ID: 1085711303

View in Genome Browser
Species Human (GRCh38)
Location 11:78831319-78831341
Sequence CTGGGGCCATAGAGGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 395}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085711303_1085711318 21 Left 1085711303 11:78831319-78831341 CCTAACTCCCTCTATGGCCCCAG 0: 1
1: 0
2: 2
3: 26
4: 395
Right 1085711318 11:78831363-78831385 CCGGGTGAAGAGCAAATGCTTGG 0: 1
1: 0
2: 1
3: 10
4: 87
1085711303_1085711309 -2 Left 1085711303 11:78831319-78831341 CCTAACTCCCTCTATGGCCCCAG 0: 1
1: 0
2: 2
3: 26
4: 395
Right 1085711309 11:78831340-78831362 AGCTCCCAGCTCCCAGCTCCTGG 0: 1
1: 2
2: 18
3: 111
4: 681
1085711303_1085711313 3 Left 1085711303 11:78831319-78831341 CCTAACTCCCTCTATGGCCCCAG 0: 1
1: 0
2: 2
3: 26
4: 395
Right 1085711313 11:78831345-78831367 CCAGCTCCCAGCTCCTGGCCGGG 0: 1
1: 0
2: 12
3: 95
4: 748
1085711303_1085711311 2 Left 1085711303 11:78831319-78831341 CCTAACTCCCTCTATGGCCCCAG 0: 1
1: 0
2: 2
3: 26
4: 395
Right 1085711311 11:78831344-78831366 CCCAGCTCCCAGCTCCTGGCCGG 0: 2
1: 0
2: 15
3: 85
4: 763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085711303 Original CRISPR CTGGGGCCATAGAGGGAGTT AGG (reversed) Intronic
900395157 1:2450509-2450531 GTGGGGCCAGGCAGGGAGTTGGG - Intronic
900921137 1:5671354-5671376 CAGGGACCATGGAGGGAGCTAGG - Intergenic
902404453 1:16175171-16175193 CAGGGCCCATGGAGGGAGTGCGG - Intergenic
902561521 1:17280561-17280583 CTGGGTCAAAAGAGGGTGTTGGG - Intronic
903415960 1:23183293-23183315 CTGGGGCCAGAGAGGAAGAGTGG - Intergenic
903445853 1:23422835-23422857 CTAGGGCCATAAAAGGAGTGAGG + Intronic
903692866 1:25186564-25186586 CTCGGGCCTTAGTGGGATTTGGG - Intergenic
903776203 1:25795469-25795491 CTGGGGCTATAGTGGGAGACCGG - Intergenic
904337959 1:29810283-29810305 CTGGGACCAGAGAGGGAGGGAGG - Intergenic
904551221 1:31320472-31320494 CTGGGGGCATAGAGAGAATCTGG - Intronic
905263891 1:36738149-36738171 CTGGAGGCAGAGGGGGAGTTAGG + Intergenic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
905363256 1:37434643-37434665 CTGGGACCAGAGAGGTAGCTGGG - Intergenic
905389938 1:37629807-37629829 CTGGGGACAGAGAGGGTGTGGGG + Exonic
905711739 1:40110390-40110412 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
906433456 1:45775047-45775069 CTGGTCTCATAGATGGAGTTGGG - Intergenic
906777387 1:48541995-48542017 CTGGGGCCAGTCAGGGGGTTGGG - Intronic
907993920 1:59610237-59610259 CTGGGGCCAGTTGGGGAGTTAGG - Intronic
909976776 1:82054785-82054807 CTGGCCTCATAGAAGGAGTTAGG + Intergenic
910563931 1:88622206-88622228 CTGGTGTCATAGAATGAGTTGGG - Intergenic
910612777 1:89163268-89163290 CTGGCCCCATAGAATGAGTTAGG + Intronic
911056306 1:93711249-93711271 CTGGGGCCATCGTGGGAGGCTGG + Intronic
911877194 1:103181870-103181892 CTTGGGCTATGGAGGGAGTGCGG - Intergenic
915030014 1:152871089-152871111 CTGAGGCCATGGAGGGGCTTTGG + Intergenic
915148283 1:153808605-153808627 CTGGAGCCAGAGAGGCAGGTGGG + Exonic
915477466 1:156161323-156161345 CTGGGGGCACAGGGGGAGTCAGG - Intronic
915515138 1:156408284-156408306 ATGGGGCCATTGAGGTAGGTGGG - Intronic
916252509 1:162752958-162752980 CTGGGGCCATAGAGGAATTTAGG + Intronic
916464689 1:165062290-165062312 CTGGGGCCACAGAGAGGGTCTGG + Intergenic
917058451 1:171010102-171010124 CTGGGGCCTTTCAGGGAGTTGGG - Intronic
918287003 1:183066792-183066814 CTGGGGCCTTTCAGGGGGTTGGG + Intronic
918661120 1:187090271-187090293 CTGAAGCCATAGAGGGAGAGAGG + Intergenic
918785166 1:188754745-188754767 CTGGGGTCATAAAATGAGTTAGG + Intergenic
920367582 1:205456289-205456311 GTGGGGCCATGGAGGGAGTGGGG - Intergenic
920972501 1:210754609-210754631 CAGGAGCAATAGAGAGAGTTGGG - Intronic
924238883 1:242022443-242022465 CTGGGGTCCTAGATGGAATTAGG - Intergenic
924398341 1:243649567-243649589 CTGGGGCCTGTCAGGGAGTTGGG - Intronic
