGTGGAGCCGGAGGCTGG + Intergenic
1122325787 14:100880075-100880097 CAGAGCTCAGGGCAAGAGGAAGG + Intergenic
1122366805 14:101199221-101199243 CTGGGCAGGGGGCAGGGGGCAGG + Intergenic
1122388473 14:101364692-101364714 CGGAGCCCAGGGCAGGAGCCAGG - Intergenic
1122429464 14:101630605-101630627 CAGGGGCCCGGGCAGGAGGCAGG - Intergenic
1122611190 14:102984611-102984633 CAGAGCAAGCGGGAGGAGCCTGG + Intronic
1122630110 14:103103910-103103932 CAGGGCAGGGGGCTGGGGGCGGG - Intronic
1122823710 14:104359639-104359661 CAGGGCTGGGGGCCGGAGGCAGG - Intergenic
1122870471 14:104635909-104635931 TAGAGCACGGGTGAGGATGCGGG - Intergenic
1122889019 14:104724163-104724185 CAGGGGGCGGGGCAGGGGGCGGG - Intergenic
1122948007 14:105022002-105022024 CCGAGGCAGGGGCAGGAGGCAGG + Intergenic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1122969821 14:105147979-105148001 CAGACCCGGGGGCAGGGGGCAGG + Intronic
1123020273 14:105394690-105394712 CACAGCATGGGGCAGGAGGTGGG - Exonic
1123054356 14:105562091-105562113 CAGGGCACGGGTCTGGGGGCTGG + Intergenic
1123078940 14:105682510-105682532 CAGGGCACGGGTCTGGGGGCTGG + Intergenic
1123109948 14:105862224-105862246 CACAGCAGGTGGCAGGAAGCAGG - Intergenic
1123154368 14:106210147-106210169 CAGAGCGGGTGGAAGGAGGCTGG - Intergenic
1123645297 15:22433505-22433527 CAGGGGACGGGGCAGGTGGTTGG + Intergenic
1123733014 15:23161839-23161861 CAGGGGACGGGGCAGGTGGTTGG - Intergenic
1123751143 15:23359216-23359238 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124036138 15:26054918-26054940 CAGGGCAGAGGGCAGCAGGCAGG + Intergenic
1124082388 15:26513521-26513543 CAGAGCACAGCCCATGAGGCAGG + Intergenic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124154939 15:27217574-27217596 CACAGCACGGAGCAGGATCCTGG - Intronic
1124283518 15:28383134-28383156 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124299180 15:28528479-28528501 CAGGGGACGGGGCAGGTGGTTGG + Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1125766455 15:42139791-42139813 GGGGGCAGGGGGCAGGAGGCTGG - Exonic
1125766457 15:42139798-42139820 AAGGGCAGGGGGCAGGGGGCAGG - Exonic
1126142813 15:45451488-45451510 CTGAGCCAGGGCCAGGAGGCAGG + Intergenic
1127207183 15:56733305-56733327 CAGAGCGCGGGGGAGGAGACCGG - Intronic
1128354920 15:66919358-66919380 CTGAGCAGGGGCAAGGAGGCAGG + Intergenic
1128374467 15:67065517-67065539 CGGGGCGCGGGGGAGGAGGCGGG + Intronic
1129411797 15:75354508-75354530 CAGAGTGCAGGGGAGGAGGCGGG - Intronic
1129464440 15:75716033-75716055 CAGAGCACAGGGTGGGAGGGAGG + Intergenic
1129606634 15:77028293-77028315 AAGAGCACAGCCCAGGAGGCGGG + Intronic
1129612345 15:77070854-77070876 CAGAGCGAGGGGCCGGCGGCGGG - Intronic
1129720806 15:77876979-77877001 CAGAGCACAGGGTGGGAGGGAGG - Intergenic
1129741525 15:77991948-77991970 GAGGGCACGAGGCAGCAGGCAGG - Intronic
1129822957 15:78617129-78617151 CAGATCTCGGGGAAGGAAGCAGG + Exonic
1129844134 15:78760456-78760478 GAGGGCACGAGGCAGCAGGCAGG + Intronic
1130104200 15:80917278-80917300 AAGAGCTATGGGCAGGAGGCAGG + Intronic
1130257672 15:82333344-82333366 GAGGGCACGAGGCAGCAGGCAGG - Intergenic
1130332427 15:82932831-82932853 GTGTGCACAGGGCAGGAGGCAGG - Intronic
1130553266 15:84905424-84905446 CAGAGGATGGGGCTGGAGCCAGG - Intronic
1130899782 15:88198668-88198690 CTGAGCATGGGGCACGAGGAGGG - Intronic
1130961218 15:88659734-88659756 CAGAACACTGGACAGGAAGCTGG - Intergenic
1131251945 15:90836783-90836805 CAGTGGACGGGGCAGGAGTCAGG - Intergenic
1131266238 15:90917011-90917033 CAGGGCACAGGATAGGAGGCAGG + Intronic
1131694076 15:94856409-94856431 CAGGGCGAGGGGCCGGAGGCTGG + Intergenic
1132311764 15:100862452-100862474 CTGCACACTGGGCAGGAGGCAGG + Intergenic
1132372023 15:101306063-101306085 CGGAGGACGGGCCTGGAGGCAGG + Intronic
1132552336 16:558778-558800 GAGAGCGGGGGCCAGGAGGCCGG - Intergenic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133026103 16:2989589-2989611 CAGGGCACGGGGCAGGGGGGAGG + Intergenic
1133128489 16:3662217-3662239 CAGACCACGAGGTAGCAGGCGGG + Exonic
1133214636 16:4284229-4284251 CAAAGCAGGAGGCAGGAGGATGG + Intergenic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1133333592 16:4991789-4991811 ATGAGCACGGGGCAGGATGGAGG - Intronic
1133781132 16:8940369-8940391 CTGAGCACTGTGCTGGAGGCTGG - Intronic
1134008808 16:10836021-10836043 CAGAGTAATGGGCAAGAGGCTGG - Intergenic
1134092488 16:11399063-11399085 CAGAGCTTGGGGCAGGAACCAGG - Intronic
1134279320 16:12803722-12803744 CAGAGCCAGGGGCAGGACCCTGG - Exonic
1134849504 16:17469442-17469464 GAGCACATGGGGCAGGAGGCCGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136060556 16:27723475-27723497 AAGCGCAAGGGGCAGGGGGCAGG - Intronic
1136173005 16:28499521-28499543 TAGAGCCTGGGGCAGGGGGCTGG + Exonic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1137231821 16:46573756-46573778 CACACCCCGGGGCGGGAGGCCGG + Intergenic
1137628327 16:49923517-49923539 CAGAGCACCGGGCAAGTGCCAGG + Intergenic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1138475060 16:57265729-57265751 TAAAGGACAGGGCAGGAGGCCGG + Intronic
