ID: 1085712360

View in Genome Browser
Species Human (GRCh38)
Location 11:78841658-78841680
Sequence CTGTGGGAAAGGAGCCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 2, 2: 7, 3: 81, 4: 671}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085712360_1085712369 -5 Left 1085712360 11:78841658-78841680 CCCCCCTGGCTCCTTTCCCACAG 0: 1
1: 2
2: 7
3: 81
4: 671
Right 1085712369 11:78841676-78841698 CACAGCTGACAGCACGTCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1085712360_1085712368 -6 Left 1085712360 11:78841658-78841680 CCCCCCTGGCTCCTTTCCCACAG 0: 1
1: 2
2: 7
3: 81
4: 671
Right 1085712368 11:78841675-78841697 CCACAGCTGACAGCACGTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085712360 Original CRISPR CTGTGGGAAAGGAGCCAGGG GGG (reversed) Intronic
900084998 1:888637-888659 GGGAGGGAAAGGAGACAGGGAGG + Intergenic
900293642 1:1937230-1937252 CCCTGGGGAAGGAGCCAGCGTGG + Intronic
900368707 1:2322063-2322085 GTGTGGGGAAGGGGCCAGGGCGG - Intronic
900370746 1:2331128-2331150 TTGTGGGAGGGGAGACAGGGTGG - Intronic
900491699 1:2952508-2952530 CTGCAGGAAATGAGCCAGGCTGG + Intergenic
900496525 1:2978441-2978463 CTGTGAGGCAGGGGCCAGGGTGG - Intergenic
900543453 1:3215667-3215689 CAGTGGGAAAGGGCCAAGGGAGG - Intronic
900687113 1:3955630-3955652 CTGTGGGAAAGGAGCCAATAAGG - Intergenic
900700881 1:4047960-4047982 CTGGGGGAAAGGGGCCTGGCTGG + Intergenic
900782898 1:4629386-4629408 CTGGGGGTCAGGAGCCAGGCTGG - Intergenic
900810659 1:4799222-4799244 CTGTGTGGAAGCTGCCAGGGTGG - Intergenic
900895628 1:5481069-5481091 CTGTGGTGAAGGAGCCACGCAGG - Intergenic
900919151 1:5659764-5659786 CTGAGGGGAAGGGGGCAGGGTGG - Intergenic
900956885 1:5891834-5891856 CTGTGGGGCTGGAGCCTGGGTGG - Intronic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902216938 1:14940167-14940189 CTGTGGGAAAGTAGCTGTGGTGG + Intronic
902254200 1:15177001-15177023 ATGTCTGAAAGGAGCCAGTGGGG + Intronic
902286835 1:15412598-15412620 CTGGGGGAAAGGAGAGACGGGGG - Intronic
903138476 1:21324579-21324601 ATGTGGGAAAGGGGCGGGGGTGG - Intronic
903346123 1:22685453-22685475 CAGTGAGAAAGGAACCAGAGGGG - Intergenic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
903839129 1:26225725-26225747 CTCTGGAAGAGGAGTCAGGGAGG - Intergenic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904179459 1:28655680-28655702 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
904307599 1:29600144-29600166 CTGTGGGAAAGGAGAAAATGGGG + Intergenic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904990127 1:34585836-34585858 TTGTGGGAAAAGAGTCAGGCAGG - Intergenic
905014849 1:34770791-34770813 CTGCGGGAAAGGAGAGAGGGAGG - Intronic
905025855 1:34848818-34848840 CTGTAGGCGAGGAGCCAGGAAGG + Intronic
905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG + Intronic
905181162 1:36167769-36167791 CTATGTGAAAGGAGGCTGGGAGG - Intronic
905354098 1:37369071-37369093 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
905387591 1:37614977-37614999 CTGGGGGAATGGGGGCAGGGTGG + Intronic
905465257 1:38148390-38148412 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
905607917 1:39320295-39320317 CTGTGGGAAAATAGCCTGTGGGG - Intronic
905775991 1:40667440-40667462 CTCTGTGAAAGGGGCCAGGGAGG - Intergenic
905793521 1:40802619-40802641 CTGAGGAGAAGGAGCCCGGGCGG + Intronic
905925724 1:41748264-41748286 CTGAGGGAAAGTAACAAGGGTGG - Intronic
906050519 1:42867705-42867727 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
906258352 1:44367690-44367712 GCTTAGGAAAGGAGCCAGGGTGG + Intergenic
907278928 1:53332343-53332365 CAGGGGGACAAGAGCCAGGGAGG + Intergenic
907475621 1:54703326-54703348 TTGTAGAAAAGGAGCCAGTGTGG - Intronic
907780373 1:57561125-57561147 CTGGGGGAGAGGAGGCAGGGTGG - Intronic
908463321 1:64367225-64367247 CTGGGGGAAAGGAGGCAATGGGG + Intergenic
908632199 1:66121410-66121432 TCGTGGGAAATGAGCCAGAGGGG + Intronic
908986021 1:70023144-70023166 CCCTGGGAAAGGGGCCAGCGTGG + Exonic
909172577 1:72315175-72315197 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
909548915 1:76876892-76876914 CTGAGGGAGAGAAGGCAGGGTGG + Intronic
910630254 1:89346543-89346565 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
910831061 1:91463133-91463155 CTGGGGGAGAGCAGGCAGGGTGG + Intergenic
911015753 1:93330275-93330297 CTGTGGGAAGGGAGAAAGAGAGG - Intergenic
911053511 1:93692229-93692251 CTGTGAGGAAGGAACCAGAGAGG - Intronic
911738364 1:101361628-101361650 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
911981869 1:104578973-104578995 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
912409070 1:109467189-109467211 CTGAAGCAATGGAGCCAGGGTGG + Intronic
912708640 1:111933643-111933665 ATGTGGGAAAGCAGGCAGGGAGG + Intronic
912823395 1:112885036-112885058 CTGTGGGTGATGAGCCAGGTGGG + Intergenic
913248606 1:116892456-116892478 CTATGGGAAAGGTGCCAGTTAGG + Intergenic
914752574 1:150545615-150545637 GTGTGGGAGGGGAGCCTGGGAGG - Intergenic
914965476 1:152253615-152253637 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
915240177 1:154515607-154515629 CTGAGGGAGAAGAGCCGGGGAGG - Intronic
915602398 1:156930460-156930482 CTCTGGGGAGGGAGCCTGGGTGG + Intronic
915709693 1:157883934-157883956 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
915996765 1:160571668-160571690 CTGGGGGGGAGGAGCTAGGGAGG + Intronic
916106297 1:161435039-161435061 CTGGGGGAAAGAAGGCAGGGTGG + Intergenic
916585068 1:166143244-166143266 CTGGGGGAAGGGTGCCAGGGAGG + Intronic
917538842 1:175894286-175894308 CTGTGGGAAAGGCGGCAAGTAGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917764558 1:178202300-178202322 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
917830274 1:178875784-178875806 CTCTGGGGAAGGAGCCAGTAGGG + Intronic
918234677 1:182569356-182569378 TTGAGGGAAAGGAGGGAGGGGGG - Intergenic
918755682 1:188337518-188337540 CTATGGGAGAGAAGGCAGGGTGG + Intergenic
919837330 1:201583842-201583864 CTGGGGGAGAGGAGCCAGTCAGG + Intergenic
919858048 1:201719038-201719060 TTGAGGGCAAAGAGCCAGGGAGG - Intronic
920186401 1:204161963-204161985 ATGAGGGAAAGGAGACAGGGAGG + Intronic
920375442 1:205505507-205505529 CAGAGGGAAAGGAGGCTGGGTGG + Intronic
920437093 1:205954074-205954096 GTGTGAGAAGGAAGCCAGGGAGG + Intergenic
920443856 1:206000986-206001008 CTAGGGGAAAGGAACCAGGGAGG - Intronic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920603687 1:207357544-207357566 CGGTGGGAATGGAGACTGGGCGG + Intronic
921188026 1:212686342-212686364 CTGTGGGAGAGTGGCCAGGCAGG + Intergenic
921713962 1:218399853-218399875 GTATGGGAAGGGAGGCAGGGAGG + Intronic
922802826 1:228371946-228371968 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
923388722 1:233492221-233492243 TTGTGGGAAAGGAGTGAGGCAGG + Intergenic