1063760557 10:9070261-9070283 CTGGGGCCTGTCAGGGAGTTGGG - Intergenic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1068776018 10:60869167-60869189 CTGGGGCCAGAGAGCGGGTTGGG - Intergenic
1069562274 10:69439310-69439332 CTGTGGCTATAGAGGAAGGTGGG - Intergenic
1070534913 10:77369609-77369631 GTGGGGCCTCAGAGGAAGTTTGG - Intronic
1071812839 10:89201978-89202000 CTTGGGCTATTGAGGGAGTGGGG - Intergenic
1071975322 10:90949465-90949487 CTGGGGCCAGTCAGGGGGTTGGG - Intergenic
1072421291 10:95291977-95291999 TTGGGGTCAGAGAGGGAGTTGGG - Intergenic
1072434673 10:95404179-95404201 CTGGGGCCAGAGAATGAGGTGGG + Intronic
1073338757 10:102729564-102729586 CTTGGGCCTTTGAGGGAGTTTGG + Intronic
1073729834 10:106274347-106274369 CTGGGCCTATAGAGGGAGAAAGG - Intergenic
1074824675 10:117206219-117206241 CTAGAGCCTTAGAGGGAGTATGG - Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077485538 11:2836844-2836866 CAGGGGCCCTAGAGGGAAATGGG + Intronic
1077538028 11:3133817-3133839 CTGGGGCCAAAGAGGAAGTGTGG + Intronic
1077852891 11:6092093-6092115 CTGGCCCCATAGATTGAGTTGGG + Intergenic
1078005170 11:7527141-7527163 CTTGGGCCATAGAGTGAGCAAGG + Intronic
1079392524 11:20035007-20035029 GAGGGGCCATATAGAGAGTTTGG + Intronic
1080513351 11:32997522-32997544 CTGGTCCCATAGAATGAGTTAGG + Intergenic
1083353963 11:62051545-62051567 CTGGGTCCATAGATGGGGGTAGG + Intergenic
1084085088 11:66851351-66851373 CAGGGGCCATAGAGTGGGTCAGG - Intronic
1084214967 11:67642239-67642261 CTGGGGCCAGACAGTGAGTGTGG - Intergenic
1084601772 11:70149970-70149992 CTTTGGCCATGGAGGGTGTTCGG - Intronic
1085308078 11:75499729-75499751 CTGGGCCCAGAGATGGGGTTGGG + Intronic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1086806760 11:91253464-91253486 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
1087133690 11:94693247-94693269 CTGGGCCCAAAGAAGGAGTCTGG - Intergenic
1089011086 11:115132391-115132413 CTTGGGGGATGGAGGGAGTTGGG + Intergenic
1091052883 11:132389672-132389694 CTGTGCTCATAGAGTGAGTTTGG - Intergenic
1096940281 12:55336604-55336626 CTGGCCTCATAGAAGGAGTTAGG + Intergenic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1098049128 12:66434772-66434794 CTGGGGGCAGAGAGGGCCTTTGG + Intronic
1099394830 12:82124732-82124754 CTGGCGTCATAGAATGAGTTGGG - Intergenic
1099502060 12:83426179-83426201 CTGGGGCCACTCAGGGGGTTGGG - Intergenic
1101162204 12:101990028-101990050 CTGGCCTCATAGAAGGAGTTTGG + Intronic
1102491335 12:113291207-113291229 CTGGGGACATGCAGGGAGATGGG - Intronic
1102912562 12:116728760-116728782 CTGTGGGCCTTGAGGGAGTTGGG - Intronic
1103991999 12:124805488-124805510 CCAGGGCCATGGTGGGAGTTTGG + Intronic
1106589010 13:31082767-31082789 CTGGGCCCATAGGCTGAGTTAGG - Intergenic
1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG + Intergenic
1107323169 13:39211066-39211088 CTGGGGCAATAGAGGTATGTTGG - Intergenic
1108895208 13:55318310-55318332 CTGGGGCCTGACAGGGAGTAGGG - Intergenic
1109759101 13:66803499-66803521 CTGGGGCGATTGGTGGAGTTAGG - Intronic
1110866656 13:80403952-80403974 CTGGGCTCATAGAATGAGTTGGG + Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112175909 13:97023797-97023819 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1113400216 13:109985652-109985674 TTGGAGCCATAGAGGGAATCTGG - Intergenic
1113507212 13:110825619-110825641 CTGTGGCCATGGGTGGAGTTGGG - Intergenic
1114878351 14:26751843-26751865 GTGGGGCCACAGGGGGGGTTTGG + Intergenic
1114969024 14:28002213-28002235 CCGGGGCCTGACAGGGAGTTGGG - Intergenic
1115441141 14:33437387-33437409 CTGTGGCCATAGAGAAAGTCAGG + Intronic
1116648641 14:47562233-47562255 CTGGCCTCATAGAGTGAGTTAGG + Intronic
1116671619 14:47849550-47849572 CTGGCATCATAGAGTGAGTTAGG - Intergenic
1117389325 14:55247999-55248021 CTGTGGCCATAGAGGGTGGTAGG + Intergenic