1138650163 16:58455719-58455741 CAGAGCCTGGGGCAAGGGGCAGG + Intergenic
1139470059 16:67173611-67173633 CAAAGCAGGAGGCAGAAGGCTGG + Intronic
1139489455 16:67278849-67278871 CAAAGTCCGGTGCAGGAGGCTGG - Exonic
1139973216 16:70789343-70789365 CAGAGCAGGAGGGAGAAGGCAGG - Intronic
1141034849 16:80618144-80618166 CAGAGCACAGGGCAAGATGGCGG - Intronic
1141125098 16:81395505-81395527 CAGAGGACGGGAGAGGAGGGAGG - Intergenic
1141561902 16:84874582-84874604 CAGAGCTCCGGGGAGGAAGCTGG - Intronic
1141623206 16:85248039-85248061 CAGAGCTGGGGGCACCAGGCAGG - Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142104346 16:88294292-88294314 AAGTGCACAGGGCAGGAGGTAGG - Intergenic
1142135732 16:88451247-88451269 CAGCGAAGGGGGCAGGCGGCAGG - Intergenic
1142240373 16:88941916-88941938 GCGAGCGCGGGGCAGGGGGCGGG - Intronic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1142425871 16:90001971-90001993 CAGTGCCCGGGGCAGCAAGCAGG - Intergenic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142866989 17:2797249-2797271 CAGAGGGCCAGGCAGGAGGCTGG - Intronic
1142978913 17:3660390-3660412 CAGGGCACGAGGCCAGAGGCTGG - Intronic
1143282504 17:5765354-5765376 CAGAGCAGGGGGTTGGAGTCAGG + Intergenic
1143366555 17:6412535-6412557 CAGAGCAGGGTGCAGGAAGGAGG + Intronic
1143519713 17:7438344-7438366 CAGAGCACTGGGCCGGTGGCTGG - Intronic
1143923564 17:10349994-10350016 TAGAGCACAGGGCAGCAGGAAGG - Intronic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1146926689 17:36750499-36750521 CTGAGGACGGGGCATGAGGCAGG - Intergenic
1146997830 17:37336189-37336211 CAGAGCATGGGCTAGCAGGCCGG - Intronic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147760688 17:42795769-42795791 CAGAGGACAGTGCTGGAGGCGGG + Exonic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148806666 17:50267289-50267311 CAGAGCCTGGGGGAGGAAGCTGG - Intergenic
1149273670 17:55011985-55012007 CAGAGCATGGGCTAGCAGGCCGG + Intronic
1149350428 17:55781262-55781284 CAAAGCATGGGGCAGGAGAACGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149923222 17:60678046-60678068 CAGTGCAAGGGGCCGGAGGGCGG + Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150583638 17:66498137-66498159 CGGGGCAGGGGGCAGGAGGCGGG - Intronic
1151287051 17:73119701-73119723 TAGAGAACGGGCAAGGAGGCAGG + Intergenic
1151383257 17:73739963-73739985 CAGAGCCAGGGTCAGGAGGGTGG - Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151558908 17:74860600-74860622 CAGAGACCGGCGCAGGCGGCTGG + Intronic
1151713514 17:75819836-75819858 CAGAGCAAGGGGCCTGAGCCAGG - Intronic
1151785206 17:76271988-76272010 CAGAGGGCGAGGCAGGAGGACGG - Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152100558 17:78299412-78299434 AAGAGCACGGACCAGGAGGTAGG - Intergenic
1152106889 17:78335437-78335459 CAGAGAAGAGGGCAGGAGGGAGG - Intergenic
1152110800 17:78356723-78356745 CAAGGCACGGGGCGGGGGGCGGG + Intergenic
1152390650 17:80001889-80001911 CAGAGCCTGGAGCAGGAGACGGG - Intronic
1152535428 17:80948093-80948115 GAGAGCGCTGGGCGGGAGGCAGG + Intronic
1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG + Intronic
1152635576 17:81429323-81429345 CAGAGCAGGGGACAGCAAGCTGG - Intronic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1153001091 18:456056-456078 CAAAGCACGTGGTGGGAGGCTGG + Intronic
1153997232 18:10453881-10453903 AAGGGCACGGTGTAGGAGGCAGG - Intergenic
1154193270 18:12247656-12247678 CTGAGGACGGGGCAGGAGAGGGG + Intergenic
1154339834 18:13493827-13493849 AGGACCACGGGGCTGGAGGCAGG - Intronic
1155525966 18:26716638-26716660 AAGAGCCCTGGGCAGGAGGCAGG + Intergenic
1157600772 18:48891937-48891959 GGGAGGAGGGGGCAGGAGGCCGG + Intergenic
1157773924 18:50375284-50375306 GGGAGGACGGGGCTGGAGGCTGG + Intronic
1159956370 18:74521200-74521222 CAGGGCAGGGGACAGCAGGCAGG + Exonic
1160391742 18:78539271-78539293 CAGGGCACGGGGGAGAGGGCAGG - Intergenic
1160392266 18:78543130-78543152 CAGAGCAGGAGGCTGGAGGCAGG + Intergenic
1160658886 19:289147-289169 CGGAGAACGGGGCAGAGGGCAGG + Intronic
1160753920 19:748001-748023 CTGAGCACTGGGCACCAGGCTGG - Exonic
1160796622 19:948579-948601 CAGAGCCTGGGGCTGCAGGCGGG - Intronic
1160817319 19:1042167-1042189 CGCAGCACGGGTGAGGAGGCCGG + Exonic
1160849506 19:1183613-1183635 CAGAGCAAAGGGCCGGGGGCAGG + Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1160939049 19:1611658-1611680 CAGAGCACAGGGCTGAAAGCGGG + Exonic
1160941416 19:1622023-1622045 CAGGGCAGGGGGCAGGGGGTGGG - Intronic
1161001922 19:1914873-1914895 CAGAGCACAGGGCACGATGAAGG + Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161111692 19:2474641-2474663 CGGGGCACTGGGCTGGAGGCGGG - Intergenic
1161568308 19:5015837-5015859 CAGAGCACGGGGAGAGAGGGGGG - Intronic
1161803675 19:6430094-6430116 CAGAGCATGGTCCAGGAGGGCGG - Exonic
1161979662 19:7623973-7623995 CAGAGCACTTGGCTGGGGGCTGG - Intronic
1162019777 19:7863107-7863129 CAGGGCCCGGGGCAGGAGCGGGG + Intronic