923473362 1:234311702-234311724 CTGTTTGGAAGGAGCCAAGGTGG + Intronic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
924679145 1:246213689-246213711 AAGTGAGAATGGAGCCAGGGAGG - Intronic
924847102 1:247784846-247784868 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
924955031 1:248917858-248917880 CTGTGGGCATAGAGCCAGTGAGG + Exonic
1064283410 10:13971008-13971030 GTGTGGGACAGGAGGCAAGGCGG - Intronic
1064435802 10:15310467-15310489 CTGTGGGAGAGGGGCCAGGTTGG - Intronic
1064630521 10:17306210-17306232 CTGTCGGGAAGGAGGAAGGGAGG - Intergenic
1064652511 10:17523708-17523730 CTGTGGAAAATGGGACAGGGTGG - Intergenic
1065253105 10:23836916-23836938 CTGTGGGAAGGAAGGAAGGGAGG + Intronic
1066046290 10:31598356-31598378 ATGTGGGAGAGAAGCCAGGATGG + Intergenic
1066802628 10:39207775-39207797 CTCAGGGAAAGCAGCCAGGTGGG - Intergenic
1066957652 10:42188344-42188366 CCGTGGGAGAGAAGGCAGGGTGG - Intergenic
1067012677 10:42729108-42729130 CTTTGGGAAAGGAGCTAAGATGG + Intergenic
1067078965 10:43203131-43203153 CTGTGGGATGGGGTCCAGGGTGG - Intronic
1067310912 10:45112760-45112782 CTTTGGGAAAGGAGCTAAGATGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067712949 10:48664878-48664900 CTGTGGGACAGGAAGCAGGCAGG - Intergenic
1067728847 10:48794335-48794357 GCGCTGGAAAGGAGCCAGGGCGG + Intronic
1067936767 10:50619522-50619544 CTGGGGGAGAGGGGCCTGGGGGG + Intronic
1068007642 10:51409287-51409309 CTGGGGGAGAGAAGACAGGGTGG + Intronic
1068447237 10:57138885-57138907 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1068837182 10:61568090-61568112 CTGGGGGAGAGGAGCCAGGGTGG + Intergenic
1069465127 10:68631611-68631633 CTGTGGGGAAAGAGCCAGCAGGG + Intronic
1069593778 10:69657425-69657447 GGGAGGGAGAGGAGCCAGGGAGG - Intergenic
1069790798 10:71019293-71019315 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1070335854 10:75454609-75454631 CTGTGAGCCAGGAGCCTGGGCGG + Intronic
1070338526 10:75475967-75475989 ATGTGGGAAAGAAGGGAGGGCGG - Intronic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070399037 10:76036607-76036629 GTGAGGGAAAGGAGCTAAGGTGG + Intronic
1070610895 10:77931703-77931725 TAGAGAGAAAGGAGCCAGGGGGG - Intergenic
1070652038 10:78244448-78244470 AGATGGGACAGGAGCCAGGGTGG + Intergenic
1070663925 10:78330132-78330154 CTTTGGGAAAAAAGCCAGGAGGG - Intergenic
1070783821 10:79151816-79151838 CTGCGGGATGTGAGCCAGGGTGG + Intronic
1071937720 10:90549566-90549588 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1072360498 10:94654439-94654461 CTGGAGGAAAGAAGGCAGGGTGG - Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072970016 10:100009649-100009671 CTGTGGGCCAGGAGCCCGCGAGG - Intronic
1073290549 10:102411148-102411170 CTGTGGGAAGGGTCCCTGGGAGG - Intronic
1074048326 10:109859927-109859949 CTGAGGGATAGGAGCCAAAGAGG - Intergenic
1074154058 10:110783027-110783049 CTGGGGGAAAGGAGAAGGGGTGG + Intronic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1075411033 10:122228124-122228146 CTGTGGTCAGGGAGTCAGGGTGG - Intronic
1075606818 10:123817689-123817711 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1076366810 10:129926584-129926606 CTGTGGCCAAGTGGCCAGGGAGG + Intronic
1076521782 10:131085749-131085771 CTGTGGGAGGGGAGCAAGTGGGG - Intergenic
1076542680 10:131224097-131224119 CAGGGGGAAAGGAGACAGGAAGG - Intronic
1076629809 10:131845755-131845777 CTGATGGGAGGGAGCCAGGGAGG - Intergenic
1076880016 10:133235568-133235590 CTGGGAGGAAGGAGGCAGGGGGG + Intergenic
1077042341 11:530311-530333 CGGTGTGGAAGGAGCCAGGGTGG + Intergenic
1077062391 11:623638-623660 CGGTGAGAAAGGAGCCGTGGAGG + Intronic
1077118849 11:897667-897689 CTGTGTGAAGGGAGGCTGGGAGG - Intronic
1077475453 11:2788192-2788214 CTGTGGAGAAGGAGCCCAGGAGG - Intronic
1077538241 11:3134605-3134627 CTTTTGGAAAGGAGGGAGGGAGG + Intronic
1078564510 11:12403063-12403085 CTGTGGGGAAGGAGGCAGCGAGG - Intronic
1078617956 11:12882403-12882425 TTGTGGGGAAGGAGACAGGTAGG - Intronic
1079586123 11:22128502-22128524 CAGGGGGAAAGTAGCCAGGAGGG - Intergenic
1080726615 11:34904584-34904606 CTGTTGGAACTGAGCCAGAGAGG - Intronic
1080746265 11:35111329-35111351 CAGAGGGAAAGGAGCCAGCTAGG - Intergenic
1081378319 11:42386208-42386230 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1083187677 11:61026985-61027007 CTGGGGGAAGGGAGCCAGGGAGG - Intergenic
1083278146 11:61609074-61609096 CTGGGGGCATGGAGCCAGAGAGG - Intergenic
1083328629 11:61886396-61886418 CTCTGGGGAAGGGGCCTGGGTGG + Intronic
1083419332 11:62544551-62544573 GGGTGGGAGAGGAGCTAGGGAGG - Intronic
1084361235 11:68669809-68669831 CTGGGGAAAAGGGGTCAGGGTGG - Intergenic
1084631160 11:70351855-70351877 CTGTAGGAACGCTGCCAGGGAGG - Intronic
1084651258 11:70490728-70490750 CTGTGGGAAAGGGCACAGCGTGG + Intronic
1085012064 11:73148124-73148146 CTGTGGGAAAACAGGCAGGCAGG - Intergenic
1085026099 11:73237583-73237605 CTGTGGGAAAGGCTCAAGGGTGG - Intergenic
1085221377 11:74876457-74876479 CTGTTGGAAGTGAGCTAGGGAGG - Intronic
1085685987 11:78622455-78622477 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1086242279 11:84709727-84709749 AAGTGGGAAAGGAGAAAGGGAGG - Intronic
1086278638 11:85160717-85160739 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1086901850 11:92376395-92376417 CAGTGGGAAAGCAGCCTGTGTGG + Intronic
1087158476 11:94926807-94926829 GTGTGGGAACGGCCCCAGGGTGG + Intergenic
1087374049 11:97320816-97320838 CTGGGGGAGAGAAGGCAGGGCGG - Intergenic
1088476954 11:110250423-110250445 CCTTGGGAAAGGAGGGAGGGAGG - Intronic
1088687660 11:112298405-112298427 ATGTGGGAAAGGAGAGAGAGAGG + Intergenic
1089133031 11:116226964-116226986 CAGTGGGAAAGGAGGAGGGGCGG + Intergenic
1089359952 11:117879123-117879145 TGGTGTGAAAGGAGCCAGGGTGG + Intergenic
1089455072 11:118621335-118621357 GCGGGGGAAGGGAGCCAGGGAGG - Intronic
1089666158 11:120021284-120021306 CAGTGGAAAAGGAACCAGAGAGG + Intergenic
1089903639 11:122013877-122013899 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1090119168 11:124006108-124006130 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1090388775 11:126373686-126373708 TTGAGGGAAAGGAGCCAGACAGG - Intronic
1090414219 11:126529432-126529454 CTGTAGGAAAGGAGCCTGATGGG + Intronic
1091051774 11:132379021-132379043 CTGGGGGAGAGAAGTCAGGGTGG - Intergenic
1091354049 11:134922080-134922102 CTGTGGGGAAGGAGAAAGAGAGG - Intergenic
1091808772 12:3377457-3377479 CAGTGAGACAAGAGCCAGGGCGG - Intergenic
1093036369 12:14335949-14335971 CTGTGGGAGAGAAGGCAGGGTGG - Intergenic
1093415982 12:18921622-18921644 TTGTGGGACAGGGGACAGGGTGG - Intergenic
1094525413 12:31227760-31227782 CCATGGAAAGGGAGCCAGGGAGG + Intergenic
1094702342 12:32881918-32881940 CTGTGGGAAAGGAGGCTAGCAGG + Intronic
1094719996 12:33053117-33053139 CTGAGGGCAAGGGGCCAGGAGGG - Intergenic