1117633637 14:57720337-57720359 CTGGCCTCATAGAGTGAGTTTGG + Intronic
1118400751 14:65377213-65377235 CTAGGGAGCTAGAGGGAGTTTGG - Intergenic
1119477114 14:74937008-74937030 CTGGGACTAGAGAAGGAGTTTGG - Intergenic
1119644684 14:76339768-76339790 CTGGGGCCATAGAGGCAGCCAGG - Intronic
1121211434 14:92210572-92210594 CTGGGGCCAGCGAAGGACTTTGG + Intergenic
1124708747 15:31987241-31987263 CTGGTGTCATAGAAGGAGTGAGG - Intergenic
1124959440 15:34383587-34383609 GTGGGGGCAGAGAGGGAGATGGG - Intronic
1124976066 15:34529808-34529830 GTGGGGGCAGAGAGGGAGATGGG - Intronic
1125361896 15:38873214-38873236 GTGGGGCACTAGAGGGAGTCTGG - Intergenic
1126326469 15:47483124-47483146 TTGGGGGCATGGAGGGAATTTGG + Intronic
1127180933 15:56416714-56416736 CTGGCCCCATAGAATGAGTTGGG + Intronic
1127467311 15:59256851-59256873 CTGGGGCCTCAGAGGGAATTAGG + Intronic
1127931171 15:63598489-63598511 CTGGGACCATGGAGGGAGCCTGG - Intronic
1128353218 15:66905891-66905913 CTGAGGCCAGATAGTGAGTTGGG + Intergenic
1128381911 15:67119439-67119461 CTGGGGCCATGGCGGGGGTGGGG + Intronic
1128546269 15:68570410-68570432 CTGGCCCCATAGAATGAGTTAGG + Intergenic
1128734061 15:70042345-70042367 CTGAGGCAAGAGAGGGAGTTAGG - Intergenic
1129003841 15:72355802-72355824 CTGGGGCCAGAGTGGGAGGGTGG + Intronic
1129672517 15:77615116-77615138 TTGAGGCCGTAGAGGCAGTTGGG + Exonic
1130145859 15:81273265-81273287 CTGGGGCCATAGAAGATGTTGGG + Intronic
1130572379 15:85058410-85058432 CTGGCGTCATAGAATGAGTTAGG + Intronic
1130619728 15:85449923-85449945 CTGGCCTCATAGAGTGAGTTGGG + Intronic
1131945302 15:97613591-97613613 CTGGAGACATAGAATGAGTTTGG - Intergenic
1132599889 16:768737-768759 CTGGGGCCAGCAAGGGAGTGGGG - Exonic
1132726439 16:1340950-1340972 CTGAGGCCATCGAGCGAGTGAGG + Exonic
1133126017 16:3646479-3646501 CTGGGGCCATGGCGGGTGTAGGG + Intronic
1133771009 16:8867274-8867296 CAGGGGTCACAGAGGGAGTGGGG - Intronic
1134515675 16:14885044-14885066 CTGGAGCAAAAGAGAGAGTTGGG + Intronic
1134703348 16:16283688-16283710 CTGGAGCAAAAGAGAGAGTTGGG + Intronic
1134964195 16:18428426-18428448 CTGGAGCAAAAGAGAGAGTTGGG - Intronic
1134968482 16:18510962-18510984 CTGGAGCAAAAGAGAGAGTTGGG - Intronic
1135048503 16:19173407-19173429 CTGAGGCCATTGGGGGAGGTGGG - Intronic
1136315697 16:29453733-29453755 CTGGGGCGAGAGATGGGGTTAGG + Intronic
1136430274 16:30193075-30193097 CTGGGGCGAGAGATGGGGTTAGG + Intronic
1137828634 16:51522754-51522776 CTGGGGCCTGTCAGGGAGTTGGG + Intergenic
1137882502 16:52065963-52065985 CTGGTGTCATAGAATGAGTTAGG + Intronic
1138230628 16:55333146-55333168 CTTTAGCCATAGAAGGAGTTTGG - Intergenic
1138475867 16:57270366-57270388 CAGGGGCCATGGATGGACTTGGG - Intronic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1138639763 16:58375508-58375530 CTGGGGCCAAAGAAGGAGGGAGG - Intronic
1138976180 16:62210963-62210985 CTGGACTCATAGAGTGAGTTGGG + Intergenic
1139090255 16:63637564-63637586 GTGGGGACATAGAGGGATGTGGG + Intergenic
1141980951 16:87550390-87550412 CAGGGGCCGAAGAGGGAGTCAGG - Intergenic
1142037305 16:87869875-87869897 CTGAGGCCAAGGATGGAGTTTGG + Intergenic
1142281625 16:89151386-89151408 CTGGTCCCATACGGGGAGTTAGG - Intronic
1143465123 17:7131384-7131406 ATGGGGCCAGAGAGGGAGGCAGG + Intergenic
1146083361 17:29803758-29803780 CTAGGGCCATAGAGCTATTTAGG + Intronic
1146932153 17:36785094-36785116 CTGGGATCATGGAGGGAGTCAGG - Intergenic
1147156667 17:38547633-38547655 CTGTGGCCATGGTGGGACTTGGG + Intronic
1147340525 17:39750975-39750997 CAGGGGTCGCAGAGGGAGTTCGG + Intergenic
1147556463 17:41482351-41482373 CTGGGCCCTTAGAGGCAGTGGGG - Intergenic
1147879027 17:43642156-43642178 CTGGGGCCTTTGAGGGAGTAGGG - Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148471307 17:47895593-47895615 CCGGCACCATAGTGGGAGTTGGG - Intergenic