1162410037 19:10500091-10500113 GAGAGCACAGGGCAGAGGGCAGG + Intronic
1162565141 19:11441806-11441828 CTGTGTACTGGGCAGGAGGCTGG + Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1162757908 19:12871255-12871277 AAGAGCACGGGAAAGGTGGCGGG + Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163015490 19:14451678-14451700 TGGAGCATGGGGCATGAGGCCGG - Intronic
1163175950 19:15564155-15564177 CAGGACACGGGCCAGGAGCCAGG - Intergenic
1163479776 19:17548248-17548270 AAGGGCACGGAGCGGGAGGCTGG + Intronic
1163623520 19:18374640-18374662 CTGAGCACGGGGGTGGGGGCGGG + Intergenic
1164914300 19:32038068-32038090 GACAGAACGGGGCAGGAGGGGGG + Intergenic
1165075735 19:33278987-33279009 CCCAGCCCAGGGCAGGAGGCAGG + Intergenic
1165104270 19:33459817-33459839 CAGGACTCGGGGCAGGAGTCAGG - Intronic
1165737133 19:38183840-38183862 CGGAGCTCGGGCGAGGAGGCTGG + Intronic
1165827282 19:38712618-38712640 GAGGGCACGGGCCAGGAGGGTGG + Intronic
1165831371 19:38732191-38732213 CACAGCAGGTGGCAGGTGGCAGG - Intronic
1165866939 19:38945324-38945346 CAGAGCCTGGGGGAGGAGCCTGG + Intronic
1165866955 19:38945365-38945387 CAGAGCCTGGGGGAGGAGCCTGG + Intronic
1165867113 19:38945765-38945787 CAGAGCCTGGGGGAGGAGTCTGG + Intronic
1166530860 19:43542779-43542801 CATAGCATGGGCCAGGAGGTGGG - Intergenic
1166852880 19:45768801-45768823 CCGAGCGCGGGGCCGGCGGCTGG - Exonic
1166948271 19:46410464-46410486 CAGAGCCCGGGGCATGAGGATGG + Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167158773 19:47754775-47754797 CAGGGCGAGGGGCCGGAGGCTGG + Exonic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167607532 19:50489456-50489478 CAGAGACCGGGGCAGGAAGCAGG + Exonic
1167752536 19:51389329-51389351 CAGGGCGCTGTGCAGGAGGCAGG + Exonic
1168137303 19:54360204-54360226 CGGGGCAGGGGACAGGAGGCTGG + Intronic
1168160774 19:54508881-54508903 CGGGGCAGGGGACAGGAGGCTGG - Intronic
1168257103 19:55173191-55173213 CAAAGCAGGGGGCAGGACCCGGG + Exonic
1168294098 19:55370335-55370357 CAGGGCAGGGGGCAGGGAGCCGG + Exonic
1168599655 19:57707681-57707703 AAGAGCAGGGGGAAGGAGTCAGG - Intronic
924981712 2:228720-228742 CAGACGCAGGGGCAGGAGGCAGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925160188 2:1678064-1678086 CACAGCCCGGGTCAGGAGGCTGG + Intronic
925406695 2:3610375-3610397 CAGAGCACCAGGAAGAAGGCGGG - Intronic
925991600 2:9259400-9259422 GAGAGCAGGGCGCAGGAAGCGGG - Intronic
926120165 2:10237473-10237495 CAGAGCCCAGGGCAGGTGCCAGG - Intergenic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926681232 2:15665481-15665503 CAGAGCACGACGCAGGAGTTGGG + Intergenic
927518370 2:23685178-23685200 CAGGGCAGAGGGCAGGAGGGAGG - Intronic
927519496 2:23690380-23690402 AAGAGCAGGGGGCAGGGAGCTGG - Intronic
927809310 2:26172978-26173000 CAGAGCAGGGGGCGGGGGTCCGG + Intergenic
927850203 2:26494094-26494116 CAGAGCCCTGGGCTGGAAGCTGG + Intronic
928348099 2:30519335-30519357 CAGAGCATGGGCTAGCAGGCCGG - Intronic
928452034 2:31386029-31386051 CAGAGCACCGAGCATGAGCCAGG - Intronic
929239590 2:39640075-39640097 TGGAGCAGGGGGCAGGTGGCAGG + Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
930897392 2:56462180-56462202 CATGGCACTGGGCAGGTGGCAGG + Intergenic
930957185 2:57217159-57217181 CAGAGCAGGTGCCAGGAGGAGGG - Intergenic
931240798 2:60450637-60450659 CAGAGCATGGGGCAGGGAGAGGG + Intergenic
932494324 2:72138973-72138995 CAGGGCACGGGGTGAGAGGCAGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933763981 2:85694887-85694909 GAGAGCAGGGTGCAGGGGGCAGG - Intronic
933797990 2:85936651-85936673 CAGAGCACGCGGGAAGGGGCAGG + Intergenic
934121477 2:88844479-88844501 CATGGCACTGAGCAGGAGGCAGG + Intergenic
934298370 2:91761193-91761215 ATGAACACGGGGCAGGGGGCAGG + Intergenic
934538958 2:95159228-95159250 CCGAGCCGGGGGTAGGAGGCCGG - Exonic
934553755 2:95276946-95276968 CAGAGCACAGGGCAGTCTGCAGG - Intronic
934561890 2:95317802-95317824 CAGAGCTGAGGGCAGGAGTCGGG + Intronic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935720345 2:105973871-105973893 CAGGGCACGGGGCTGCAAGCAGG + Intergenic
935749157 2:106215173-106215195 CAGAGCATGGGCTAGCAGGCAGG - Intergenic
935804849 2:106735213-106735235 CCAAGCAGGGGGCAGGAGGGTGG - Intergenic
935878783 2:107540192-107540214 CAGAACACTGGGCGGGAGGTTGG - Intergenic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936516741 2:113185832-113185854 GCGGGCACAGGGCAGGAGGCAGG - Intronic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937989867 2:127656328-127656350 CAGAGGCTGGGCCAGGAGGCTGG - Intronic
938236085 2:129708363-129708385 CAGAGCACCAGGCAGGGGCCAGG + Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939750910 2:146045024-146045046 CGGATCACAGGTCAGGAGGCGGG - Intergenic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
941003168 2:160222047-160222069 CAGAGCCAGGGGGAGTAGGCAGG - Intronic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
941370523 2:164658391-164658413 CAGAGCATGGGCTAGCAGGCCGG + Intronic
