ID: 1085715654

View in Genome Browser
Species Human (GRCh38)
Location 11:78870955-78870977
Sequence GGTCTTAGTAGAGCCCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085715654_1085715660 28 Left 1085715654 11:78870955-78870977 CCCGGGTGGGCTCTACTAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1085715660 11:78871006-78871028 GGCCACCCCCCACCAACCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 169
1085715654_1085715659 7 Left 1085715654 11:78870955-78870977 CCCGGGTGGGCTCTACTAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1085715659 11:78870985-78871007 TATATAACTAATTTAGGAGTTGG 0: 1
1: 0
2: 0
3: 26
4: 219
1085715654_1085715657 1 Left 1085715654 11:78870955-78870977 CCCGGGTGGGCTCTACTAAGACC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1085715657 11:78870979-78871001 CTTCCGTATATAACTAATTTAGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085715654 Original CRISPR GGTCTTAGTAGAGCCCACCC GGG (reversed) Intronic
900399628 1:2467637-2467659 GGTCTTGGCTGAGCCCACCTGGG - Intronic
905863439 1:41364757-41364779 GGTTTTGGCAGAGACCACCCAGG + Intronic
908551534 1:65213577-65213599 GCTCTTGGTAGAGCTCACCTAGG - Intronic
912496854 1:110097466-110097488 GGTATGGGTAGAGCCAACCCAGG + Intergenic
912752622 1:112298394-112298416 TGTTTTAGCAGAGCCCACGCTGG + Intergenic
921115454 1:212086597-212086619 GCTCATAGTTGAGCCCAGCCTGG - Intronic
921254681 1:213328818-213328840 GCACTTAGTAGGGACCACCCTGG - Intergenic
1070805166 10:79266618-79266640 GGTCTCGCTAGAGCCAACCCTGG + Intronic
1071916972 10:90303897-90303919 GGTCTTAGTGCATCCAACCCTGG + Intergenic
1074975023 10:118572941-118572963 GGCCTTTGTAGAGGCCAGCCAGG - Intergenic
1075802672 10:125162111-125162133 GGGCTCAGTTCAGCCCACCCAGG - Intergenic
1076892285 10:133291171-133291193 GGTCTCAGGAAAGCACACCCCGG - Intronic
1080990878 11:37533274-37533296 GGTCTTATTGGACCCCACCCAGG - Intergenic
1085715654 11:78870955-78870977 GGTCTTAGTAGAGCCCACCCGGG - Intronic
1088928783 11:114328175-114328197 AGTCTTAGTACAGCCCAGCACGG + Intergenic
1096477567 12:51917734-51917756 GGTCTCCTTAGAGCCCACTCTGG - Intronic
1097846595 12:64372808-64372830 GGACTTAGTAGAGCCTGGCCAGG - Intronic
1098284865 12:68896605-68896627 GTTCTTTCCAGAGCCCACCCAGG - Intronic
1113807289 13:113117331-113117353 GGTCTTTGCAGATCCCTCCCAGG - Intronic
1114617887 14:24077815-24077837 GGGCTTGGTAGAGCCCAACTAGG + Intronic
1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG + Intronic
1139403110 16:66697197-66697219 AGTCTGAGTCAAGCCCACCCTGG - Intergenic
1139662451 16:68430278-68430300 GGCCTTAGAAAAGCCCACCACGG + Intronic
1141142799 16:81507981-81508003 GCTTTTAGTAGAGCCCACTTGGG + Intronic
1142167461 16:88600029-88600051 GGTCTCAGCCGAGCGCACCCTGG - Intronic
1142961554 17:3555068-3555090 GGTCCTAGGAGAGCCCAGCAGGG + Intronic
1143526971 17:7478824-7478846 GGTCTGGGTAGGGCCCTCCCTGG - Intronic