1148567827 17:48644189-48644211 CTGGGGCCCTTGGGGCAGTTAGG + Intergenic
1148585417 17:48775203-48775225 CTGGCCCCATAAAGTGAGTTGGG - Intronic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149651814 17:58280496-58280518 CTGGGGCCTGATAGGGGGTTGGG - Intronic
1151197957 17:72445391-72445413 ATGGGGCCAGAGTGGGAGGTTGG - Intergenic
1152582694 17:81173790-81173812 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1155456832 18:26025801-26025823 CTGGTTTCATAGAGTGAGTTGGG - Intronic
1155621763 18:27787380-27787402 CTGGAGCTCCAGAGGGAGTTTGG + Intergenic
1155740644 18:29284096-29284118 CAGGGGCCATGGTAGGAGTTAGG - Intergenic
1156005261 18:32432928-32432950 CTGGCCCCATAGAATGAGTTAGG - Intronic
1156060453 18:33068305-33068327 CTGGGCTCATAGAATGAGTTAGG - Intronic
1156480350 18:37432341-37432363 CTGGGCCCAGAGGGGGAGCTTGG + Intronic
1156665174 18:39396055-39396077 CTGGGGCCAATCAGGGGGTTGGG + Intergenic
1157556321 18:48615407-48615429 CGGGGCCCAGAGAGGGAGTGGGG - Intronic
1157626381 18:49054689-49054711 CTGGCGACACAGAGGGACTTGGG + Intronic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1157935714 18:51870483-51870505 CTGGTTTCATAGAGTGAGTTAGG + Intergenic
1158162194 18:54497506-54497528 GTGAGGCAATAGAGGGAGTGGGG - Intergenic
1159025526 18:63179402-63179424 CAGGGGCCCTAGAGGGACTCAGG - Intronic
1161726855 19:5934210-5934232 CTGTGCCCATACAGGGAGTGGGG + Intronic
1162446792 19:10728307-10728329 CTGAGGCCAGAGAGGGAGACTGG + Intronic
1162622518 19:11855297-11855319 CTGGGTCCATGGAGGGGGGTAGG + Intronic
1162641541 19:12014285-12014307 CTGGGTCCAGTCAGGGAGTTTGG - Intergenic
1162780916 19:13006726-13006748 CTGGGGCCCTGGTGGGAGTTGGG - Intronic
1164504542 19:28848548-28848570 CTGTGGCCATTCAGGGATTTGGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164751070 19:30655073-30655095 CTGGGTACATCTAGGGAGTTAGG + Intronic
1165168742 19:33875810-33875832 CTGGGCATAGAGAGGGAGTTTGG - Intergenic
1165856396 19:38881233-38881255 CGGAGGCCACAGTGGGAGTTGGG + Intronic
1166209524 19:41297271-41297293 TTGGGGCCATGGTGGGAATTTGG + Intronic
1166277132 19:41761832-41761854 CAGGGGACATAGCGGGGGTTTGG + Intronic
1166483639 19:43194708-43194730 CAGTGAACATAGAGGGAGTTTGG - Intronic
1167748136 19:51364761-51364783 CAGGGGGCATTGAGGGAGATGGG + Intronic
1167981898 19:53282589-53282611 CTGGGGCCATGGTGGGGGTGGGG + Intergenic
1167984195 19:53301073-53301095 CTGGGGCCATGGTGGGGGTGGGG - Intergenic
1168277129 19:55284450-55284472 CCGGGGCCAAGGAGGGAGGTGGG + Exonic
924982066 2:232596-232618 CTGGGGCCTTTCAGGGGGTTGGG - Intronic
925103408 2:1268914-1268936 CTGGGGCACTAGAGGGTGTGGGG - Intronic
925232661 2:2248513-2248535 CTGGCCTCATAGAAGGAGTTTGG - Intronic
925269805 2:2595970-2595992 CTGGCCTCATAGAGTGAGTTTGG - Intergenic
925819120 2:7782256-7782278 CTGGCCTCATAGAAGGAGTTAGG + Intergenic
927013538 2:18931496-18931518 CTGGGGCCATGGAAGGGGATGGG + Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
931195298 2:60047191-60047213 CTGGGGCCAGAGAGTCAGATAGG - Intergenic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
932511951 2:72301353-72301375 CTGGCCTCATAGAAGGAGTTGGG + Intronic
932823205 2:74919073-74919095 ATGGGGCAAAAAAGGGAGTTTGG - Intergenic
934069947 2:88374563-88374585 CTGGGGCAAGAGAGGGAAATGGG + Intergenic
934906039 2:98204716-98204738 CTGGCCTCATAGAGTGAGTTGGG + Intronic
936978403 2:118241656-118241678 CTGGGGCCATGGAGGGTGGGTGG + Intergenic
937243897 2:120479973-120479995 CTGGGACCACAGAGGGACTTGGG - Intergenic
937376667 2:121341128-121341150 CTAGGGCCACAGAGGGAGGGAGG + Intronic
938315454 2:130323842-130323864 CTGGTCTCATAGAGTGAGTTAGG + Intergenic
939930090 2:148223271-148223293 CTGGGCTCATAGAATGAGTTTGG + Intronic
940371108 2:152901853-152901875 CTGGGGCCTTTTGGGGAGTTGGG + Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