941991348 2:171560505-171560527 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942729135 2:179044462-179044484 TTGAGCACAGGGTAGGAGGCAGG + Intronic
944361764 2:198865406-198865428 CAGAACACTGGCCTGGAGGCTGG - Intergenic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
946396848 2:219447695-219447717 CAGGGCTGGGGGGAGGAGGCTGG + Intronic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947623277 2:231604387-231604409 CAGAGCACGGGGCAGTCAGATGG + Intergenic
947713562 2:232329151-232329173 CAGAGGACAGGGCAGGAGTGGGG - Intronic
947731734 2:232435068-232435090 CAGGGCCCAGGGCAGGAGGAAGG - Intergenic
947758765 2:232588204-232588226 GAGAGCATGGGGTGGGAGGCTGG - Intergenic
947910579 2:233798460-233798482 CAGAGCACTGGGCATGAAGTGGG - Intronic
948127584 2:235576141-235576163 GAGGGCACCAGGCAGGAGGCTGG + Intronic
948229954 2:236342284-236342306 CAGAGGCCGGGGCAGGTGGGAGG + Intronic
948232105 2:236356236-236356258 CAGGGCGCAGGGAAGGAGGCTGG - Intronic
948232339 2:236359084-236359106 CAGGGCGCAGGGAAGGAGGCTGG + Intronic
948449603 2:238060977-238060999 CAGAGCGCCGGGGAGGAGGCGGG - Exonic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948598874 2:239096933-239096955 CAGGGAGCAGGGCAGGAGGCAGG + Intronic
948598876 2:239096940-239096962 CAGGGCAGGAGGCAGGAGGCAGG + Intronic
948608096 2:239148749-239148771 CGGAGCCCGGGAGAGGAGGCGGG + Intronic
948718483 2:239881397-239881419 CAGGGCAGTGGGCAGGAGGGAGG - Intergenic
948794594 2:240395740-240395762 CTGAGCACTGGGCAGGCTGCGGG + Intergenic
948871413 2:240800515-240800537 CTGCGCACGGGGCAAGAGACTGG + Intronic
948945017 2:241215047-241215069 CAGAGCCCGGGGCAGACGGCCGG - Intronic
948946655 2:241223972-241223994 GAGTGCACGGGGCAGGGGCCTGG - Intronic
1168838612 20:894461-894483 CAGAGCATGGGCTAGCAGGCTGG + Intronic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1169365173 20:4986220-4986242 CAGAGGCGGGGGCAGGAGGATGG + Intronic
1169486493 20:6038568-6038590 CAGAGAAGGGGGCATGTGGCTGG + Exonic
1170494936 20:16915253-16915275 CAGAGCAGGTGCCAGGAGCCAGG - Intergenic
1172108137 20:32528689-32528711 GAAACCACAGGGCAGGAGGCTGG + Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172204961 20:33156805-33156827 CTGGGCACCAGGCAGGAGGCAGG + Intergenic
1172222213 20:33281752-33281774 CCCAGCACGTGGCAGGAAGCAGG + Intronic
1172258833 20:33543705-33543727 CAGAGCAGTGGTCAGGAGACTGG - Intronic
1172654378 20:36528025-36528047 CGGGGCACCTGGCAGGAGGCGGG + Exonic
1172794455 20:37527480-37527502 CAGAGCCGGGGGCACGGGGCTGG - Intronic
1172846095 20:37930741-37930763 CTCTGCATGGGGCAGGAGGCAGG + Intronic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1172975188 20:38900781-38900803 CTGAGCACAGCGCACGAGGCAGG - Intronic
1173210751 20:41029497-41029519 CAGGGCGCGGGGGAGGCGGCCGG - Intronic
1173516224 20:43667221-43667243 CAGAGCCCGGAGCGGGAGCCGGG - Exonic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173647553 20:44642873-44642895 CAGGGAGCTGGGCAGGAGGCAGG + Intronic
1173791940 20:45833768-45833790 GAGCGGGCGGGGCAGGAGGCGGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174265011 20:49325057-49325079 CAGAGCACTGGGCTGGGTGCTGG - Intergenic
1174452671 20:50629540-50629562 CACAGGACGGGGCAGCAGGCAGG + Intronic
1174567390 20:51475394-51475416 GCGAGCAGGGGGCAGGTGGCAGG - Intronic
1174977655 20:55352559-55352581 CAGAGCATGGGCTAGCAGGCTGG - Intergenic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175676804 20:60953151-60953173 CAGAGCTCAGGACAGGTGGCAGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175773089 20:61635864-61635886 CAGAGCAGGGGGCAGGACACAGG + Intronic
1175802780 20:61810585-61810607 CAGGGCGGGAGGCAGGAGGCAGG - Intronic
1175818882 20:61897809-61897831 CAGATCACGGGGCAGGGGAACGG + Intronic
1175946232 20:62560129-62560151 CAGAGCAGGGGGCAGGCTGGGGG - Intronic
1175975986 20:62710763-62710785 CAAAGCCCCGAGCAGGAGGCTGG + Intronic
1176126017 20:63475131-63475153 CAGAGGAGGGGACAGGGGGCAGG - Intergenic
1176309211 21:5140930-5140952 GTGAGCACGAGGCAGCAGGCAGG - Intronic
1178843683 21:36157148-36157170 GAGAGCTCGGGGCCGGAGACCGG + Intronic
1179209532 21:39313494-39313516 CCGGGCGCGGGGCGGGAGGCGGG + Exonic
1179266440 21:39807607-39807629 CAGAGTGTGGGGCAGCAGGCTGG + Intergenic
1179588216 21:42387531-42387553 CAGACCTCAGGGCTGGAGGCTGG + Intronic
1179596694 21:42447406-42447428 GGGAGCACAGGGCAGGTGGCTGG + Exonic
1179627290 21:42655864-42655886 CACAGCAAGGGGCAGAGGGCGGG - Intronic
1179732132 21:43373864-43373886 CCGAGCAGGGGCCAGGTGGCCGG - Intergenic
1179847850 21:44121103-44121125 GTGAGCACGAGGCAGCAGGCAGG + Intronic
1179884323 21:44306985-44307007 CAGAGCACGGGCCTGGGGGCAGG + Intronic
1179988320 21:44932957-44932979 CAGAGGACGGGGCCGGGGCCGGG + Intronic
1180007860 21:45031566-45031588 CAGAGGACGGGGTCAGAGGCTGG + Intergenic
1180010930 21:45050707-45050729 CAGGGGACGGGGCGGGAGCCAGG + Intergenic
1180201905 21:46229242-46229264 CAAAGCGCGGCGCACGAGGCCGG - Intergenic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181392421 22:22593445-22593467 TGGAGCAGGGTGCAGGAGGCAGG + Intergenic
