ID: 1085726547

View in Genome Browser
Species Human (GRCh38)
Location 11:78960015-78960037
Sequence TTCTAAGGTACCCTGATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085726547_1085726550 1 Left 1085726547 11:78960015-78960037 CCTAAAATCAGGGTACCTTAGAA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1085726550 11:78960039-78960061 TTGCTCCATCACTGGCAAAATGG 0: 1
1: 0
2: 1
3: 15
4: 227
1085726547_1085726554 12 Left 1085726547 11:78960015-78960037 CCTAAAATCAGGGTACCTTAGAA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1085726554 11:78960050-78960072 CTGGCAAAATGGGGAAACTGAGG 0: 1
1: 0
2: 3
3: 84
4: 638
1085726547_1085726552 3 Left 1085726547 11:78960015-78960037 CCTAAAATCAGGGTACCTTAGAA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1085726552 11:78960041-78960063 GCTCCATCACTGGCAAAATGGGG 0: 1
1: 0
2: 3
3: 33
4: 266
1085726547_1085726551 2 Left 1085726547 11:78960015-78960037 CCTAAAATCAGGGTACCTTAGAA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1085726551 11:78960040-78960062 TGCTCCATCACTGGCAAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 200
1085726547_1085726549 -7 Left 1085726547 11:78960015-78960037 CCTAAAATCAGGGTACCTTAGAA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1085726549 11:78960031-78960053 CTTAGAAATTGCTCCATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085726547 Original CRISPR TTCTAAGGTACCCTGATTTT AGG (reversed) Intronic
903123544 1:21232638-21232660 TTCTAGGTTATCCTGATTTAAGG + Intronic
904595278 1:31640539-31640561 TTCTAAGAGTCCCTGATTTCTGG - Intronic
907086519 1:51680351-51680373 TTCTAAGAAAACATGATTTTTGG + Intronic
908179689 1:61591615-61591637 TTCTAGGGAACCCTCACTTTAGG + Intergenic
910352478 1:86314256-86314278 TTCTTAGTTACCATCATTTTGGG - Intergenic
916636017 1:166669491-166669513 CTCTAAGGTACCTTGATGTCTGG + Intergenic
919487321 1:198160187-198160209 TTCTCAGGTACCCTGAATGGTGG - Intronic
921160096 1:212466493-212466515 TTCTTAGCAACCCTGCTTTTGGG + Intergenic
1064735183 10:18374923-18374945 TACTAAAGTACCCTGTCTTTAGG - Intronic
1065132745 10:22638786-22638808 TTCTAAGGCACCATGATTTTTGG - Intronic
1065927672 10:30449906-30449928 ATCTATGGTACCTTGAGTTTAGG - Intronic
1067066688 10:43107828-43107850 TTTTAAGATACCCTGCATTTTGG - Intronic
1069639849 10:69947630-69947652 TTCTAGGTTGCCCTGATTGTGGG + Intronic
1071731804 10:88255705-88255727 TTCAAGGGCACCATGATTTTGGG + Intergenic
1073666285 10:105537915-105537937 TTCTAAGACTCCCTGATTCTTGG + Intergenic
1074174801 10:110987424-110987446 ATCTATGTTTCCCTGATTTTTGG + Intronic
1075603439 10:123787638-123787660 TTCAAAGGGACCAAGATTTTGGG + Intronic
1081592101 11:44430806-44430828 TTCTAAGTTTTCCTGATTTCAGG + Intergenic
1082257576 11:50049371-50049393 ATTTAAAGTACCCTGATTTTTGG - Intergenic
1084878790 11:72154702-72154724 TCCTAAGGTACCCTTCTTTATGG + Intergenic
1085219085 11:74858252-74858274 ATCTATGGTCCACTGATTTTCGG + Intronic