1094777395 12:33746155-33746177 ATGAGTGAAAGCAGCCAGGGGGG + Intergenic
1095460731 12:42442198-42442220 CTGTAGGAAATCAGTCAGGGTGG + Intronic
1095603887 12:44044590-44044612 CTGAGGGAGAGAAGGCAGGGTGG - Intronic
1095856215 12:46863410-46863432 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1095977881 12:47952129-47952151 CTGTGGGAAAAGGGACAAGGGGG + Intergenic
1096333982 12:50739046-50739068 GAGTGAGAAATGAGCCAGGGAGG + Intronic
1096813215 12:54184724-54184746 GTGTGGGAAAGAAGCTAGGCTGG - Intronic
1097222828 12:57460853-57460875 CTGTGGGCAAGGAGCTCAGGAGG + Intronic
1098749875 12:74279855-74279877 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1099365959 12:81765650-81765672 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1099375681 12:81894223-81894245 CCGTGGGAGAGAAGGCAGGGTGG - Intergenic
1099689808 12:85938286-85938308 CTGGGGGACAGAAGGCAGGGTGG - Intergenic
1100241120 12:92711342-92711364 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100647142 12:96543469-96543491 CTGGGGGTAAGAAGCCAGGAGGG + Intronic
1101437480 12:104676701-104676723 CCTTAGGAAAGGAGGCAGGGAGG - Intronic
1101543101 12:105682901-105682923 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1101816998 12:108152853-108152875 CTTTGGGAGAGAAGCCAAGGTGG + Intronic
1101874952 12:108591786-108591808 CGGTGGGGACGGAGCCAGGATGG - Exonic
1101996289 12:109527629-109527651 CTGTGGCCAAGGAGCAAGGCCGG - Intronic
1102086936 12:110149681-110149703 CAGTGGGAGAAGAGTCAGGGTGG - Intronic
1102597188 12:114001835-114001857 AGGTGGGATAGGAGCAAGGGAGG + Intergenic
1102636730 12:114331179-114331201 TTGAGGGAATGGAGGCAGGGAGG + Intergenic
1102821169 12:115910350-115910372 CTGTGGAAAAAGAGCCTGGCTGG - Intergenic
1102884517 12:116511475-116511497 CTGGAGGCAAGGAGGCAGGGAGG - Intergenic
1103618925 12:122174039-122174061 CTGCAGGGATGGAGCCAGGGTGG - Intronic
1104253312 12:127117229-127117251 CAGAGGGAAAGGAGGCAGTGGGG - Intergenic
1104992171 12:132631869-132631891 CTGTGGGGATGGAGCCTGTGAGG - Intronic
1105705270 13:22964423-22964445 CTGTGAGCAGGGAGTCAGGGCGG - Intergenic
1105924612 13:24996393-24996415 CTGTTGGAAATGAGCTAGAGAGG - Intergenic
1106369520 13:29117900-29117922 ATGAAGGAAATGAGCCAGGGCGG + Intronic
1108302404 13:49091731-49091753 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
1109241644 13:59897163-59897185 ATATGGGAAAAGAGTCAGGGAGG + Intronic
1109712654 13:66180556-66180578 CTGGGGGAAAGAAGACAGGGTGG + Intergenic
1110377197 13:74806735-74806757 CTGGGGGAGAGAAGACAGGGTGG - Intergenic
1111317531 13:86582067-86582089 CTGGGGGAAAGAAGGCAGGGTGG - Intergenic
1112763707 13:102718610-102718632 CTGTGGAAACAGAGCCAGGTTGG + Intergenic
1113091282 13:106619405-106619427 CAGTGGGAAGGGATCCCGGGAGG - Intergenic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113319677 13:109221397-109221419 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1113396168 13:109949798-109949820 CTGGGGGAGAGAAGGCAGGGAGG - Intergenic
1113843531 13:113373437-113373459 CAGAGGGAGAAGAGCCAGGGAGG - Intergenic
1114205898 14:20571034-20571056 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1115130725 14:30049526-30049548 CTGGGGGAAAGAAGGCAGGGTGG - Intronic
1115143431 14:30199639-30199661 CTGTGGGGAAGAAGGCAGGGTGG - Intergenic
1117001631 14:51376578-51376600 CTGGGGGAAAGAAGGCAGAGTGG - Intergenic
1117072380 14:52068732-52068754 CTGCGGGAAAAGTGCCAGGAGGG + Intronic
1117216874 14:53560440-53560462 CTGGGGGAAAGAAGGCAGAGTGG - Intergenic
1118713444 14:68541336-68541358 CTGCTGGAAAGGGGCCAGGTAGG - Intronic
1118776079 14:68974909-68974931 CTGGGGGCCTGGAGCCAGGGTGG - Intronic
1118880742 14:69823755-69823777 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1118917986 14:70123933-70123955 CTGGGGGACCGGAGCCTGGGAGG - Intronic
1118950728 14:70434319-70434341 CTGCGGGAGAGGAGGCAGGGTGG + Intergenic
1119298495 14:73552476-73552498 GCCTGGGAAAGGGGCCAGGGTGG - Intronic
1119302792 14:73584663-73584685 GCCTGGGAAAGGGGCCAGGGTGG - Intergenic
1119691538 14:76676508-76676530 CTTGGGGTAAGGAGCAAGGGAGG + Intergenic
1119728602 14:76937266-76937288 CCCTGGGAAAGGTGGCAGGGAGG - Intergenic
1119889744 14:78173919-78173941 ATGGGGGGAAGGAGCCATGGTGG - Intergenic
1120150812 14:81031691-81031713 CTGTGGGCAAAGTGCCAGGCTGG - Intronic
1120744536 14:88141845-88141867 ATGTGAGAAAGGAGGCAGAGAGG + Intergenic
1120817761 14:88881529-88881551 CTGTGACAAAGGAGATAGGGTGG - Intergenic
1120973732 14:90231098-90231120 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1121815223 14:96923854-96923876 CTGAGGGAAAGGGACCAGTGTGG - Intronic
1122156202 14:99751881-99751903 GGGTGAGAAGGGAGCCAGGGAGG + Intronic
1122412748 14:101534352-101534374 GTGTGGGAATGAGGCCAGGGTGG + Intergenic
1122738893 14:103859512-103859534 GTGGAGGGAAGGAGCCAGGGAGG + Intergenic
1122986204 14:105212775-105212797 CTGTGGGGAAGGACGCAGCGGGG + Intronic
1123910746 15:24964539-24964561 CTTTGGGAAAGAAACCAAGGCGG - Intronic
1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG + Intronic
1124715592 15:32058180-32058202 CAGAGGGAAAGGAGGCAAGGAGG - Intronic
1125736303 15:41928869-41928891 CTGGGGAAAAGGGGGCAGGGAGG - Intronic
1127369882 15:58329920-58329942 CTGTAGGCCAGGAGCCAGGATGG - Intronic
1128113801 15:65093232-65093254 CTGAGGAAGAGGAGACAGGGAGG + Intronic
1128207013 15:65861801-65861823 CTGAGTGAAAGAAGCCAGAGGGG - Intronic
1128220764 15:65966862-65966884 CTCTGGGAAAGAGCCCAGGGTGG - Intronic
1128233001 15:66048521-66048543 TTGTGGGCAGGGAGTCAGGGTGG - Intronic
1128757768 15:70195096-70195118 CTGTGGGAAAGGACCCATGAGGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131397488 15:92098088-92098110 TTGTGGGGAAGGAGCAAGGCAGG + Intronic
1131407978 15:92182229-92182251 ATGTGGGAAAGATGACAGGGTGG - Intergenic
1131425943 15:92345572-92345594 CTTTGGGAAAGGCACCAGGTAGG + Intergenic
1131670429 15:94614200-94614222 CTGTGAGGAAGGACCCATGGAGG + Intergenic
1132517491 16:372594-372616 ATGTGGGTAAGGAGCCGGGCTGG - Exonic
1132648583 16:1010281-1010303 CTGTGGCAAGGGCGGCAGGGAGG + Intergenic
1132785910 16:1656902-1656924 CGGTGGGTAGGGAGCCGGGGCGG - Exonic
1132908849 16:2298283-2298305 CTGGAGGAAGGGAGCCAGGAGGG - Intronic
1133073817 16:3264371-3264393 GGGAGGGAAAGGACCCAGGGCGG + Intronic
1133838809 16:9389846-9389868 CTGTGGGTCAGGAATCAGGGTGG - Intergenic
1134093064 16:11401878-11401900 CTGTGGGAAAGGCACTGGGGGGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1137582258 16:49640634-49640656 CTGTGCCAATGGTGCCAGGGGGG - Intronic
1137718533 16:50613458-50613480 CTGAGGGAGAGGAGCCGGCGGGG - Intronic
1137721755 16:50631638-50631660 GTGTGGGAAGGAAGCCAGGAGGG + Intronic
1137913480 16:52403245-52403267 CTGTGGGGAAGGGGGCACGGCGG + Intergenic