1181508942 22:23380292-23380314 CAAGGCTCGGGGCAGGAGACCGG + Intergenic
1181675100 22:24446123-24446145 CTGAGCCGGGGGCAGGACGCAGG + Intergenic
1181763892 22:25077443-25077465 AAGAGCATGGGACAGGAGGTGGG - Intronic
1181801788 22:25352477-25352499 CGGAGCACAGGCCAGGAGGCTGG - Intronic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182866184 22:33606577-33606599 GAGAGCACGGGGTAGGGGGCGGG - Intronic
1183064185 22:35352433-35352455 TAGGGCAGGGGGCAGGGGGCAGG - Intergenic
1183064627 22:35354457-35354479 CAGAGCACGGTGCAGGGTGCTGG - Intergenic
1183411694 22:37658745-37658767 GAGAGCGCGGCGCGGGAGGCCGG + Exonic
1183507842 22:38219244-38219266 CAGAGCAGGGGGCAGGGAGGAGG + Intergenic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1183671396 22:39274836-39274858 AAGAGAAGGGGGCAGGGGGCTGG + Intergenic
1184092350 22:42299324-42299346 CAGAGCAGGGGGCTGGATGTGGG - Intronic
1184273292 22:43396840-43396862 CAGGGCCTGGGGCAGGAAGCAGG + Intergenic
1184341351 22:43887785-43887807 CAGGGCTCAGGGCAGGAGCCTGG + Intronic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184735205 22:46393949-46393971 CAGAGCACGGGGGAGCAGCAAGG + Intronic
1184834481 22:47013047-47013069 TCGCGCACGGGGCGGGAGGCTGG - Intronic
1184866878 22:47206257-47206279 CAGGGCGGGAGGCAGGAGGCAGG + Intergenic
1185062956 22:48616569-48616591 CACAGCACGAGGCAGGAAGGTGG + Intronic
1185089772 22:48759315-48759337 CAGATCACGGGCCAGGTGGCAGG + Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185128391 22:49024337-49024359 CTGAGCACAGGGCAGAACGCAGG - Intergenic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
1185320814 22:50199643-50199665 TGGAGCACGGGGGAAGAGGCAGG - Intergenic
1185417451 22:50718041-50718063 CAGGGCATGGGGCAGGGGCCTGG - Intergenic
950536864 3:13583841-13583863 TAGAGGACGGGGCTGGAAGCAGG - Intronic
950543550 3:13626079-13626101 CAGAGCAGGACGCAGGAGACAGG - Intronic
950642729 3:14358965-14358987 GAGAGCACTGGGCAGGAGCTTGG + Intergenic
950967206 3:17154650-17154672 CAGAGCTGAGGGCAGGAGGTAGG + Intergenic
953451262 3:43008375-43008397 CAGAGGACTAGGAAGGAGGCAGG - Intronic
953850485 3:46462792-46462814 CAGAGAAGGGGGCAGGGAGCTGG + Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954712522 3:52512226-52512248 CAGAGCAAGGGGCAGGGGCTGGG + Intronic
954757514 3:52849559-52849581 CAGGGAAGGTGGCAGGAGGCAGG - Intronic
956860220 3:73315871-73315893 CAGAGCAGGGGGCTGGAGGGAGG - Intergenic
956999854 3:74873302-74873324 CAGAGCATGGGCTAGCAGGCTGG + Intergenic
957054885 3:75435568-75435590 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
960663213 3:120083407-120083429 AAAAGAAAGGGGCAGGAGGCAGG + Intronic
960946357 3:122969459-122969481 CACAGCACGGGATAGGACGCAGG - Intronic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961031261 3:123605997-123606019 CAGAGCAGGGGCCAAGAGTCAGG - Intergenic
961299947 3:125916106-125916128 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
961356578 3:126343491-126343513 AGGCGCACGGGGCTGGAGGCAGG - Exonic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961888556 3:130111967-130111989 CAGAGAAGGGCTCAGGAGGCGGG + Intronic
962350299 3:134651278-134651300 AAGTGCACCGGGCGGGAGGCAGG - Intronic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962495889 3:135938415-135938437 CAGAGCAAGGGCTAGCAGGCTGG - Intergenic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
964273014 3:154978816-154978838 CAGAGCACAGGCTAGCAGGCTGG - Intergenic
964335150 3:155646774-155646796 GTGAGCTTGGGGCAGGAGGCAGG - Intronic
966891184 3:184408817-184408839 CAGAGTAGGAGACAGGAGGCAGG - Intronic
966933563 3:184691309-184691331 CTGAGCATAGGGCAGGCGGCAGG - Intergenic
967108696 3:186273881-186273903 CACATCACGGGGCGGGCGGCAGG + Intronic
967721458 3:192820635-192820657 GAGAGCCCGGGGCGGGACGCCGG - Intronic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968286985 3:197514521-197514543 GAGAGCACTGGGCGAGAGGCTGG - Intronic
968506461 4:973394-973416 CCCAGCACGGGGCTGCAGGCCGG + Exonic
968521181 4:1035484-1035506 CCGACCACGGGCCAGGAGCCCGG - Intergenic
968523248 4:1043954-1043976 CAGAGCAGGGGGCAGGGACCTGG + Intergenic
968651658 4:1762547-1762569 CAGGGCAGAGGGCAGAAGGCAGG + Intergenic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969347860 4:6580495-6580517 GCTGGCACGGGGCAGGAGGCAGG - Intronic
969444207 4:7234891-7234913 CAGTGCTGGGGCCAGGAGGCCGG + Intronic
969705267 4:8788306-8788328 TCCAGCACCGGGCAGGAGGCAGG + Intergenic
969816632 4:9691976-9691998 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
970120226 4:12745594-12745616 TGGAGCAGGGGGTAGGAGGCAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
974137995 4:57843972-57843994 CAAAGCACGTGGAAAGAGGCAGG - Intergenic
976246698 4:83012494-83012516 CAGACCGCCGGGCAGGCGGCTGG + Intronic
976845397 4:89483426-89483448 CACAGCAGGAGGCAAGAGGCAGG + Intergenic