1085726547 11:78960015-78960037 TTCTAAGGTACCCTGATTTTAGG - Intronic
1086217235 11:84398481-84398503 TTATAAGGTACCCAGTTTTCAGG - Intronic
1090978850 11:131698909-131698931 TTCTAACTTACCTTGATATTGGG + Intronic
1091809038 12:3379614-3379636 TTCTATGGGATCCTGATGTTGGG + Intergenic
1092299213 12:7229220-7229242 TTCTCAGGTACCCTATTTTATGG - Intergenic
1093738794 12:22656715-22656737 TTATAAGAGACCCTGATTTGGGG - Intronic
1094350935 12:29524012-29524034 TTCTCAGTTACCATTATTTTAGG + Intronic
1094696881 12:32828533-32828555 TTCTAGGGTACCCTAATTTCAGG - Intronic
1097255007 12:57666466-57666488 TTCTCAGTTACCATCATTTTAGG - Intergenic
1097537267 12:60888557-60888579 TTCTAAGCTAGTGTGATTTTGGG + Intergenic
1098986198 12:77014987-77015009 TTCTAACAGAACCTGATTTTTGG + Intergenic
1099425244 12:82515698-82515720 CTCTAATGTACAGTGATTTTAGG - Intergenic
1102343441 12:112142048-112142070 TTCTAATGTATCCTGAATGTTGG + Intronic
1108870397 13:54977249-54977271 TTCAAAAGTGCCCTGTTTTTGGG + Intergenic
1108907034 13:55488848-55488870 TTCTAAGTTACCCAATTTTTTGG + Intergenic
1111847219 13:93526223-93526245 TTCTAATGCACCCTGATGTATGG - Intronic
1113968405 13:114168275-114168297 CTCTCAGTTACCATGATTTTGGG + Intergenic
1115613463 14:35070901-35070923 TGGAAAGGTACCCTGATATTTGG + Intronic
1117516791 14:56509914-56509936 TTCTAAGGTACTGTGAGTTAGGG + Intronic
1120654509 14:87173033-87173055 TTCTTATGTACTCAGATTTTAGG - Intergenic
1121589253 14:95088723-95088745 TTCTAAGGAACCCTGAGTGAGGG - Exonic
1121895705 14:97645231-97645253 TTATAAGGTACACTGCTTTGAGG - Intergenic
1124921642 15:34032711-34032733 TTCTAGGGTAGACTGCTTTTGGG - Intronic
1126893187 15:53228520-53228542 TTCTAATCTCCCCTTATTTTTGG - Intergenic
1127125681 15:55809470-55809492 TTCTCAGTTGACCTGATTTTTGG - Intergenic
1127467621 15:59259516-59259538 CTCTCAGTTACCCTCATTTTGGG + Intronic
1128904918 15:71458228-71458250 TTCTAAGTTCATCTGATTTTTGG - Intronic
1140767296 16:78172192-78172214 TTTTTAGGTACCCTCATATTAGG - Intronic
1141346544 16:83251791-83251813 TTGCAGGGTACCCTGATTTTGGG - Intronic
1146132829 17:30293015-30293037 TTCTAAGGAACTCTGATATCTGG + Intergenic
1148436814 17:47692064-47692086 TTCTAAGGTGCCCTGAGGGTTGG - Intergenic
1149154527 17:53610713-53610735 TTCTCAGTTACCATCATTTTGGG - Intergenic
1149514591 17:57270790-57270812 TTATAAGGTCCCCTGATGATGGG - Intronic
1150794957 17:68229551-68229573 TTTTAAGGTACCTCGCTTTTGGG - Intergenic
1155112611 18:22731297-22731319 TCCTAAGTTACCCTGCTTTCTGG - Intergenic
1156279943 18:35627390-35627412 TTCTAAAATAAACTGATTTTAGG + Intronic
1157786463 18:50487799-50487821 CTCTCAGTTACCATGATTTTGGG - Intergenic
1158162743 18:54503977-54503999 TTCCAAGTTACCTTGATTCTTGG - Intergenic
1159013805 18:63084848-63084870 TTCTGAGATAGCCTGAATTTGGG - Intergenic
1160138574 18:76297257-76297279 ATCTAAAATGCCCTGATTTTTGG + Intergenic
1167807220 19:51796385-51796407 TTCTAAGTTACCCTTATCTTAGG - Intronic
924976113 2:177099-177121 TTCTGAGATACACTGAATTTAGG - Intergenic