940757390 2:157698997-157699019 CTGGGGCCATAAAGCAAGTGTGG + Intergenic
942819568 2:180096169-180096191 CTGAGCCCATAGAATGAGTTAGG - Intergenic
942860840 2:180609950-180609972 TTGGAGCCATAAAGGGAGATGGG - Intergenic
943895902 2:193359216-193359238 CTAGGGCTATAGAGGTAGGTAGG - Intergenic
944126805 2:196303412-196303434 CTGGGCTCATAGAATGAGTTAGG + Intronic
945549301 2:211199604-211199626 TTGTGGCCATAGAGAGATTTTGG - Intergenic
945651689 2:212569089-212569111 ATGATGCCATAAAGGGAGTTAGG - Intergenic
946164148 2:217853619-217853641 GTGGGGCCATGGAGAGATTTTGG - Intronic
947026225 2:225741012-225741034 GTGGGGCCATGGAGGGAGGCTGG - Intergenic
947123645 2:226843776-226843798 CTGGCTTCATAGAAGGAGTTGGG + Intronic
947965358 2:234275888-234275910 TTTGAGCCATAGAGGGAGTGAGG - Intergenic
1168988670 20:2074321-2074343 CTGGCCTCATAGAAGGAGTTAGG - Intergenic
1169209092 20:3755729-3755751 CTGGAGTGATGGAGGGAGTTGGG - Intronic
1169249836 20:4051922-4051944 CTGGGAGCATAGGTGGAGTTTGG + Intergenic
1169909628 20:10636864-10636886 CAGAGGCCATCGAGGGATTTGGG - Intergenic
1170291608 20:14776205-14776227 CTGGAGCCAAAGAGTGGGTTTGG + Intronic
1170300427 20:14877978-14878000 CTGGCTCCATAGAAGGAGTTAGG + Intronic
1170409563 20:16073950-16073972 CTTGGGCCATCGTGGTAGTTAGG - Intergenic
1170637540 20:18121339-18121361 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1170690174 20:18607499-18607521 CTGGCCCCATAGAATGAGTTGGG + Intronic
1171815590 20:29783400-29783422 CAGGGACCATGGAGGGAGTTGGG + Intergenic
1172484729 20:35291350-35291372 CTGAGGCCAGAGAGGGGCTTGGG - Intronic
1172892683 20:38278191-38278213 GTGGGGCCATAGAGGGAAAGGGG - Intronic
1174464549 20:50707185-50707207 CTGGAGCCATTGAGGGCTTTAGG + Intergenic
1174503002 20:50999379-50999401 CTGGGGACATGGTGGGAGTGTGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175522597 20:59611698-59611720 CTGGGGCCGGAGAGGGAGGCAGG - Intronic
1176000012 20:62827454-62827476 CTGGGGCCAGGGAGAGAGCTCGG - Intronic
1176035803 20:63035938-63035960 AGGGGGCCATAGAGGGAGAAGGG - Intergenic
1178201501 21:30411895-30411917 CTGGAGTCATAGAATGAGTTAGG - Intronic
1178687612 21:34723625-34723647 GAGGAGCCATAGAGGAAGTTTGG - Intergenic
1180032747 21:45223587-45223609 CTGGGGCCATGGGGAGAGATTGG + Exonic
1180033503 21:45229013-45229035 CTGAGGGCATAGCGGGAGGTGGG - Intergenic
1180336177 22:11578605-11578627 CAGGGACCATGGAGGGAGCTGGG - Intergenic
1180864028 22:19105596-19105618 CCGGGGCCCCAGAGGGACTTCGG + Intronic
949696536 3:6702896-6702918 CTGGCTTCATAGAGTGAGTTAGG - Intergenic
950181921 3:10919465-10919487 CTGGGGCTTGAGAGGGAGGTGGG - Intronic
951367445 3:21801327-21801349 CTGGACCCATAGAATGAGTTAGG + Intronic
951470228 3:23048063-23048085 CTGGTCTCATAGAGTGAGTTAGG - Intergenic
952163821 3:30723949-30723971 CTAGGGCCATAGGGGGAGCATGG + Intergenic
952316035 3:32233046-32233068 CTGGGGCAGAATAGGGAGTTGGG - Intergenic
952574841 3:34762125-34762147 CTGGCTTCATAGAGTGAGTTAGG - Intergenic
953417643 3:42732143-42732165 CTGGGGTCATAAAGGCACTTGGG - Intronic
954139033 3:48595524-48595546 CTGTGACCTTAGATGGAGTTAGG - Intergenic
957368587 3:79259565-79259587 GTGGGGGCATAGGGGGAGGTGGG - Intronic
958668827 3:97176402-97176424 CTGGGCTCATAGAATGAGTTTGG + Intronic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
960066845 3:113383440-113383462 GTGGGGCCTTTGAGGGAATTAGG - Intronic
960868191 3:122223677-122223699 CTGGGTTCATAGAATGAGTTAGG - Intronic
962001390 3:131301860-131301882 CTGGCCTCATAGAGTGAGTTAGG + Intronic
962038389 3:131678937-131678959 CTGGCCCCATAGAATGAGTTAGG + Intronic
962208091 3:133452221-133452243 CTTGGGGGATAGAGGGAGTATGG - Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
962584268 3:136825905-136825927 CTGGCCTCATAGAGTGAGTTCGG + Intronic
962894821 3:139704736-139704758 GTGGGGGAATAGAGGGAGTATGG + Intergenic