977313750 4:95418907-95418929 CTGAAGTCGGGGCAGGAGGCAGG - Intronic
978896902 4:113899732-113899754 TAGAGCCCTGGGCAGGTGGCAGG + Intergenic
980444656 4:132888646-132888668 CAGAGCATGGGCCAGCAGGATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981045030 4:140256907-140256929 CAGAGCAGGTGGCTAGAGGCAGG + Intergenic
981686212 4:147457794-147457816 CAGTGCACTGGGTAGCAGGCAGG - Intergenic
982075483 4:151732415-151732437 CAGAGCACAGGGTTGGGGGCAGG - Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
984999438 4:185469953-185469975 CAGAGCACGGGGCAGGAGAAGGG - Intronic
985534340 5:455178-455200 CAGCCCATGAGGCAGGAGGCAGG + Intronic
985558810 5:571116-571138 CCCAGCCTGGGGCAGGAGGCCGG + Intergenic
985628318 5:1001632-1001654 CCATGGACGGGGCAGGAGGCAGG + Intergenic
985728150 5:1526376-1526398 CAGAGCAGGGGGCAGGACTGGGG + Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985899663 5:2778794-2778816 CAGAGAACGGTGCAGCAGGGAGG + Intergenic
986205984 5:5625688-5625710 CAGAGTACCTGGCAGGAGCCCGG + Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987089293 5:14497126-14497148 CAGGGCACGGGGCTGGTGGGTGG - Intronic
988956872 5:36329166-36329188 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
990617243 5:57520490-57520512 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
992217282 5:74538422-74538444 TAGAGCAAGGGTCAGGAGACAGG + Intergenic
993460672 5:88177230-88177252 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
994710364 5:103258605-103258627 GAGAGCTGGGCGCAGGAGGCGGG + Intergenic
996882595 5:128317069-128317091 CAGTGCAAGGGGCATGTGGCAGG - Intronic
996993608 5:129667596-129667618 GGGAGCAAGGGGCAGGAGGGTGG - Intronic
998098917 5:139415670-139415692 CCGAGCCCTGGGCAGGATGCAGG - Intronic
999812163 5:155138010-155138032 CACAGCAAGGGAGAGGAGGCTGG + Intergenic
999956595 5:156709848-156709870 CAGAGTAGGGGGCGGGAGGGTGG - Intronic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1001956931 5:175854101-175854123 CAGGGCACCGGGCATGAAGCTGG - Intronic
1002066376 5:176654105-176654127 CTGAGCAGGTGCCAGGAGGCAGG + Intronic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1002579515 5:180199124-180199146 CAGAGGACGGGAGAGGTGGCAGG + Intronic
1002664337 5:180811207-180811229 CAGAACACAGGCCAGGAGACCGG - Intronic
1002764631 6:228295-228317 CAGAGCACGAGGAGGGAGGGAGG + Intergenic
1002795094 6:465631-465653 AAGAGGATGGGGCAGGTGGCGGG - Intergenic
1002873680 6:1190870-1190892 CAAAGCTTTGGGCAGGAGGCAGG + Intergenic
1003014206 6:2454913-2454935 CTGAGCAGGGGGCAGAAGGTGGG - Intergenic
1003117984 6:3295907-3295929 CAGAGTCCCAGGCAGGAGGCTGG - Intronic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005293683 6:24403069-24403091 CATCGCGCGGGGCAGGAGGCAGG - Exonic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1006068027 6:31476609-31476631 CAGTGCAGGGGGCAGGATGGAGG - Intergenic
1006388646 6:33746263-33746285 CACGGGAGGGGGCAGGAGGCCGG - Intronic
1006516212 6:34547034-34547056 ATGTGGACGGGGCAGGAGGCAGG - Intronic
1006750214 6:36372315-36372337 AGGAGCACGGGGGAGAAGGCTGG + Intronic
1007577979 6:42938426-42938448 CACAGCGAGAGGCAGGAGGCAGG + Intronic
1007742753 6:44022829-44022851 GAGAGGATGGGGCTGGAGGCGGG - Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1008813711 6:55537585-55537607 CTGAGCACTGGTCAGGAGTCAGG + Intronic
1009925811 6:70119381-70119403 CAGTGCTTGGTGCAGGAGGCGGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1012935644 6:105364591-105364613 CAGGACACAGGGCAGGATGCGGG - Intronic
1013558363 6:111280317-111280339 CAGAGCAGAGGGCAGCAGGTTGG - Intergenic
1015145041 6:129976241-129976263 CAGACCAGCAGGCAGGAGGCAGG - Intergenic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1016051776 6:139537472-139537494 CACAGCCCAGGGCAGGAGACAGG - Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017409853 6:154156527-154156549 CAGAGCATGGGGCAGCGGGAGGG + Intronic
1017720039 6:157237416-157237438 GAGAGCAGGGGCCAGGTGGCAGG - Intergenic
1017768218 6:157624271-157624293 CAGAGCTGGAGGCAGGAGGGTGG + Intronic
1017891117 6:158640115-158640137 CACAGCAGGGGGCAGGAAGGTGG - Intronic
1018420913 6:163640668-163640690 CAGAGGCTGGGGCAGCAGGCAGG - Intergenic
1018718870 6:166557031-166557053 CAGACCACGGGGCATTAGCCGGG + Intronic
1018761486 6:166897763-166897785 CAGAGCATGGGCTAGCAGGCCGG - Intronic
1018765895 6:166932440-166932462 CAGAGCTGGGGGCTGGGGGCTGG - Intronic
1018890066 6:167976858-167976880 AAGACCCAGGGGCAGGAGGCCGG - Intergenic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1018945971 6:168346708-168346730 CTGAGCAGGGTGCAGAAGGCCGG - Intergenic
1018983434 6:168617459-168617481 CTGAAGACGGGGCAGGAAGCTGG + Intronic
1019139734 6:169935870-169935892 GAGAGCACGGGGCAGTAAGAGGG - Intergenic
1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG + Intergenic
1019594274 7:1851190-1851212 CAGAGCGGGCGGCAGGAGCCCGG + Intronic
1019722673 7:2582676-2582698 CAGAACACGGGGCGGAAGGCAGG - Intronic