1138532996 16:57645350-57645372 GGGTGGGAAGGGAGCCAAGGAGG - Intronic
1138868407 16:60851048-60851070 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1139306808 16:65993609-65993631 CTGTGCCAAGGGTGCCAGGGAGG - Intergenic
1139361188 16:66401209-66401231 CGGTGGGGGATGAGCCAGGGAGG + Intronic
1140820724 16:78660450-78660472 CAGTGGGAGAGGAGCTGGGGTGG + Intronic
1141093725 16:81148182-81148204 CTGTGGGGAGGGAGTCAGGTTGG + Intergenic
1141220419 16:82064276-82064298 CTGAGTGAAAGAAGCCAGCGTGG - Intronic
1141445570 16:84055604-84055626 CTGAGGGCTGGGAGCCAGGGCGG + Intronic
1141559514 16:84857772-84857794 CTGGGGGAAAGAAGGCAGGGTGG + Intronic
1142006578 16:87692212-87692234 CTGTGGGGAGGGAGACGGGGAGG - Intronic
1142299271 16:89247261-89247283 CTGAGGCAGAGGCGCCAGGGAGG + Intergenic
1142894315 17:2964273-2964295 CTGTGGGAGAGGAGCTGCGGGGG + Intronic
1143020100 17:3913046-3913068 CAGTGGGGAGGAAGCCAGGGAGG - Intronic
1143116099 17:4582615-4582637 CTGAGAAAAAGGAGCCAAGGGGG + Intergenic
1143350078 17:6281489-6281511 CTCTGGGAAAGGAGTCTAGGAGG - Intergenic
1143399893 17:6637303-6637325 CTGTGGAGAAGGAGACACGGTGG - Intronic
1144005824 17:11098052-11098074 GTGTGGGAGAGGAGACAGTGGGG - Intergenic
1144038712 17:11389588-11389610 CTTTGGGAGAGGAGAGAGGGCGG + Intronic
1144577826 17:16440386-16440408 CGGTGGCAGTGGAGCCAGGGTGG + Intergenic
1145062918 17:19743787-19743809 CAGTGGGAATGGATCCGGGGAGG + Intronic
1145997281 17:29111903-29111925 CTGTGGGAAAGGGGCCAGGGTGG + Intronic
1146289899 17:31599442-31599464 CTGAGGGCCAGGCGCCAGGGTGG + Intergenic
1146591758 17:34133502-34133524 CTGTGGGACAGAAGCCCAGGAGG + Intronic
1146637129 17:34514751-34514773 CGGTAGGAGAGGGGCCAGGGAGG - Intergenic
1147645806 17:42033173-42033195 CTGTGGTATAGCATCCAGGGAGG - Intronic
1148213558 17:45822378-45822400 GGGTGGGAAAGGAGACAGGGTGG - Intronic
1148346653 17:46907991-46908013 CTGTGGGAGAGCAGGCTGGGGGG + Intergenic
1148465038 17:47859853-47859875 TTGGGGCAAAGGAGCAAGGGCGG + Intergenic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148720874 17:49752355-49752377 TAGTGGGAAAGAAGCCTGGGGGG - Intronic
1149634614 17:58156883-58156905 CAGTGGGGAATGAGGCAGGGAGG - Intergenic
1150260158 17:63782662-63782684 CTGTGGGAAAGGAGAAACGGGGG - Intronic
1151037781 17:70821332-70821354 ATGGGGGAGAGGAGGCAGGGTGG + Intergenic
1151166729 17:72210016-72210038 CAGAGGGGAAGCAGCCAGGGGGG + Intergenic
1151819751 17:76491115-76491137 CTGTGGGTACGGAGCCAGCAGGG - Intronic
1151914541 17:77107839-77107861 CTTTGAGAAAGGAGCCATGCTGG + Intronic
1152073040 17:78143560-78143582 ATGTGGTAAAGGGGCCACGGTGG + Intergenic
1152128643 17:78462462-78462484 GTGGAGGAAAGGATCCAGGGAGG + Intronic
1152768437 17:82153230-82153252 CTGGGGGAGAGGGGCCAGGCAGG + Intronic
1152820518 17:82435568-82435590 CTGTGGGGAGGAGGCCAGGGAGG - Intronic
1153089741 18:1330423-1330445 CTGGGGGAGAGAAGACAGGGTGG - Intergenic
1154252640 18:12757013-12757035 CTGTAGGAGAGAAGACAGGGTGG + Intergenic
1154486098 18:14872334-14872356 CTGTGGCAAAGGAAACAGAGAGG + Intergenic
1155316608 18:24578035-24578057 CTGTGGGAGAGGAGCTATGCGGG + Intergenic
1157341231 18:46780288-46780310 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1157559536 18:48636836-48636858 CTGTGGGCAGGGAGTTAGGGAGG - Intronic
1158231437 18:55260236-55260258 TGGTGGGAAAAGAGCCAGGCTGG + Intronic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1160054422 18:75465523-75465545 CTGTGGGAGGGGGCCCAGGGGGG + Intergenic
1160188016 18:76690651-76690673 CTGGGTGAGGGGAGCCAGGGAGG - Intergenic
1160220739 18:76975790-76975812 CTGTGGTAAAGCAGGCAGGCAGG + Intergenic
1160309178 18:77772807-77772829 CTGTGAGAGAGGAGCCGTGGAGG + Intergenic
1160785783 19:899725-899747 CTGTGGGTGGGGGGCCAGGGAGG + Intronic
1160939787 19:1614859-1614881 CTGACGGGAAGGGGCCAGGGTGG + Intronic
1161401691 19:4068441-4068463 AGGTGGGAAGGGACCCAGGGAGG + Intergenic
1162777727 19:12990047-12990069 CTGTGGGAAAGGGCCCGGGGAGG - Intergenic
1163115350 19:15185560-15185582 GTGGGGGCAAGGAGCCAGGCGGG + Exonic
1163207713 19:15815708-15815730 CGGTGGGCAGGGAGTCAGGGAGG - Intergenic
1163251135 19:16127048-16127070 CTCTTGCAGAGGAGCCAGGGAGG + Intronic
1163272443 19:16262374-16262396 CTGTGGCAAGGGTGCCTGGGTGG - Intergenic
1163512133 19:17741618-17741640 AGGTGGGAAAGGAGCCTGGGAGG + Intergenic
1163512150 19:17741683-17741705 AGTTGGGAAAGGAGCCTGGGAGG + Intergenic
1163664578 19:18597300-18597322 CTATGGGAAAGCAGCCATTGCGG + Intronic
1163767438 19:19171248-19171270 CTGTGCCAGAGGAGTCAGGGAGG + Intronic
1164117231 19:22234312-22234334 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1164397992 19:27882727-27882749 CTGTTGGAAGTGAGCCAGAGAGG - Intergenic
1164615418 19:29664544-29664566 CTGTGGGGAGGAGGCCAGGGAGG + Intergenic
1164890010 19:31815151-31815173 CTGAGGGAAGTGAGTCAGGGAGG + Intergenic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1165703226 19:37954490-37954512 CAGTGGGGAAGGAGACAGGCTGG + Intronic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1166271394 19:41716438-41716460 GTGTGGAGAAGGAGCCCGGGTGG + Intronic
1166699288 19:44873047-44873069 CTGTGTGAAGAGTGCCAGGGTGG - Intronic
1166783316 19:45353333-45353355 CCCTGGGGAAGGACCCAGGGAGG + Exonic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1167092678 19:47355313-47355335 CTGTGGTACAGGTGCCTGGGAGG + Exonic
1167211266 19:48135623-48135645 CTGTGGGCAGAGTGCCAGGGTGG - Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
1167786889 19:51644537-51644559 AAGTGGGATAGGAGGCAGGGAGG + Intronic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925306035 2:2848901-2848923 GTGGGGGAAGGAAGCCAGGGAGG + Intergenic
926076698 2:9948869-9948891 CTGGAGGAAATGAGCCAGGCTGG + Intergenic
926101904 2:10123147-10123169 AGGCGGGAAAGGAGCCGGGGCGG - Intronic
926287696 2:11502999-11503021 ATGTTGGAAAGGAGAAAGGGAGG + Intergenic
926345486 2:11941192-11941214 CCGTGGGAAAGGGGCCAAAGAGG - Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
927459712 2:23287516-23287538 GTCTGGGAAAGGTGCCAGGAGGG - Intergenic
927720484 2:25378935-25378957 CTGTGGGAAAGGAGCATGGGAGG + Intronic
927992272 2:27456583-27456605 CTGTGGGCAAAGAGCCTGGGAGG - Exonic
928473458 2:31598292-31598314 CGGTAGGAAAGGTGCAAGGGGGG + Intergenic
928481553 2:31689332-31689354 CTGTTGAAAGGGAGCCAGAGAGG + Intergenic
929107787 2:38380918-38380940 CTTTGGGGGAGGGGCCAGGGAGG + Intergenic
929260773 2:39864281-39864303 CTGTGTGAAAGCAGCCAGGAGGG + Intergenic
929393883 2:41500100-41500122 CTGTGGAAAGTGAGCCAGAGAGG - Intergenic
929446201 2:42003274-42003296 TGGTGGAAAAGGAGCCAGGTGGG - Intergenic
929964570 2:46524642-46524664 CTGTGGGCAAGGGGCCAGTCAGG + Intronic
930021058 2:47002560-47002582 CTGAGGGCAGTGAGCCAGGGAGG + Intronic