963616074 3:147539713-147539735 CTGGCCTCATAGAGTGAGTTGGG + Intergenic
963849011 3:150190058-150190080 CTGGCCCCATAGAATGAGTTAGG + Intergenic
964038667 3:152231065-152231087 CTGGGGCCTGTCAGGGAGTTGGG + Intergenic
964050143 3:152381972-152381994 CTGGGGACATAGTAGGTGTTTGG + Intronic
964442838 3:156729627-156729649 CAGCGTCCAGAGAGGGAGTTGGG + Intergenic
966270039 3:178093915-178093937 CTGGCTCCATAGAGTAAGTTAGG - Intergenic
967449151 3:189603261-189603283 CTGGGCACATATAAGGAGTTGGG - Intergenic
968734469 4:2288267-2288289 CTGGGGCCACAGGGGGGCTTAGG - Intronic
969049747 4:4364242-4364264 CTGGGGCCACACAGGAAGATGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969444739 4:7238270-7238292 CTGGGGAGGTAGAGGGAGTCTGG + Intronic
969659139 4:8516191-8516213 CTGGGGCCATAGCAGCAGATGGG - Intergenic
969704579 4:8784800-8784822 CTGGGGGCAGCAAGGGAGTTGGG + Intergenic
970134892 4:12911860-12911882 ATGGAGGCATAGAGGGAGTGAGG - Intergenic
971285290 4:25283298-25283320 ATGGTGCCGTAGAGGGAGATAGG + Intergenic
971425905 4:26515211-26515233 CGGGGGTTATAGAGGGAGTGAGG - Intergenic
972143543 4:35992032-35992054 CTGGCTCCATAGAATGAGTTTGG - Intronic
972868180 4:43260370-43260392 CCGGGGCCTTTCAGGGAGTTGGG - Intergenic
973590317 4:52434243-52434265 CTAGAGCCATAAAGGGAATTGGG - Intergenic
974889672 4:67865981-67866003 CTGGAGTCATAGAATGAGTTCGG - Intronic
975977823 4:80119201-80119223 CTGGCCTCATAGAGTGAGTTGGG - Intronic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
979184793 4:117774325-117774347 CTGGCCTCATAGAGTGAGTTTGG - Intergenic
979594614 4:122520859-122520881 CTGGCGTCATAGAATGAGTTTGG + Intergenic
980090579 4:128438975-128438997 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
980099986 4:128532388-128532410 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
980335957 4:131473709-131473731 CTGGGGCCTATCAGGGAGTTGGG - Intergenic
982846583 4:160260261-160260283 CTGGGGCCTATCAGGGAGTTGGG - Intergenic
985653727 5:1119391-1119413 CTGGGGCCCTAGCGGGTGTCTGG - Intergenic
986041516 5:3998554-3998576 CTGGTGGCATAGAGGAAGTGTGG + Intergenic
986234199 5:5892584-5892606 CTGGGGCCAAGAATGGAGTTTGG - Intergenic
986244550 5:5994572-5994594 CTGGTCCCATAGAATGAGTTAGG + Intergenic
986470453 5:8068496-8068518 GTGGGGCTAGAGAGGGAGTATGG + Intergenic
986655717 5:10009651-10009673 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
986793646 5:11188445-11188467 CTGGGGCCAGTCAGGGAGTTGGG + Intronic
987079713 5:14415760-14415782 CTGGGCCTAAAGAGGGACTTGGG + Intronic
987596819 5:20011943-20011965 CTGGGCTCATAGAATGAGTTAGG + Intronic
987655691 5:20802655-20802677 GTGGCTCCATAGAGTGAGTTAGG - Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
988607977 5:32697495-32697517 CTGGCTGCATAGAGTGAGTTTGG + Intronic
988767865 5:34401254-34401276 GTGGCTCCATAGAGTGAGTTAGG + Intergenic
988833144 5:35006494-35006516 CAGGAGCAAGAGAGGGAGTTAGG + Intronic
989404841 5:41048787-41048809 ATGGGGCCAAAGAGAGAGATGGG + Intronic
989428152 5:41320246-41320268 CTGGCCTCATAGAGTGAGTTTGG - Intronic
991205609 5:64046590-64046612 CTGGCCCCATAGAATGAGTTTGG - Intergenic
991693141 5:69245181-69245203 CTGGCCCCATAGAATGAGTTTGG + Intronic
993233901 5:85277975-85277997 CTGGGCTCATAGAATGAGTTAGG - Intergenic
993634038 5:90322734-90322756 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
993944300 5:94099114-94099136 CTGGCCCCATAGAATGAGTTGGG - Intronic
995186326 5:109275494-109275516 CTGGGGACAGGGAGAGAGTTCGG + Intergenic
996902412 5:128557559-128557581 CTGGCCCCATAGAATGAGTTAGG - Intronic
997350168 5:133225345-133225367 ATGGGGCCATTGAGAGTGTTAGG + Intronic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
997609983 5:135209144-135209166 CTGGGGCCATGGAGTGAGTGAGG + Intronic