1019748869 7:2716422-2716444 CAGAGCATGGGTGAGGAGGGAGG + Exonic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1021907371 7:25348684-25348706 CAGAGTTGGGGGCAGGAGACTGG + Intergenic
1022415278 7:30171951-30171973 CAGAGCAGTGAGCAGGAGCCTGG - Intergenic
1022465321 7:30649430-30649452 CAGGGCAGGGGGCTGGGGGCAGG + Intergenic
1022524504 7:31028551-31028573 CAGGGCTCGGCGCGGGAGGCAGG + Intergenic
1022646366 7:32232480-32232502 CAGGCCACTGGGCAGGAGGACGG - Intronic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023638655 7:42237431-42237453 CCCAGCACGGGGCACCAGGCCGG - Intronic
1023905019 7:44515993-44516015 CAGGGCACAGGGCATCAGGCAGG + Intronic
1023905024 7:44516012-44516034 CAGGGCACAGGGCATCAGGCAGG + Intronic
1023912909 7:44568080-44568102 CAGGGCAGGAGGCAGCAGGCTGG - Intronic
1024037810 7:45523673-45523695 CAGAGCAAGAGGCAGGATGGTGG + Intergenic
1024307733 7:47942424-47942446 GGGGGCGCGGGGCAGGAGGCGGG - Intronic
1025028436 7:55536666-55536688 CAGAGCACATGGCACGTGGCAGG + Intronic
1025871768 7:65440960-65440982 CAGTGCAGGGGGCAGGTGTCTGG - Intergenic
1025974612 7:66359752-66359774 CAGATCAGGGGCCAGGAGGATGG - Intronic
1027266626 7:76498351-76498373 CAGAGCCCTGGGCTGGGGGCAGG - Intronic
1027318007 7:76996469-76996491 CAGAGCCCTGGGCTGGGGGCAGG - Intergenic
1027555935 7:79664882-79664904 CAGAGCACAGGGCTGGAGTATGG - Intergenic
1029206018 7:98869793-98869815 CGGGGCCCAGGGCAGGAGGCAGG + Exonic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029459962 7:100688725-100688747 GAGAGCAGGGGGGAGGAGGGAGG + Exonic
1029477223 7:100792219-100792241 CAGAGCTTGGGTCAGGAAGCGGG - Intronic
1029530543 7:101122393-101122415 CAGAGATCGGGCCAGAAGGCGGG + Intergenic
1029639709 7:101813169-101813191 CAGAGCACGGTGTGAGAGGCAGG - Intergenic
1029707587 7:102283956-102283978 CAGAGCACAGGGCACCAGGGTGG - Intronic
1029926938 7:104328533-104328555 CGGAGCCCGGGCCAGGAGGGAGG + Intergenic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1030273687 7:107696857-107696879 CAGAGCAGGGGCCAGAAGTCTGG - Intronic
1030677403 7:112398547-112398569 CAGAGCAGGGTGGAGGAGGGTGG - Intergenic
1031264993 7:119570346-119570368 CAGAGCACGGGCTAGCAGGCTGG - Intergenic
1031924832 7:127629440-127629462 CAGAGCACTGGGTAGGCTGCAGG - Intergenic
1032079089 7:128849767-128849789 GACAGCACTGGGCAGGGGGCAGG - Intronic
1032089836 7:128905914-128905936 CAGAGGAGGGCACAGGAGGCAGG - Intronic
1032092409 7:128917617-128917639 CAGAGGAGGGCACAGGAGGCAGG + Intergenic
1032388039 7:131538150-131538172 CAGAGCACAGGGGAGGGGCCAGG - Intronic
1032517162 7:132515212-132515234 GAGAGCAGGGGACAGGAGCCTGG + Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1034260565 7:149752817-149752839 GGGAGGCCGGGGCAGGAGGCAGG + Intergenic
1034278112 7:149832934-149832956 GAGGGGACGGGGCAGGAGCCTGG + Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034427439 7:151021456-151021478 TAGAGCCCGGGGCAGGGGGTGGG + Intronic
1034439050 7:151077287-151077309 GTGAGCAAGGGGCAGGCGGCAGG - Intronic
1034552462 7:151830306-151830328 CACAGCACAGTGCAGGTGGCGGG - Intronic
1035463156 7:159058645-159058667 CAGAGCACAGGGCTGGATCCTGG - Intronic
1035911584 8:3572281-3572303 CAGAGCCTGGGGCAGAAAGCAGG + Intronic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036379545 8:8228086-8228108 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036678126 8:10851738-10851760 CAGAACACGCGGGAGAAGGCAGG + Intergenic
1036850015 8:12194529-12194551 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1036871377 8:12436802-12436824 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1037308463 8:17530113-17530135 TATAGCACGGGGTAGGAGGCAGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037601149 8:20395274-20395296 CAGAGCAGGTGGCAGGAACCTGG - Intergenic
1037987038 8:23296491-23296513 CACAGCACAGGCCAGAAGGCTGG - Intergenic
1037991348 8:23323408-23323430 AAGAGGACAGTGCAGGAGGCAGG - Intronic
1039797034 8:40924521-40924543 CAGAACAGAGGGCAGGTGGCTGG + Intergenic
1039890441 8:41682190-41682212 CACAGGACGGGGCTGGAGGCGGG - Intronic
1039979170 8:42391988-42392010 CAGAGCGCCAGGCGGGAGGCGGG + Intronic
1040435174 8:47383173-47383195 CAGAGCACCTGGCAGGAGGCTGG - Intronic
1040582263 8:48707642-48707664 CAGAGCACAGGGCAGGGTGCAGG + Intergenic
1040740726 8:50571307-50571329 TTGAGCCCGGGACAGGAGGCAGG - Intronic
1041085082 8:54249477-54249499 AAGAGCAAGGGTCAGGAGGTGGG - Intergenic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041662386 8:60412887-60412909 CCCAGCACTGGGCAGGAGGAGGG - Intergenic
1042747559 8:72123415-72123437 AAGAACACAGGGCAGGAAGCTGG + Intergenic
1042961065 8:74304090-74304112 CATAGCCTGGGGCTGGAGGCAGG - Intronic
1043784977 8:84387507-84387529 CAGAGCTGGAGGCAGGAGTCAGG - Intronic
1044055444 8:87564254-87564276 CAGGGCATAAGGCAGGAGGCAGG - Intronic
1044731023 8:95228864-95228886 CAGAGCAGGTGGAAGAAGGCTGG - Intergenic
1044821533 8:96158977-96158999 AAGAGCTCGGGGCTGGGGGCGGG + Intronic