930536583 2:52652000-52652022 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
930696278 2:54415162-54415184 GTCTGGCAAAGGAGCCAGGTGGG + Intergenic
930938592 2:56985382-56985404 GTGTAGGAAATGAGTCAGGGTGG - Intergenic
931020325 2:58037430-58037452 CTATGGGAAAGGGGGCAGGTGGG + Intronic
931371055 2:61663086-61663108 CTGTGGGAAGTGAGCAAGAGAGG - Intergenic
931423645 2:62151220-62151242 ATGTGAGAGAGGAGCCAGGAAGG - Intergenic
931732540 2:65165923-65165945 CGGTAGGAAAGAAGCAAGGGAGG - Intergenic
931757898 2:65390320-65390342 CTGTCGGGAGGGAGCCGGGGCGG - Intronic
932200080 2:69818443-69818465 ATGTGGGCAAGCAGCCAGGAGGG - Intronic
932777763 2:74538600-74538622 TTGTGGAAAATGAGCCAGAGAGG + Intronic
933694861 2:85210231-85210253 GTGTGGGGAAGGGGCCAGGCAGG - Intronic
933708650 2:85309333-85309355 CTGTGGGCATGGACCCAAGGGGG - Exonic
933750942 2:85601947-85601969 ATGAGGGAGGGGAGCCAGGGTGG + Exonic
934465871 2:94262464-94262486 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
934548183 2:95236050-95236072 CTGTGGGCAAGGAGTCAGGCTGG + Intronic
934738013 2:96699737-96699759 CTGGGGGAAGGGAGTCAGGTGGG + Intergenic
935153939 2:100465698-100465720 ATGTGGGAAAGGCACCAGGGTGG + Intergenic
935564280 2:104589989-104590011 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
936384090 2:112013119-112013141 ATGTGGGCATGGGGCCAGGGGGG - Intronic
936641255 2:114314951-114314973 CTGGGGGAAAGAAGGCAGGGTGG - Intergenic
937065837 2:119016984-119017006 CTGTGAGAAAGGAGCCAGGGAGG - Intergenic
937290754 2:120780402-120780424 CAGTGTGAAAGGAGGAAGGGAGG + Intronic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937582036 2:123498903-123498925 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
937878812 2:126849893-126849915 CTGTATGAAAGGCACCAGGGAGG - Intergenic
938150147 2:128875456-128875478 CTGGGGGAATGGTGCCTGGGAGG - Intergenic
938229460 2:129646001-129646023 CTGTGGACAAGGAGCCATGCTGG - Intergenic
938260607 2:129892658-129892680 CTGTGACAAAGGGGCCAAGGAGG - Intergenic
938791546 2:134680774-134680796 CTGTGGCACTGGAGCCAGAGAGG + Intronic
939619068 2:144395613-144395635 AGGTGGGGATGGAGCCAGGGAGG + Intronic
940605890 2:155924024-155924046 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
942047150 2:172106413-172106435 CTGTCGGCAGGGAGCTAGGGTGG + Intergenic
942277608 2:174334555-174334577 TTGTAGGAAAGGAGGCAGGAGGG - Intergenic
942641667 2:178067078-178067100 ATTTGGGAAAGGAGGGAGGGAGG - Intronic
944495761 2:200306454-200306476 GGGTGGGAAAGGAGCTAGGGAGG + Intronic
944854034 2:203749312-203749334 CTGTGGGACAGGGGACAAGGAGG - Intergenic
944945433 2:204678501-204678523 CAGTGGAAAAGGAGCTAGAGCGG + Intronic
945502102 2:210589091-210589113 ATGGGACAAAGGAGCCAGGGTGG - Intronic
945988350 2:216372182-216372204 CTTTGGGAATCGAGCCAGTGGGG - Intergenic
947520413 2:230841563-230841585 CTGTGGGAAAGGAGCTGTGGAGG - Intergenic
947722447 2:232378266-232378288 CTGTGGGAAAGGGGCACGTGGGG - Intergenic
947925936 2:233922599-233922621 CTCTGGAAAGGGAGACAGGGAGG - Intronic
948272170 2:236683161-236683183 CTGCTGCAAGGGAGCCAGGGTGG + Intergenic
948780826 2:240320621-240320643 CTGTGTGACAGCAGCGAGGGAGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1170973761 20:21141288-21141310 ATGGGGGAAGGGAGGCAGGGAGG + Intronic
1171173477 20:23035061-23035083 CTGAAGGAAAGAAGCCAGGCGGG + Intergenic
1171278463 20:23877932-23877954 CTCTGGGGAACCAGCCAGGGTGG + Intronic
1171993932 20:31717879-31717901 ATGTGGGAAGGGACCCAGGTGGG - Intronic
1172262316 20:33578721-33578743 ATGTGGGAATGGTGCCAGAGTGG - Intronic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1172791757 20:37510733-37510755 CTGGGGCAAAGGCACCAGGGAGG - Intronic
1173800335 20:45891083-45891105 CTCGGGGAAGGGAGTCAGGGGGG - Exonic
1174264701 20:49322977-49322999 ATGGGGGAAAGGAGGCTGGGAGG + Intergenic
1175303881 20:57962595-57962617 CTTTGGGACAGGACCCAGAGTGG + Intergenic
1175466713 20:59194403-59194425 CAGTGAGGAAGGAGCCAGGCTGG - Exonic
1175529894 20:59667341-59667363 CTGTGGCAAAGCAGCCCAGGTGG - Intronic
1175700342 20:61132268-61132290 GTGTGAGAAGGGAGGCAGGGAGG - Intergenic
1176060646 20:63171300-63171322 CTCTGGGAAAGCAGGCAGGGTGG - Intergenic
1176596871 21:8705668-8705690 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1176795209 21:13367044-13367066 CTGTGGCAAAGGAAACAGAGAGG - Intergenic
1177727901 21:24992324-24992346 CTGTTGGAAATGAGCCAGGGAGG - Intergenic
1177913209 21:27056474-27056496 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1177933666 21:27316668-27316690 CTGGGGGAAAGAAGGCAGGGTGG + Intergenic
1178085258 21:29105709-29105731 CTGTGTGGAAGGGGCCAGTGGGG + Intronic
1178320602 21:31602286-31602308 GAGAGGGAAAGGAGGCAGGGCGG + Intergenic
1178436563 21:32564711-32564733 CTAAGGGAAAGGAACTAGGGAGG - Intergenic
1179341629 21:40516391-40516413 TTGGGGGAGGGGAGCCAGGGAGG - Intronic
1179625264 21:42645707-42645729 CTGAGGGCAAGGACCGAGGGAGG - Intergenic
1180061359 21:45386590-45386612 CGGTGGGACAGGAGCCCGGCAGG - Intergenic
1180183455 21:46128179-46128201 CACAGGGAAAGCAGCCAGGGAGG + Intronic
1180279791 22:10683110-10683132 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1180587009 22:16901636-16901658 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1180591119 22:16938103-16938125 CTGTGGGAGAGAAGGAAGGGTGG + Intergenic
1180685635 22:17664418-17664440 GTCTGTGAAAGGAGCCGGGGGGG - Intronic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1181050903 22:20237775-20237797 GGGTGGGAAAGGAGCCAGCTGGG + Intergenic
1181103625 22:20558251-20558273 CTTTGGGAAAGGTGTCAGGAAGG - Intronic
1181112329 22:20609434-20609456 CTGTGGGAAAATAGCCTGAGAGG - Intergenic
1181283974 22:21739140-21739162 GTGTGGGAAAGGGGTTAGGGAGG - Intergenic
1181309800 22:21938414-21938436 ATGCGGGCAGGGAGCCAGGGCGG + Intronic
1181387789 22:22558065-22558087 ATGGGGGAAGGGAGACAGGGTGG + Intronic
1181387804 22:22558101-22558123 ATGCGGGAAGGGAGACAGGGTGG + Intronic
1181387864 22:22558264-22558286 GTGGGGGAAGGGAGACAGGGTGG + Intronic
1181439999 22:22930838-22930860 CTTTGGGACAGGAGCCAGGGAGG + Intergenic
1181513709 22:23400139-23400161 CTGTGGGGCAGGGGCCATGGTGG + Intergenic
1181608746 22:23998785-23998807 CTGTGGGAGAGGACCCAGGTGGG - Intergenic
1181685518 22:24525200-24525222 CCTTGGGAAAGGAGGGAGGGAGG + Intronic
1183457812 22:37932388-37932410 CAGTGGGGAAGGGGCCAGTGTGG - Intronic
1184067397 22:42128496-42128518 CTCTGGGCAAGGAGAGAGGGTGG - Intronic
1184120171 22:42444829-42444851 CCGTGGGAGAGGAGAGAGGGGGG + Intergenic
1184169195 22:42749063-42749085 CTCTGGGAAAGCAGACAGAGCGG - Intergenic
1184516452 22:44965577-44965599 TGCTGGGAAAGGAGGCAGGGAGG - Intronic
1184704525 22:46201478-46201500 CAGTGGGGAAGGGGACAGGGAGG + Intronic
1184820442 22:46905742-46905764 CTGTGGGAAACCAGCAAGGCAGG - Intronic
1185050189 22:48550373-48550395 CTGTGGGAAAGGTGCATGAGAGG - Intronic
1185100652 22:48839253-48839275 CTGTGGGGAAGGGGCCTGGCAGG - Intronic
1185116506 22:48941207-48941229 CTGTGGGATATGAGGCAGGCAGG - Intergenic
1185187865 22:49413660-49413682 CTTTGGGAAAGGAACCCGTGAGG + Intergenic
1185326446 22:50228029-50228051 CTGTGGGCAAAGAGGCTGGGAGG + Intronic
949170010 3:986340-986362 CTGGGGGAGAAAAGCCAGGGTGG + Intergenic
949417559 3:3830623-3830645 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
950025329 3:9816178-9816200 TTGTGGTAAAGGAGCCAGCCCGG - Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950567723 3:13780913-13780935 GGGTCGGGAAGGAGCCAGGGAGG + Intergenic
950773096 3:15327758-15327780 CTGTCACAAAGGAGCCAGGTGGG - Intronic
951003644 3:17593115-17593137 CTGAGGGAGAGAAGGCAGGGTGG - Intronic
951679610 3:25281208-25281230 ATTTGGGAATGGAGCCAGTGGGG + Intronic
951970726 3:28441604-28441626 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
953040316 3:39250489-39250511 CTGTGGGAAGTAAGCCAGGGTGG + Intergenic
953349805 3:42206973-42206995 CACTGGGAAAGAACCCAGGGAGG - Intronic
953367611 3:42359475-42359497 TGGTGGGAAAGGGGGCAGGGAGG - Intergenic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
954371536 3:50171698-50171720 CTGTGGGTGAGCAGCCAGGCGGG + Intronic
954663310 3:52237533-52237555 CTATGGGAAAGGAGGGAGTGAGG + Intronic
955080712 3:55655595-55655617 ATGAGGGAAATGGGCCAGGGAGG - Intronic
955087413 3:55716746-55716768 CTGTGTCACAGGAGTCAGGGTGG - Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
955531748 3:59880297-59880319 ATGAAGGGAAGGAGCCAGGGAGG - Intronic
957320758 3:78627392-78627414 CTGTGGGGAGGGAGTCAGAGTGG + Exonic
958180369 3:90052133-90052155 TTATGAGAAATGAGCCAGGGAGG - Intergenic
958487650 3:94732211-94732233 CTGTGGGAGAGAAGGCAGGGTGG + Intergenic
959997887 3:112698583-112698605 CTGGGGGAGAGAAGGCAGGGGGG - Intergenic
960378684 3:116933832-116933854 CTGTGGGAAATAAGCCAGCAAGG + Intronic
960983511 3:123254583-123254605 CTGAGGGAAACGAGCCAGTAGGG - Intronic
961455647 3:127022640-127022662 CTGTAGGAAGGGGGGCAGGGTGG + Intronic
962281114 3:134052601-134052623 CAGGGAGGAAGGAGCCAGGGTGG - Intergenic
962469590 3:135694141-135694163 CTATGGGAAAGGATCTAGGCAGG + Intergenic
964497888 3:157313676-157313698 CTGTGGGAGAAGACCCAGGCAGG - Exonic
964569226 3:158094549-158094571 CCGTGCGATAGGAGCCAGGTGGG - Intergenic
965226735 3:166000497-166000519 CTGGGGGAGAGAAGGCAGGGAGG + Intergenic
965451119 3:168839969-168839991 TAGTGGGGAAGGAGCCAGGGAGG - Intergenic
965920154 3:173903694-173903716 CTGCGGGCAAGGAGCTATGGAGG + Intronic
966003452 3:174979001-174979023 TTGGGTGAAAGGAGCCAGGAAGG + Intronic
966910363 3:184556203-184556225 CTCTGGGAGAGGGGTCAGGGAGG - Intronic
967579016 3:191129871-191129893 CTGTTGGAAGAGAGGCAGGGAGG + Intergenic
967977731 3:195044776-195044798 CTCAGGGAAAGGAGCCAGGCTGG + Intergenic
967983791 3:195080714-195080736 GTGTGGGAAAGGCGGCAGGGAGG + Intronic
968800211 4:2738382-2738404 CTGGGGGAGAGGAGGCAGGGTGG - Intergenic
968906979 4:3458231-3458253 CTGGGGGAGAGGAGGCAGGGTGG - Intergenic
969011156 4:4063800-4063822 ACGTGTGAAAGGAGCCAGGAGGG - Intergenic
969112417 4:4852155-4852177 CTGGGGGAAAGAGGCAAGGGAGG + Intergenic
969470540 4:7385065-7385087 CTGTGGAGCAGGGGCCAGGGTGG + Intronic
969706786 4:8796945-8796967 CTTTGTGGAAGGAGCCAGTGGGG - Intergenic
970907453 4:21232918-21232940 CTGAGTGAAAGGACCAAGGGAGG + Intronic
971100985 4:23466159-23466181 CTGGGGGAGAGAAGCTAGGGTGG + Intergenic
971380856 4:26096220-26096242 AGGTGGGAATGGAGCCGGGGCGG - Intergenic
972565006 4:40261789-40261811 CTGTAGGAAATCAGTCAGGGTGG - Intergenic
974197241 4:58591440-58591462 CTGTGAGAAAGCAATCAGGGTGG + Intergenic
974262340 4:59542017-59542039 CTGGGGGAAAGAAGGCAGAGTGG + Intergenic
974299101 4:60041560-60041582 GTGTGGAAAAGGAGCCAAGCAGG + Intergenic
974564819 4:63568572-63568594 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
975386688 4:73767246-73767268 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
977103698 4:92852389-92852411 CTGAGGGAAAGGAGCTAGTAGGG - Intronic
977466030 4:97383637-97383659 CTGGAGGAAAGAAGGCAGGGTGG - Intronic
977701705 4:100029624-100029646 CTGTGGGAGAGAAGATAGGGTGG + Intergenic
978341559 4:107725286-107725308 CTGGGGGACAGAAGGCAGGGTGG + Intergenic
978369405 4:108015561-108015583 CTGTGGGGTAGGAGAGAGGGAGG - Intronic
978878151 4:113666969-113666991 CTGTAGTAAGGAAGCCAGGGAGG - Intronic
979767044 4:124474858-124474880 CTGGGGGAAAGAAGGCAGGGTGG - Intergenic
980602230 4:135040283-135040305 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
981039896 4:140213418-140213440 CTGTGGGTCAGGAGTCTGGGTGG + Intergenic
981104622 4:140866422-140866444 GTGTGGGAAAAGAGGCAGGGAGG - Exonic
982902579 4:161025847-161025869 TTGTGGGAAGGGAGACATGGGGG - Intergenic
983062832 4:163177692-163177714 CTGTTGGAAGTGAGCTAGGGAGG - Intergenic
983412866 4:167421183-167421205 CTGTTGGAAGGGAGCCAGAGAGG - Intergenic
983651442 4:170040471-170040493 CTGGGTGGAAGGGGCCAGGGAGG + Intergenic
984926926 4:184815262-184815284 CTGTGAGCAAAGAGGCAGGGAGG + Intronic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985258172 4:188090126-188090148 CTGTGCGACAGGAGTCAAGGCGG + Intergenic
985354449 4:189102766-189102788 CTGTGGGAGGAGAGCCAAGGAGG - Intergenic
985366644 4:189237812-189237834 CTCAGGGAAAGGAGACAGGGTGG - Intergenic
985485509 5:146268-146290 GTGTGGGAAAGGAGGGAGGGGGG - Intronic
986338532 5:6771994-6772016 CTGTGGGAAAGGGACAAGGTGGG + Intergenic
986742951 5:10719769-10719791 CTGTGGGAGAGAAGGCAGGGTGG - Intronic
986938305 5:12918487-12918509 CTGGGGGAGAGAAGTCAGGGTGG + Intergenic
987765657 5:22226046-22226068 CTGTGGGAAAGTAGCTAAAGGGG - Intronic
988160797 5:27516607-27516629 CTGTGGGAGAGAAGGCAGGGTGG + Intergenic
988169169 5:27632574-27632596 CTGGGGGAGAGAGGCCAGGGTGG + Intergenic
988233262 5:28506826-28506848 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
989213981 5:38884820-38884842 CTTTGGCAAGGGAGGCAGGGAGG - Intronic
989486353 5:41996095-41996117 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990371547 5:55124305-55124327 CTGGTGGAAATGTGCCAGGGAGG - Intronic
990646000 5:57845160-57845182 TTGTGGGAAATGAGCCAGAGAGG - Intergenic
990916155 5:60907684-60907706 CTGTTGGGAATGAGCCAGTGGGG - Intronic
991946172 5:71900405-71900427 CTGGGGAAAAGAAGGCAGGGTGG - Intergenic
992143301 5:73820609-73820631 CTGTAGGGTAAGAGCCAGGGTGG - Intronic
992636624 5:78730956-78730978 GTGAGGGGAAGGAGGCAGGGAGG + Intronic
993042727 5:82834057-82834079 CAGTGGGGAAGGAGGCAGGGTGG + Intergenic
993367440 5:87050697-87050719 CTAGGGGAGAGGAGGCAGGGTGG + Intergenic
993926407 5:93871907-93871929 CTATGGGAAAGGAGGAAGGGAGG + Intronic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
995463691 5:112429003-112429025 CTCTGGGAAAGGGGCATGGGTGG + Intergenic
995715554 5:115078896-115078918 CTGTTGGAGATGAGCCAGAGAGG + Intergenic
996323930 5:122251396-122251418 CGGTGGGAAAGGAACCAAGTTGG - Intergenic
997222376 5:132180220-132180242 CTGATGAAAAGGAGCCAGGGAGG + Intergenic
998046668 5:138992487-138992509 CTGTGGAAAAGGAGCCTGCTAGG - Intronic
998065785 5:139157324-139157346 CTGTGGGAAAGGAGAAATTGTGG - Intronic
999331720 5:150678012-150678034 CTGTGCTAGAGGAGCCAGTGAGG + Exonic
999615937 5:153424184-153424206 CTGGGGGAAATGAGACAGGAGGG + Intergenic
1000021465 5:157322627-157322649 TTGTGGGAAAGCAGCCACAGTGG - Intronic
1000139922 5:158392882-158392904 CAGTGTGAAAGCAGCCATGGGGG + Intergenic
1001173629 5:169444908-169444930 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1001306382 5:170576956-170576978 CTGTGGGAAGGGACCCAGCAGGG + Intronic
1001330883 5:170761553-170761575 CTGTGGGAGATGAGTAAGGGTGG + Intergenic
1001552873 5:172617235-172617257 CTGTGGAAAAATAGCCAGTGTGG - Intergenic
1001603849 5:172946311-172946333 CTGTGGGGATGGGGCCTGGGAGG - Intronic
1001705733 5:173740024-173740046 CTGTAGGAGAGGGGTCAGGGAGG + Intergenic
1002471035 5:179436261-179436283 CTGTGGGAACGTGGCCTGGGTGG + Intergenic
1002473046 5:179448699-179448721 CTGTGGGAAAGACCCCGGGGGGG - Intergenic
1002481178 5:179501955-179501977 CTGTGGGAAAGACCCCGGGGGGG + Intergenic
1002997996 6:2305011-2305033 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1003110769 6:3250457-3250479 CTGTGGGAAAGCAGGCTTGGAGG + Intronic
1004401051 6:15288982-15289004 CTGGGGGCAAGGAGCAGGGGTGG + Intronic
1004513664 6:16303418-16303440 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
1004551668 6:16653895-16653917 CTGTGGGAGAGGAGGCAAAGAGG + Intronic
1005229573 6:23684662-23684684 CTGTGGGGTAGGAGCCATGGAGG - Intergenic
1005920617 6:30397573-30397595 GAGAGTGAAAGGAGCCAGGGAGG + Intergenic
1006020110 6:31112751-31112773 GTCAAGGAAAGGAGCCAGGGCGG - Intergenic
1006050221 6:31336516-31336538 CTCTGGGAAAGCAGCCAGAGTGG - Intronic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1006806759 6:36793927-36793949 GCGTGAGAAAGAAGCCAGGGTGG + Intronic
1007315494 6:40985242-40985264 CAGTAGGGAAGCAGCCAGGGTGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008266893 6:49439024-49439046 CTGAGGGAGAGAAGGCAGGGTGG + Intronic
1009660663 6:66606658-66606680 CTGGGGGAAAGAAAACAGGGTGG + Intergenic
1009683505 6:66927387-66927409 CTGTTGAAAATGAGCCAGAGAGG - Intergenic
1010107974 6:72190648-72190670 CTGTGGGGGAGAAGGCAGGGTGG + Intronic
1010275597 6:73965288-73965310 CAGTGGGAAAGGAAACATGGAGG + Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012920767 6:105219280-105219302 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1013273671 6:108562883-108562905 CTTGGGGGAAGGGGCCAGGGAGG - Intronic
1013885457 6:114959514-114959536 CTATGGGAGAGGAGCTAGGTAGG + Intergenic
1014198775 6:118586357-118586379 CTGTTGGAAGTGAGCCAGAGAGG - Intronic
1014275400 6:119382160-119382182 CTGTAGGAGATGGGCCAGGGTGG + Intergenic
1014410875 6:121118760-121118782 CTTTGGGAAAGGAAGCAGGGAGG - Intronic
1014417015 6:121195650-121195672 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1014631672 6:123797063-123797085 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1015765669 6:136713340-136713362 CAGTGGGCAAGGAGTGAGGGTGG + Intronic
1016147299 6:140692451-140692473 CTGTGGGGGAGAAGGCAGGGTGG + Intergenic
1016634462 6:146271468-146271490 CTGTGGAAAAGGAGACAAAGGGG + Intronic
1016909104 6:149179376-149179398 CTATGGGAAGGGAGACAGAGTGG + Intergenic
1017227778 6:152040827-152040849 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
1017388427 6:153911958-153911980 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1017981284 6:159402671-159402693 ATGTGGGAAAGGAAGCAGGGTGG + Intergenic
1018295932 6:162343980-162344002 CTGTGGTAAAGGTGCCAGAGAGG - Intronic
1018803760 6:167242728-167242750 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1019182897 6:170202976-170202998 CTGTGGGAAAGAAGTCATGGTGG + Intergenic
1019416888 7:931960-931982 CTGAGTGCAGGGAGCCAGGGGGG + Intronic
1019437780 7:1030830-1030852 CTGTGGGAAAGCAGGCATGGTGG - Intronic
1019539330 7:1544711-1544733 CTGAGGGTCAGGAGGCAGGGAGG + Exonic
1019695729 7:2445189-2445211 CTTTGGGAAGGGGGCCAGGCAGG + Intergenic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1021988843 7:26123187-26123209 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1022107062 7:27204276-27204298 ATTTGGGAAAGGAGCAAGTGGGG + Intergenic
1023155534 7:37247820-37247842 CTCTGGGAAAAGAGCAAGAGGGG + Intronic
1023846300 7:44122689-44122711 CTGTGGGGAGGGATCCAAGGTGG - Intronic
1023881353 7:44323343-44323365 CTGCTGGAAAGGAGCGAGTGTGG - Intronic
1024230101 7:47357412-47357434 GTGTGTAAAAGGAGGCAGGGTGG + Intronic
1024541059 7:50475494-50475516 CTGTGAGCCAGGAGGCAGGGGGG - Intronic
1024884312 7:54124382-54124404 CTGAGGGAGAGAAGGCAGGGTGG + Intergenic
1026015761 7:66669456-66669478 CTGTGGGATGGGTGGCAGGGAGG + Intronic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1027435127 7:78156293-78156315 ATGTGGGGAAGGGGACAGGGAGG + Intronic
1027685828 7:81278219-81278241 GTGGGGGAAAGAAGGCAGGGTGG - Intergenic
1028141764 7:87282246-87282268 CTGGGGGATAGAAGGCAGGGTGG - Intergenic
1028173662 7:87628695-87628717 ATGTAGGAAAGGAGCCTGGAGGG - Exonic
1028284828 7:88982804-88982826 CTCTGGCAGAGGAGCCAAGGTGG - Intronic
1030355518 7:108538329-108538351 CTGGGGGACAGAAGGCAGGGTGG - Intronic
1030932738 7:115545112-115545134 AGGTGGGAAAGGAGTAAGGGAGG + Intergenic
1031236857 7:119188287-119188309 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1031676587 7:124618627-124618649 CTGGGGGAAAGAAGGCAGGGTGG - Intergenic
1031802482 7:126265307-126265329 CTTTGGGAGAGGAGACAGGCAGG - Intergenic
1032001216 7:128266637-128266659 CAGTTTGAAAGGAGCCAGGCTGG - Intergenic
1032153074 7:129446694-129446716 CTGGGGGAAAGAAGCCAGGGTGG + Intronic
1032436754 7:131907147-131907169 AAGTGGAAATGGAGCCAGGGTGG + Intergenic
1033754217 7:144384676-144384698 GTGTAGGAAAGGAGCCGGGTTGG + Intergenic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034027457 7:147721680-147721702 ATGGGGCAAAGGAGCCAGGAAGG - Intronic
1034286283 7:149885255-149885277 CCTCGGGAAAGGAGCCTGGGAGG + Intergenic
1034327284 7:150248130-150248152 CCCTGGGACAGGAGCTAGGGTGG - Intronic
1034370127 7:150587766-150587788 CTAGGGGAAAAGAGCCAGAGGGG + Intergenic
1034438994 7:151077083-151077105 CAGAGGTAAAGGAGGCAGGGTGG - Exonic
1034466226 7:151231576-151231598 TTGGGGGAGAGGAGCCAAGGAGG - Intergenic
1034765925 7:153721327-153721349 CCCTGGGACAGGAGCTAGGGTGG + Intergenic
1036119901 8:6004492-6004514 CTTTGGGAAAGGTGCAAGGAAGG - Intergenic