998876857 5:146608917-146608939 CTGGCCTCATAGAAGGAGTTTGG - Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1001838853 5:174856007-174856029 ATGGGGCCATAGATGCAGGTTGG - Intergenic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002452267 5:179325770-179325792 CTGGGGCCAAAGGGGGAATGCGG - Intronic
1002869621 6:1155211-1155233 CTCAGGCCATAATGGGAGTTGGG + Intergenic
1003499922 6:6695544-6695566 CTGGGGCGACAGTGGGAGTGTGG + Intergenic
1003924095 6:10860667-10860689 CAGGAGCAAGAGAGGGAGTTGGG + Intronic
1004464029 6:15866776-15866798 CTGGAGCCTCAGAGGGTGTTGGG - Intergenic
1005083045 6:21976558-21976580 CTGGGGCCTGTCAGGGAGTTGGG + Intergenic
1009419742 6:63452092-63452114 CTGGTCCCATAAAGTGAGTTGGG + Intergenic
1010674926 6:78731777-78731799 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1011111979 6:83848867-83848889 CTGGGTCCATAAAGGGATCTTGG - Intergenic
1011159886 6:84377455-84377477 CTGGTGCCATACAATGAGTTAGG + Intergenic
1011630425 6:89318072-89318094 CTGGTCCCATAGAATGAGTTAGG - Intergenic
1011716758 6:90114153-90114175 CTGGACTCATAGAGTGAGTTGGG - Intronic
1011886065 6:92097054-92097076 CTGGGGCCTTTCAGGGAGTAGGG + Intergenic
1012698511 6:102421022-102421044 CTGGCCTCATAGAAGGAGTTAGG - Intergenic
1013428814 6:110038078-110038100 CTAGGGCCAGAGAGGGATTTGGG - Intergenic
1013763561 6:113547878-113547900 CTGGCCTCATGGAGGGAGTTTGG - Intergenic
1013912798 6:115298381-115298403 CTGGGCTCATAAAGTGAGTTAGG + Intergenic
1014386163 6:120804966-120804988 CTGGGGCCTTGGAGGGGGTGGGG + Intergenic
1015185238 6:130408434-130408456 CTGGGGCCATCCAGAGATTTTGG - Intronic
1015651827 6:135470774-135470796 CTGGGGCCTGTCAGGGAGTTTGG + Intronic
1016230117 6:141793150-141793172 CTGGCCCCATAGAAGGAGTTTGG - Intergenic
1016453314 6:144206231-144206253 CTGGCCTCATAGAGTGAGTTGGG + Intergenic
1016565239 6:145444587-145444609 CTGGACCCATAGAATGAGTTGGG + Intergenic
1017067262 6:150540527-150540549 CTAGGATCATAGAGGTAGTTTGG + Intergenic
1019305930 7:335733-335755 CTGGGGCCATACTGGGATTATGG + Intergenic
1019518842 7:1451612-1451634 CTGGCCCCACAGAGGGAGCTGGG + Intronic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1022040965 7:26580745-26580767 CTTGGTCCATAGAGGGAGACAGG + Intergenic
1023290475 7:38663496-38663518 CTGGCTTCATAGAAGGAGTTAGG - Intergenic
1024726185 7:52198584-52198606 CTGGTTCCATAGATTGAGTTAGG + Intergenic
1025192034 7:56903087-56903109 CTGGGGCCATGGATGGTGCTAGG - Intergenic
1025679918 7:63673844-63673866 CTGGGGCCATGGATGGTGCTAGG + Intergenic
1028057676 7:86267602-86267624 CTGGGGCCTGACAGGGGGTTGGG + Intergenic
1028316519 7:89408992-89409014 CTGGGGCCAATGAGGGATATTGG + Intergenic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1029973875 7:104814957-104814979 CTGGGTCCATAGCTGCAGTTTGG + Intronic
1030752846 7:113252159-113252181 CTGGCTTCATAGAGTGAGTTTGG - Intergenic
1031736287 7:125366253-125366275 CTGGTCTCATAGAAGGAGTTAGG + Intergenic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1032517466 7:132517809-132517831 CTGAGGGCAGTGAGGGAGTTGGG + Intronic
1032893718 7:136226354-136226376 CTGGGGCCTGTCAGGGAGTTGGG + Intergenic
1032965881 7:137096863-137096885 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034756488 7:153626264-153626286 CTGGCTTCATAGAAGGAGTTAGG + Intergenic
1036153412 8:6319932-6319954 CTGGGCCCATGGAGGGGGATGGG - Intergenic
1037556269 8:20026626-20026648 CTGGGGCCTGTGAGGGAGTGGGG - Intergenic
1037658362 8:20906601-20906623 CTGGGGCCGGAGAGGGAGCGGGG - Intergenic
1037734711 8:21556710-21556732 CTGGGGCCACAGAAGCAGATGGG - Intergenic
1037788093 8:21914618-21914640 CTGAGGTCACAGAGGTAGTTGGG + Intergenic
1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG + Intergenic
1040012428 8:42673340-42673362 ATGAGGCCATGAAGGGAGTTTGG - Intergenic
1041131073 8:54701001-54701023 CTGGGGAACTAGAGGGAGATGGG + Intergenic
1042216577 8:66434348-66434370 CTGGGGCTCAAGAGTGAGTTGGG + Intronic
1042401264 8:68350281-68350303 CTGTGGTCATAGAGTGTGTTTGG + Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1044765549 8:95569536-95569558 CTGGCCCCATAAAGTGAGTTTGG + Intergenic
1046656905 8:116904880-116904902 TTGGGGCCAGAGAGGCAGTGAGG + Intergenic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047676830 8:127211863-127211885 CTGGGGCCATGGGTGGGGTTTGG - Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048123650 8:131608671-131608693 CTGGGGGTATAGAGGGATCTGGG - Intergenic
1050585292 9:7104415-7104437 CTGGGGCCCTGGAAGGAGTGAGG + Intergenic
1050659227 9:7864651-7864673 CTGGCCTCATAGAGTGAGTTAGG + Intronic
1051197664 9:14580794-14580816 CTGGCTCCATAGAATGAGTTAGG - Intergenic
1052265542 9:26567795-26567817 CTGGGGCCTGAGAGGGAGGGAGG - Intergenic
1052277879 9:26698846-26698868 CTGGCTCCATAGAATGAGTTAGG - Intergenic
1052973130 9:34390951-34390973 CTGGGTTCATAGAATGAGTTAGG + Intronic
1052978695 9:34431111-34431133 CTGCAGCCATAGAGAGAGATTGG - Intronic
1053580596 9:39400057-39400079 CTGGCCTCATAGAAGGAGTTTGG - Intergenic
1053845091 9:42228104-42228126 CTGGCCTCATAGAAGGAGTTTGG - Intergenic
1054102183 9:60958862-60958884 CTGGCCTCATAGAAGGAGTTTGG - Intergenic
1054584176 9:66948001-66948023 CTGGCCTCATAGAAGGAGTTTGG + Intergenic
1056148592 9:83761549-83761571 CTGGCCTCATAGAAGGAGTTTGG - Intronic
1056538491 9:87551653-87551675 ATGGGCCCATGGTGGGAGTTGGG + Intronic
1056845094 9:90030695-90030717 ATGGGGCCATCCAGGGCGTTGGG - Intergenic
1057875342 9:98749318-98749340 CTGGGGTCAGGGAGGGAGCTGGG - Intronic
1057904746 9:98974944-98974966 CTGAGGCCATGCAGTGAGTTTGG - Intronic
1059762204 9:117349031-117349053 CTGGTGCCATAGAGAGAGCTAGG + Intronic
1060015744 9:120084821-120084843 GTGGGGGCATGGAGAGAGTTGGG - Intergenic
1062609407 9:137367257-137367279 CTGGGGCCAGAGAGGGCTCTTGG - Intronic
1186962366 X:14750379-14750401 GTGGAGCCATTGAGGGAGTCTGG - Intergenic
1186964107 X:14769167-14769189 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1187494840 X:19786198-19786220 CTGGGGCCATGGTGGGACTCAGG + Intronic
1187575328 X:20547784-20547806 CTGGGGAGAGAGAGGGAGTGAGG + Intergenic
1190266813 X:48831742-48831764 CTGGGGCCTAAGAGGGAGTGAGG - Intronic
1190339054 X:49282029-49282051 CTGGGGCCATGGACGGAGAGGGG - Exonic
1190380020 X:49829946-49829968 CTGGGGCGAGGGAGGAAGTTGGG + Intronic
1191972810 X:66836355-66836377 CTGGCACCATAGAATGAGTTTGG - Intergenic
1192780325 X:74287487-74287509 CCGTGGCCATAGACGGAATTGGG + Intergenic
1193180133 X:78445282-78445304 CTGGAGTCATAGAATGAGTTGGG + Intergenic
1193436570 X:81480913-81480935 CTGGCCTCATAGAAGGAGTTAGG - Intergenic
1193552905 X:82920981-82921003 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
1193767864 X:85553570-85553592 CTGGTGTCATAGAATGAGTTTGG + Intergenic
1193775978 X:85642093-85642115 CTGGGGGCATTGAGGGGGCTGGG - Intergenic
1194251763 X:91584698-91584720 CTGGGCACATAGAATGAGTTAGG + Intergenic
1194953686 X:100155031-100155053 CTGACCTCATAGAGGGAGTTTGG + Intergenic
1195024195 X:100859441-100859463 CTGGCCTCATAGAGTGAGTTAGG + Intronic
1195705004 X:107732250-107732272 CTGAGTCCTTGGAGGGAGTTTGG - Intronic
1197077843 X:122374794-122374816 CTGGCCTCATAGAGTGAGTTTGG + Intergenic
1197625411 X:128796536-128796558 CTGGGGCCAGACAGGGCGTGAGG + Intergenic
1199104294 X:143844040-143844062 CTGGCCCCATAGAATGAGTTTGG + Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1200570698 Y:4825929-4825951 CTGGGCACATAGAATGAGTTAGG + Intergenic
1201402069 Y:13613990-13614012 TTAGAGCCATAGAAGGAGTTTGG - Intergenic
1201771785 Y:17622891-17622913 CTGGGACCATAGAGGGACCAGGG + Intergenic
1201829770 Y:18283095-18283117 CTGGGACCATAGAGGGACCAGGG - Intergenic