1152403441 17:80083100-80083122 GGTCTCTGTGGAGCCCACCCTGG - Intronic
1152442356 17:80316666-80316688 GGTCTTAGGAGACCCTGCCCAGG + Intronic
1152640912 17:81448854-81448876 GGTCCAGGTGGAGCCCACCCTGG - Intronic
1163478434 19:17540193-17540215 GGTCTTTGTAGGGGCCACCTTGG - Intronic
1164430889 19:28187772-28187794 TCCCTTTGTAGAGCCCACCCAGG - Intergenic
929879845 2:45826071-45826093 AGTCAAAGTAGACCCCACCCAGG + Intronic
934952999 2:98592081-98592103 GGTCTTGGAAGAGCCATCCCAGG - Intronic
943114262 2:183646663-183646685 GGTCTCAGTAGGCCCCAACCAGG - Intergenic
943663402 2:190583666-190583688 GGACTTGGTAGAGCTCAACCAGG + Intergenic
1175638329 20:60604027-60604049 CTTATTAGTAGAGTCCACCCTGG - Intergenic
1179258173 21:39736017-39736039 GGTCTTAGACGAGCCCACAGAGG - Intergenic
1179271715 21:39856586-39856608 GGTTTCTGTAGAGCCCACACTGG + Intergenic
1185376321 22:50484131-50484153 GGTCCTGGAAGCGCCCACCCAGG + Exonic
954369023 3:50160664-50160686 GGGCTGAGTCGACCCCACCCAGG - Intronic
954929685 3:54270610-54270632 GAACTCAGCAGAGCCCACCCAGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961348130 3:126278209-126278231 GGTCTTAGGAGTGTCCTCCCTGG + Intergenic
962425061 3:135262370-135262392 GGTGTTAGGAAAGCCCCCCCTGG - Intergenic
968481150 4:833613-833635 GGTCGGAGCAGAGACCACCCTGG + Intergenic
973784541 4:54322886-54322908 GGGCATGGGAGAGCCCACCCAGG + Intergenic
981640921 4:146942847-146942869 GGTCTTTGAAGAGTTCACCCAGG + Intronic
982162955 4:152588182-152588204 GGTCTTGGTAGATCGCAGCCTGG - Intergenic
985573695 5:663999-664021 GGGCTGAGCAGAGCCCATCCAGG - Exonic
985817468 5:2137417-2137439 TGTCTTAGTAAATCCCATCCAGG + Intergenic
989278167 5:39612107-39612129 GAACTTAGTAGAGCCCAGCAAGG - Intergenic
989554298 5:42774315-42774337 GATCTTAGTAGAGCTCTCACAGG - Intronic
997401135 5:133603584-133603606 GGTCTTTGTAGAGACTAACCAGG + Intronic
999288598 5:150408744-150408766 GGTCTTAGTAGTCCCACCCCTGG - Intronic
1001159213 5:169299601-169299623 GGACTAAGAGGAGCCCACCCCGG + Intronic
1013371698 6:109476694-109476716 GGTGTTGGTAATGCCCACCCTGG + Intronic
1014535828 6:122611312-122611334 GGTCTTCGTAGAGCTCCCCGGGG + Intronic
1031866998 7:127048385-127048407 GGTCAGAGTAAAGCCCACCAGGG - Intronic
1034196557 7:149252774-149252796 GGTCCTGGTGGTGCCCACCCAGG + Exonic
1034552903 7:151832604-151832626 GGTCCCAGCACAGCCCACCCTGG + Intronic
1038422843 8:27444457-27444479 GGTCTTAGCTGAGCACAGCCTGG - Intronic
1038480898 8:27901329-27901351 GGGGTTAGCAGAGGCCACCCTGG + Intronic
1048720536 8:137319334-137319356 GGTGTTAGTGGAGCCCACTCAGG - Intergenic
1052111732 9:24593887-24593909 GGTCTTTGTAGAGCTCATCAAGG - Intergenic
1053299586 9:36939396-36939418 GGTCTCAGCAGGGCCTACCCAGG - Intronic
1188043786 X:25402274-25402296 GTTCTTAGTAGAGTCAACCAGGG + Intergenic
1190491836 X:50990294-50990316 GGTGATGGTAGAGCCCACCTTGG + Intergenic