1045016765 8:98007318-98007340 CAGAGCAAGGGGCAGGGGAGGGG - Intronic
1045288225 8:100810151-100810173 CTGGGCTCTGGGCAGGAGGCAGG - Intergenic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1045680427 8:104653747-104653769 GAGAAAACGGGGCAGGAGGTGGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1047446024 8:124920449-124920471 CATTGCATGGGTCAGGAGGCAGG - Intergenic
1048301655 8:133255712-133255734 CAGGGGATGGGGCAAGAGGCAGG + Intronic
1048468921 8:134689825-134689847 GAAAGCACGGGGCAAGAGGCTGG + Intronic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1049350518 8:142162040-142162062 GAGAGCAGGGGGCATAAGGCAGG - Intergenic
1049488439 8:142878548-142878570 GACAGTCCGGGGCAGGAGGCAGG - Intronic
1049488755 8:142879931-142879953 CAGAGGTCAGGGCTGGAGGCAGG + Intronic
1049493335 8:142916568-142916590 GACAGTCCGGGGCAGGAGGCAGG - Intronic
1049505448 8:142994099-142994121 CTGAGCATGGGTTAGGAGGCTGG - Intergenic
1049589620 8:143451177-143451199 CAGAGCAGAAGGCAGGAAGCAGG + Intronic
1049613977 8:143568360-143568382 AAGAGCCCAGGGCAGGAGACTGG + Intronic
1049683201 8:143928973-143928995 CAGAGATCTGGCCAGGAGGCGGG - Intronic
1049773151 8:144392995-144393017 CAGAGCACGAGCCAGGAGGGCGG - Exonic
1050406120 9:5310088-5310110 GAGAGCAGGGTGCAGGAAGCAGG + Intergenic
1050537704 9:6645155-6645177 CAGAGCTCAGGGTAGGAGCCGGG + Intronic
1050592303 9:7173360-7173382 CAGAGCACGGGGCAGGCTTCTGG + Intergenic
1051469986 9:17427207-17427229 CAGAGCACGGAGCATGTGACTGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052834378 9:33239801-33239823 CAGAGAAGGGGGCTGGAGCCTGG - Intronic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1052974982 9:34403484-34403506 CAAAGTAAGGGGCAGAAGGCTGG + Intronic
1053302677 9:36963002-36963024 CTGAGCAAGGGGCCGCAGGCTGG - Intronic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1055388437 9:75791146-75791168 CAAAGCATGGGGCAGGGGGATGG - Intergenic
1056163598 9:83921492-83921514 GAGAGGACGCGGCGGGAGGCGGG - Intergenic
1056732060 9:89174840-89174862 CAGTGCAGGGGACAGGAGGCAGG - Intronic
1057489030 9:95507797-95507819 CAGGGCAGGGGGCACGGGGCAGG + Intronic
1057895715 9:98906993-98907015 CAGCTGTCGGGGCAGGAGGCTGG + Intergenic
1059308052 9:113370041-113370063 CAGAGCACTGTGCCGGAGGCTGG - Exonic
1059382299 9:113935758-113935780 CACAGCACAGGGCAGGGTGCAGG - Intronic
1059883877 9:118722760-118722782 CAAAGTAGGGGGTAGGAGGCAGG - Intergenic
1059944778 9:119398392-119398414 AAGAGCCCTGAGCAGGAGGCAGG + Intergenic
1060137142 9:121168415-121168437 CAGAGCCCAGGAGAGGAGGCAGG + Intronic
1060438634 9:123617714-123617736 CAGAGCAAAGGTCAGGAGACAGG + Intronic
1060695657 9:125707049-125707071 CAGAGCTCGGGGCAGGGGCCGGG - Exonic
1060758443 9:126229068-126229090 CAGTGCACAGGCCATGAGGCTGG + Intergenic
1060886883 9:127160715-127160737 CAGTGCTAGGGGCTGGAGGCTGG - Intronic
1060977024 9:127770866-127770888 AAGAGCATGGGCCAGGAAGCTGG + Intronic
1061002105 9:127908274-127908296 CCCAGCACGTGGCAGGAGGCAGG + Exonic
1061250165 9:129421796-129421818 GAGAGCAAGGGGCAGGGGGTGGG + Intergenic
1061409174 9:130409373-130409395 AACAGCACGGGGCCTGAGGCAGG - Intronic
1061416495 9:130450103-130450125 TGGAGCAGGGGGCAGGAGGCAGG + Intronic
1061754335 9:132802310-132802332 CAGGGCAGGGGGCGGGAGGGGGG + Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061924565 9:133799605-133799627 CCAAGCACCAGGCAGGAGGCAGG - Intronic
1061988091 9:134142080-134142102 CAGGGCACGGGGCAGGTGCGGGG + Intronic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062264640 9:135681384-135681406 ACCAGGACGGGGCAGGAGGCAGG + Intergenic
1062347588 9:136122522-136122544 CAGGGTACAGGGCAGGAGCCTGG + Intergenic
1062465165 9:136677661-136677683 CCTGGCACGGGGCAGGAGACCGG + Intronic
1062555468 9:137111822-137111844 CAGAGCTCGGGGCAGAAAGCAGG + Intronic
1186627415 X:11309339-11309361 CAGAGAAGGAGACAGGAGGCAGG + Intronic
1189860523 X:45266496-45266518 CTGAGCAAGGGGCAGGAGTGGGG - Intergenic
1190121396 X:47662348-47662370 CAGAGCTGGGGGCAGGAAGTTGG - Intergenic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190957260 X:55207922-55207944 CAGGGCAGGGGGCGGGGGGCGGG + Intronic
1192201889 X:69071463-69071485 CGGAGCCCGGGCAAGGAGGCTGG - Intergenic
1192210321 X:69123693-69123715 CAGAGCACCTGGCAGGGGGTGGG - Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1193278506 X:79620467-79620489 CAGAGCAGGAGGTAGGCGGCAGG + Intergenic
1194744347 X:97612040-97612062 CAGGGCACGTGGCAGGAGGCAGG + Intergenic
1196124347 X:112082980-112083002 GGGAGGACGGGGCAGGCGGCAGG + Intergenic
1197954203 X:131929368-131929390 CAGAGCATGGGCTAGCAGGCCGG + Intergenic
1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG + Intergenic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200237096 X:154472921-154472943 CTGGGCACAGGGCAGGAGGGTGG - Exonic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202094985 Y:21240372-21240394 CAGTACACGAGGCAGGAAGCAGG + Intergenic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic