ID: 1085715426

View in Genome Browser
Species Human (GRCh38)
Location 11:78868726-78868748
Sequence GCACACTTCCCTTCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085715425_1085715426 13 Left 1085715425 11:78868690-78868712 CCAATATCAGTACAGGTGAGTTT 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1085715426 11:78868726-78868748 GCACACTTCCCTTCCAAAACTGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085715426 Original CRISPR GCACACTTCCCTTCCAAAAC TGG Intronic
901060303 1:6468778-6468800 GCACTCTTCCCTGCCAAGGCTGG + Intronic
901767603 1:11513479-11513501 GCAGACTTCCCATTAAAAACAGG - Intronic
902305718 1:15537349-15537371 GCACACTTCTCTTTAAACACTGG - Intronic
902650459 1:17833891-17833913 CCACCCTTCTCTTCCAAGACAGG - Intergenic
904705385 1:32386371-32386393 GTACACTTCTTTTTCAAAACTGG - Intronic
906038021 1:42765100-42765122 GCAGAATTCTCTTCCAAATCTGG + Intronic
910799067 1:91127824-91127846 ACACACACACCTTCCAAAACAGG - Intergenic
910990381 1:93049721-93049743 GCTTTCTTCCCTTCCCAAACAGG - Intergenic
915255677 1:154627135-154627157 GGAAACTTGCCTTCCAAAAAGGG - Intronic
915861512 1:159449694-159449716 GCACTCTTCACTTCCCAGACTGG - Intergenic
922151886 1:223013440-223013462 GCCCACATCCTTTCCAACACTGG - Intergenic
922925723 1:229345264-229345286 GTACACCTCCCTTACATAACTGG + Intergenic
1067100196 10:43329297-43329319 GCACTCCTCACTTCCCAAACGGG - Intergenic
1067101964 10:43340368-43340390 GCAGAATTCCATTCTAAAACAGG + Intergenic
1071196056 10:83161548-83161570 ACACACTTACATTCCAGAACTGG - Intergenic
1072323494 10:94273739-94273761 GCACACTGCCTTTTCATAACTGG - Intronic
1075782515 10:125026447-125026469 CCACACTTCCCCTCCAACTCCGG - Exonic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1081267391 11:41042532-41042554 GCACACTTCCTTGCCGCAACTGG + Intronic
1083191042 11:61052691-61052713 CCACACTTCCCTTCCTGACCAGG + Intergenic
1083415160 11:62520784-62520806 GGACATTTCCGTTCCTAAACTGG - Exonic
1084443872 11:69192182-69192204 GCACAAATCCTTTGCAAAACAGG + Intergenic
1085715426 11:78868726-78868748 GCACACTTCCCTTCCAAAACTGG + Intronic
1085738686 11:79061332-79061354 TCCCACATCCCTTCCAAGACTGG - Intronic
1086881240 11:92156084-92156106 GCACACTGCCCTTCCCGAAAGGG + Intergenic
1086931018 11:92693193-92693215 GCATACTTCCCCTCCTAAATTGG + Intronic
1087704448 11:101473871-101473893 GGAGACTTCCATTCGAAAACCGG - Intronic
1090556434 11:127881598-127881620 GCCAAGTTGCCTTCCAAAACAGG + Intergenic
1092173344 12:6386531-6386553 GAACACTTCCCTCCCAGAATTGG + Intronic
1093050694 12:14501243-14501265 GCAAACTTGCATTCCCAAACTGG - Intronic
1106193486 13:27474281-27474303 GCTCACTTTTCTTCCAAATCTGG + Intergenic
1107992989 13:45834641-45834663 TGACACCTCCCTTCCAAAGCTGG + Intronic
1108009858 13:45994833-45994855 GCACCTTCCTCTTCCAAAACTGG - Intronic
1112979506 13:105365006-105365028 GAACCCTTCCCTTCCTAAAAGGG + Intergenic
1113339977 13:109412814-109412836 GCTCACTCCCCTTCCCAACCAGG - Intergenic
1121209116 14:92193645-92193667 GGACACTTTCCTTCAAAGACTGG + Intergenic
1123163788 14:106306476-106306498 GCAGACTTCACCTCCAACACTGG + Intergenic
1125122849 15:36183333-36183355 ACACTCTTCCCTTCCAACAGAGG + Intergenic
1128502903 15:68241192-68241214 GGAGACTTCCAGTCCAAAACTGG + Intronic
1128549804 15:68590820-68590842 ACTCACTTCCCTGGCAAAACTGG - Intronic
1128941612 15:71792128-71792150 GCACATTTCCCTGCCCTAACAGG - Intergenic
1129649158 15:77468840-77468862 ACATTTTTCCCTTCCAAAACAGG + Intronic
1129952625 15:79605545-79605567 GAACAATTACCTTCCCAAACTGG + Intergenic
1131045989 15:89315955-89315977 GCCCACTCCCATTTCAAAACTGG + Intronic
1131361254 15:91792557-91792579 GCACTCTGTCCTTCCAAACCAGG - Intergenic
1135195736 16:20392956-20392978 ACACATTCCCCTTCCAAAAATGG - Intronic
1137792524 16:51186921-51186943 AAACACTACCCTTCAAAAACAGG - Intergenic
1139059842 16:63236577-63236599 GTAGACTTTCCTTCTAAAACAGG - Intergenic
1142435713 16:90055675-90055697 CCACACTTCACCTCCAACACCGG - Intergenic
1143462640 17:7114107-7114129 GCACACTTGCCTTTCAAAAATGG + Exonic
1144675350 17:17158240-17158262 CCCCACATCCCTTCCCAAACTGG - Intronic
1146644383 17:34567418-34567440 ACACCCTTCCCTTCCACAGCAGG + Intergenic
1151171539 17:72250483-72250505 GAACACTTCCTTTCCAAGAGGGG - Intergenic
1153165440 18:2256449-2256471 AGACACTTCACTTCCAGAACAGG - Intergenic
1153309469 18:3663904-3663926 GCAGACTTCCCTTCCTAAGGTGG + Intronic
1155216051 18:23643931-23643953 GCACTCTTAGCTTCCAAAACTGG + Intronic
1156381346 18:36564195-36564217 GCACACAGCCTCTCCAAAACAGG - Intronic
1161105772 19:2443282-2443304 GCTGACTTCCCTTCCCCAACAGG - Intronic
1164217323 19:23161264-23161286 GCACTCCTCACTTCCTAAACGGG + Intergenic
1165776932 19:38410175-38410197 GAACACTTCCCTGCCCAGACTGG + Intronic
1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG + Intronic
928266504 2:29816634-29816656 CCAGACTTTCCTTCCAACACTGG - Intronic
930242675 2:48952755-48952777 TCACACATTCTTTCCAAAACAGG + Intergenic
932161603 2:69465438-69465460 GCACCCTTCCCTTCAAAATCAGG - Intronic
933869074 2:86549391-86549413 GCACTCCTCCCTTCCCAGACGGG + Intronic
936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG + Intergenic
938100719 2:128496327-128496349 GCAGATTTCCCTTCCAAATGGGG + Intergenic
942888454 2:180957878-180957900 GAACACTTTTCTTCCAAAAGTGG - Intergenic
944967076 2:204947018-204947040 GCAGACTGCCCTTCCCAAAGTGG - Intronic
945201477 2:207286078-207286100 GAAAGCTTCCATTCCAAAACAGG + Intergenic
948096992 2:235343396-235343418 GCAAACATCACTTCCAGAACTGG - Intergenic
1170948159 20:20910398-20910420 GCAAACTGCCCCTCCAAATCAGG - Intergenic
1171159734 20:22910337-22910359 CAACCCTTCTCTTCCAAAACAGG - Intergenic
1176374196 21:6079134-6079156 GCACACTTCCTTGCAAAATCCGG - Intergenic
1179036632 21:37763611-37763633 GGACAATGCCCTTCCCAAACAGG + Intronic
1179542185 21:42090331-42090353 GCACAGTTCCCTTCCAGAGCAGG - Exonic
1179749280 21:43459111-43459133 GCACACTTCCTTGCAAAATCCGG + Intergenic
1184406092 22:44301707-44301729 GCACATTACTCTCCCAAAACAGG + Intronic
951396883 3:22179663-22179685 GAACCATTCCCTTTCAAAACTGG - Intronic
953155071 3:40362386-40362408 GCATACTTCCATTCTAAAAATGG + Intergenic
955810590 3:62783922-62783944 GCACACTTACATTACAAAAATGG + Intronic
956239506 3:67113998-67114020 GCACACATCCCTTCCACTAGGGG + Intergenic
957010878 3:75004943-75004965 GCAGAATTCCCTTTGAAAACTGG - Intergenic
958406115 3:93760782-93760804 GCACACCTCACTTCCCAGACTGG + Intergenic
962056026 3:131872528-131872550 GCAGACTGCCCTTCCTAAAGTGG - Intronic
963246304 3:143066850-143066872 GCCAACTTGCCTTCCAAAAATGG + Intergenic
965593420 3:170383831-170383853 GCCCACCACCCTTCCAAAGCAGG - Intronic
967974112 3:195021874-195021896 GCACTCTCCCCTTCCAACAGGGG + Intergenic
975526861 4:75360534-75360556 TCACAGTTCCCTGCCCAAACAGG + Intergenic
977242555 4:94590746-94590768 GCACACTTCCCTGCCTAGCCTGG - Intronic
981543422 4:145870299-145870321 GCACACTTCCCTTCCCTTCCTGG + Exonic
982576418 4:157116006-157116028 GCACAGTTTCATTTCAAAACAGG - Intronic
984305540 4:177984646-177984668 GCACATTTCCATTCAAAACCTGG - Intronic
984316782 4:178139687-178139709 GCTCACCTCCCTTCCAAAGCTGG - Intergenic
984565215 4:181321862-181321884 GCACACTGTCTTTCCATAACAGG + Intergenic
988025638 5:25684973-25684995 GCAGACTACCCTTCCAAATGTGG - Intergenic
988249566 5:28738702-28738724 CCAAAATTCCCTTCCAAAAGGGG - Intergenic
988495220 5:31739219-31739241 GCACACATGCCTTCCAAAAAAGG - Intronic
992541548 5:77770484-77770506 GAACACTTCACTGCTAAAACTGG - Intronic
999549643 5:152672285-152672307 GCACACATCTCTTCCACAAAAGG - Intergenic
1000833739 5:166132005-166132027 GCACACCTCCCAGCTAAAACGGG - Intergenic
1002270931 5:178071382-178071404 TCACACTTCCCTTCTATAGCAGG - Intergenic
1002519760 5:179785732-179785754 ACACACTTCCCATACAAAGCAGG + Intronic
1002956007 6:1865578-1865600 GCTCACTTCCCTACCAAACAAGG + Intronic
1004879649 6:19995234-19995256 GCTTTCTTCCCTTCCAAACCTGG - Intergenic
1005567271 6:27108969-27108991 GCACACTTCCTATACAAAATAGG + Intergenic
1006428968 6:33983507-33983529 GCAGATTTCCCATCCAAATCTGG - Intergenic
1008457253 6:51725396-51725418 AAACACATCTCTTCCAAAACAGG - Intronic
1009314184 6:62197147-62197169 GAAGACTTCCCTTCAAAAATGGG + Intronic
1011571304 6:88738862-88738884 ACACACACCCCTTCCAAAACAGG + Intronic
1013669777 6:112387613-112387635 TCACACTGCCCTTCCCGAACAGG - Intergenic
1013926321 6:115477114-115477136 GAACAATTCCCTTTGAAAACCGG - Intergenic
1014324525 6:119975875-119975897 GCAGACTTGCCTTCCTAACCTGG + Intergenic
1015165885 6:130199512-130199534 GTACACATCCCTTCCAAATAGGG + Intronic
1015333985 6:132014106-132014128 GCACAATTCCTTTAGAAAACTGG - Intergenic
1015682063 6:135819323-135819345 TAAAACTTCCCTTCCAAAAAGGG - Intergenic
1019117453 6:169776689-169776711 CCACAGTGCCCCTCCAAAACAGG - Intronic
1019370802 7:661462-661484 GCACAGTTCCCCACCACAACGGG + Intronic
1021774239 7:24036290-24036312 TCAAAATTCCCTTCCTAAACGGG - Intergenic
1023089943 7:36608247-36608269 GCACACTTACCTTCCCCGACAGG + Intronic
1024584693 7:50832057-50832079 GCACACTGCCCTTCAAAAAGAGG - Intergenic
1026340459 7:69430051-69430073 GCACTCCTCCTTTCCAAAGCAGG - Intergenic
1026595784 7:71733134-71733156 GCACCCCTCCCTTGCAAGACTGG - Intergenic
1026875122 7:73874979-73875001 GGACACTGCCCTTCCACACCTGG - Intergenic
1027636216 7:80678289-80678311 GCACATTTTCTTTCCAAAGCTGG + Intronic
1028407868 7:90495855-90495877 GCACATTTCCCTTGCAACATTGG - Intronic
1031257659 7:119476409-119476431 GCATACTTCCCATCAAAAAAGGG - Intergenic
1034909127 7:154978379-154978401 CTACACTTCCCTTCCCAAAAAGG + Intronic
1035062160 7:156077373-156077395 CCAGGCTCCCCTTCCAAAACTGG + Intergenic
1037032043 8:14119635-14119657 GCAGCATTCCCTTCAAAAACTGG - Intronic
1037511281 8:19585917-19585939 GCACAGTTCCATTGCAAATCTGG - Intronic
1038165934 8:25085104-25085126 GCACACTGCCCTGCCTAGACTGG - Intergenic
1040637470 8:49291567-49291589 GCACAGGTGCCTTACAAAACTGG - Intergenic
1041360340 8:57046352-57046374 GCACAGTGCCTTTCCAATACAGG - Intergenic
1041788868 8:61668665-61668687 TCACACTTGCCATCCAAAAAAGG + Intronic
1046834349 8:118782881-118782903 AGACACTGCCCTTCTAAAACAGG - Intergenic
1048457475 8:134591269-134591291 GCACACTCTACTTCCAACACTGG - Intronic
1050418003 9:5434677-5434699 GCACACCTCACTTCCCAGACGGG - Intronic
1050418022 9:5434751-5434773 GCACACCTCACTTCCCAGACAGG - Intronic
1052643393 9:31199361-31199383 GCACACTTTCCATCCAAATTAGG - Intergenic
1062206249 9:135339048-135339070 ACACCCTTCCCTTCCACAACAGG + Intergenic
1185818225 X:3176530-3176552 GTTCACTTCACTTCCCAAACTGG - Intergenic
1186186715 X:7027426-7027448 TCACACTTCACTTGCAAAGCAGG + Intergenic
1186790779 X:12996315-12996337 GCACACTTTCCTTCTTAAAGTGG + Intergenic
1188164554 X:26845885-26845907 GTTCACTTGCCATCCAAAACAGG + Intergenic
1195898685 X:109774398-109774420 ACACAGTTCCCTTCCACAACTGG - Intergenic
1196194969 X:112829877-112829899 ACACACATCCATTCCAAAAGAGG + Intronic
1197220590 X:123909550-123909572 GGACACTTCACTTCCAAGTCAGG + Exonic
1201743145 Y:17344600-17344622 GCACACTTCCCAGCTAAAGCAGG - Intergenic
1201763706 Y:17561998-17562020 GCCCTCTTCCCTTCCAACAGAGG + Intergenic
1201837847 Y:18343992-18344014 GCCCTCTTCCCTTCCAACAGAGG - Intergenic