1036462186 8:8963297-8963319 CTCTTGGAAAGGAACCAGGCGGG + Intergenic
1036980982 8:13469935-13469957 TTGTGGGAAAATAGCCAGGCAGG + Intronic
1037364560 8:18107998-18108020 CTGGGGGAGAGGGGGCAGGGTGG + Intergenic
1037585108 8:20270673-20270695 GTGTGGGACAGGAGGAAGGGTGG + Intronic
1037756724 8:21715066-21715088 GTGTGGGAAAGCAGCCATGTGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038176519 8:25185440-25185462 CTGGAGGAAAGGGGGCAGGGCGG - Intronic
1039099234 8:33923030-33923052 CCCTGGGAAAAGAGGCAGGGTGG + Intergenic
1039324140 8:36466265-36466287 ATGGGGGAGAGGAGGCAGGGTGG + Intergenic
1039424158 8:37471851-37471873 AAATGGGAAAGGAGCCAGGCAGG - Intergenic
1040536453 8:48315275-48315297 CTGAAGCAGAGGAGCCAGGGAGG - Intergenic
1041906131 8:63035916-63035938 CTATGGGAAAGCAGCAGGGGAGG + Intronic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1043240054 8:77921525-77921547 CTTTGGGAAAGGGGCAAGGGAGG + Intergenic
1044487128 8:92766920-92766942 CTGCGGGAGAGAAGGCAGGGTGG + Intergenic
1044633125 8:94298143-94298165 CTGGGGGAAAGAAGGCAGTGTGG + Intergenic
1047177949 8:122559137-122559159 TTGGGGGGAAGGAGACAGGGAGG + Intergenic
1047317678 8:123749084-123749106 CTGTGGTAAGGTGGCCAGGGAGG - Intergenic
1047340255 8:123974255-123974277 GTCTGGGAAAGGAGACAGGAAGG + Intronic
1047757398 8:127929088-127929110 CTTTGGGACAGAAGCAAGGGGGG + Intergenic
1048134011 8:131728373-131728395 CTGTGGTCAAGCAGCAAGGGAGG + Intergenic
1048850136 8:138637024-138637046 CAGCAGGAAAGGGGCCAGGGAGG + Intronic
1049541329 8:143210504-143210526 CTGTGGGCAGGGAGCGGGGGTGG + Intergenic
1049658732 8:143810297-143810319 CTGGGTGAAGGGTGCCAGGGTGG - Intronic
1049693482 8:143972867-143972889 CTGTGGGCTAGGGGTCAGGGTGG - Intronic
1049927216 9:421032-421054 CCGTGGGGAAGGGGCCAGAGGGG + Exonic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051000436 9:12275370-12275392 AGGTGGGAAAGGAGGAAGGGAGG + Intergenic
1051247880 9:15129938-15129960 CGCGGGGAAAGGAGCCAGTGGGG + Intergenic
1051874631 9:21778194-21778216 TGGTGTGAAAGGAGCCTGGGAGG + Intergenic
1052819636 9:33128662-33128684 GTGTGGGAACGGAGCTTGGGAGG - Intronic
1053036650 9:34832281-34832303 CTGAGGGTTAGGAGCTAGGGTGG + Intergenic
1053942913 9:43270278-43270300 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1054738111 9:68776789-68776811 AAGGGGGAAATGAGCCAGGGAGG + Intronic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057490333 9:95515799-95515821 CTGCGGGAAAAGGGCCAGAGAGG - Intronic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1057929323 9:99179780-99179802 CCGTGGGGAAGGAGCCGGCGAGG - Intergenic
1058590231 9:106557729-106557751 CTCTGAGAATGGAGGCAGGGAGG - Intergenic
1059340298 9:113594205-113594227 GTGGGGGACAGGAGCCAGAGTGG + Intronic
1060302451 9:122383288-122383310 CTTAGGGAAAGGAGTCAGAGTGG + Intronic
1060481572 9:124019175-124019197 CTGTGGGAATGCAGCCCCGGGGG + Intronic
1061147749 9:128809540-128809562 CTCTGGGAGAGGAGACAGGCAGG - Exonic
1061197026 9:129111968-129111990 CGGTGGGGAAGCTGCCAGGGAGG + Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061412931 9:130430919-130430941 CAGAGGGAAAGCAGTCAGGGAGG + Intronic
1061499047 9:130991813-130991835 GTGTGTGAAAGGAGGGAGGGAGG - Intergenic
1061680116 9:132238841-132238863 CTGTGGGCAGGGAACCAGGGAGG - Intronic
1061884562 9:133585079-133585101 CTGTGGCAAGGGGGCCTGGGCGG + Intronic
1061972008 9:134050064-134050086 TTGTGGGAGAGAAGCCAGGGTGG - Intronic
1062003426 9:134228016-134228038 CTGCGGGAGAGCAGGCAGGGAGG + Intergenic
1186279529 X:7977381-7977403 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1186384068 X:9091499-9091521 CTGGGGGAAAGAAGGCAGGGTGG + Intronic
1186469736 X:9811847-9811869 CTGGGGGAGAGAAGACAGGGTGG + Intronic
1186585091 X:10864980-10865002 CTGTGGGAAAGAAGATAGGTTGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187219433 X:17309176-17309198 GTGTGCTAAAGGAGACAGGGAGG - Intergenic
1187604899 X:20872125-20872147 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1188308423 X:28586961-28586983 CTTTTGGAAAGGACCCTGGGAGG - Intergenic
1189154853 X:38746459-38746481 CTGGGGGACAGAAGGCAGGGCGG + Intergenic
1189263125 X:39692198-39692220 GTGTGGGGAGGGACCCAGGGAGG - Intergenic
1189556161 X:42147617-42147639 CTCTAGGAAAGAAGTCAGGGAGG - Intergenic
1190148922 X:47924752-47924774 CTCTGGGAAAGTCTCCAGGGAGG - Intronic
1192213053 X:69139842-69139864 CTGGGGCAGAGGAGACAGGGAGG + Intergenic
1192220127 X:69192069-69192091 CTGGGGGAAAGGGGCAAGGGGGG + Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192452634 X:71253478-71253500 GTGTGGGCACGGGGCCAGGGCGG - Intronic
1192503962 X:71669820-71669842 CTGTGGGACAGCTGCCTGGGTGG - Intergenic
1192661536 X:73047500-73047522 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1193356283 X:80523384-80523406 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1193832979 X:86310363-86310385 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1193957319 X:87878478-87878500 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1194179565 X:90695677-90695699 CTGAGGGAAAGAAGGCAGGGTGG + Intergenic
1194343343 X:92731345-92731367 CTGGGGGAGAGAAGACAGGGTGG - Intergenic
1196175969 X:112639297-112639319 CTCTGGCAAAGGAGCCTGGCAGG - Intronic
1196274766 X:113754161-113754183 CTATGTGAAAGGAACCATGGTGG + Intergenic
1197245700 X:124164162-124164184 CTGTGGGAAAGTAGCCACAAGGG + Intronic
1197508281 X:127336550-127336572 CTTTGGGAAAGAAGTCGGGGTGG - Intergenic
1197591895 X:128419645-128419667 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1198082066 X:133249459-133249481 CTGTAAGAAATGAGCCAAGGGGG - Intergenic
1198237885 X:134753087-134753109 CTGTGGGAAAGGAGGCTTTGTGG - Intronic
1198641252 X:138758570-138758592 CTGTGTGAGAGGAGCCAGATTGG - Intronic
1198934072 X:141888140-141888162 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1199024409 X:142919980-142920002 CTGAGGGAGAGAAGACAGGGTGG - Intergenic
1199718874 X:150527473-150527495 CTATTGGAAAGGTGCCAGGAAGG - Intergenic
1199771162 X:150976208-150976230 CGGTGGGAAAGGAGCCACCGGGG - Intergenic
1199953253 X:152722612-152722634 CTGTGAGGGAGGATCCAGGGAGG + Intergenic
1199956429 X:152745838-152745860 CTGTGAGGGAGGATCCAGGGAGG - Intergenic
1200134603 X:153868780-153868802 CAGTGGCCAGGGAGCCAGGGAGG - Intronic
1200521299 Y:4212287-4212309 CTGAGGGAGAGAAGGCAGGGCGG - Intergenic
1200526225 Y:4277850-4277872 CTGAGGGAAAGAAGGTAGGGTGG + Intergenic
1200651699 Y:5848010-5848032 CTGGGGGAGAGAAGACAGGGTGG - Intergenic
1200812444 Y:7500029-7500051 GTTTGGGAAAGGAGTCTGGGTGG + Intergenic
1201193688 Y:11471157-11471179 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic
1202116154 Y:21470354-21470376 CTGTGGCAAAGGTGACAAGGAGG - Intergenic