926657909 2:15429112-15429134 TTCTCAGGTGTCCTGATTTGTGG - Intronic
926773925 2:16403548-16403570 TTCTAAGGTACCAGGATGTCAGG + Intergenic
939843240 2:147213700-147213722 TTCTAAGATACCCTGCTTTCTGG - Intergenic
941432034 2:165424723-165424745 TTCTAAAGACCCCTGTTTTTTGG + Intergenic
942513926 2:176731680-176731702 TTCTAAAGTACCTTTAATTTTGG + Intergenic
944053914 2:195503257-195503279 TCCGAAGGAACCCTGCTTTTTGG - Intergenic
944963361 2:204901544-204901566 TTCTAGGGTTCCCTGATTCCAGG - Intronic
1169179454 20:3550650-3550672 TTTTTAGGTACACAGATTTTAGG + Intronic
1170427491 20:16249401-16249423 TTCTATGGTACACTGCTCTTTGG - Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1170993639 20:21329803-21329825 TTCTTAGGCACCTTTATTTTAGG + Intronic
1172411162 20:34724174-34724196 CTCTTAGGTATCCTCATTTTAGG - Intronic
1177077159 21:16590192-16590214 TTCTAAGCTATCCTTATTTCTGG + Intergenic
1177676344 21:24305721-24305743 TTATAAGCTACCCAGATTATCGG - Intergenic
1178186827 21:30231771-30231793 TTCTAAGGCACTGTGCTTTTAGG + Intergenic
1179325355 21:40337733-40337755 TTCTAAGAGACCTTGCTTTTAGG + Intronic
1184079418 22:42208366-42208388 TTCTAAAGTACCAGGATTATAGG - Intronic
1184440892 22:44514043-44514065 TGATAAGGTTTCCTGATTTTAGG + Intergenic
1184997911 22:48223778-48223800 TCCCAAGGCACCCTGATCTTGGG + Intergenic
951688788 3:25373884-25373906 GTGTGAGCTACCCTGATTTTTGG - Intronic
952044677 3:29304337-29304359 TTCTAAGTTAAACTGATATTTGG + Intronic
954181518 3:48884769-48884791 TTATAAGGTACCAAAATTTTGGG + Intronic
955578702 3:60395390-60395412 TTCAAAGGCACCCAGCTTTTAGG + Intronic
955883907 3:63577343-63577365 TTATAGAGTACCCTGAATTTAGG + Intronic
957444853 3:80302920-80302942 TTGTAACCTTCCCTGATTTTTGG + Intergenic
958801903 3:98765691-98765713 GTTTTAGGGACCCTGATTTTAGG + Intronic
959274081 3:104255257-104255279 TTCTAAGGTTTCAGGATTTTTGG - Intergenic
961156369 3:124683154-124683176 TCCTAAGGTACCCTTGTGTTTGG - Intronic
962728949 3:138261870-138261892 TTCGTAGGGACCTTGATTTTGGG - Exonic
967536024 3:190604407-190604429 TGTTAAGGTAGCCTGATTCTTGG + Exonic
974523212 4:63012582-63012604 CTCTTAGTTACCATGATTTTGGG - Intergenic
979623740 4:122824682-122824704 TGCCAAGGTACCATTATTTTTGG - Intergenic
980484164 4:133432651-133432673 GACTATGGTACCCAGATTTTTGG + Intergenic
984599258 4:181707175-181707197 TTTCCAGGTAACCTGATTTTGGG - Intergenic
984984653 4:185316165-185316187 TTCTTAACTATCCTGATTTTTGG + Intronic
985235027 4:187863071-187863093 GTCTAAGGCACCATCATTTTGGG - Intergenic
987018408 5:13844791-13844813 TTCGAAGGTACGGTGATTGTTGG + Intronic
987255874 5:16150385-16150407 TTCTAAGGTGGATTGATTTTTGG - Intronic
988972848 5:36487215-36487237 TTCTAAGGTAGACTAATTTTAGG + Intergenic
991322485 5:65389981-65390003 TTCTAAGACACTGTGATTTTGGG - Intronic
991477814 5:67042164-67042186 TTCTAATGTACCCTGGTTGTGGG + Intronic
992880537 5:81105121-81105143 TCTTAAGATACCCTGATTGTGGG + Intronic
994677820 5:102847152-102847174 GTCTAAGGTACTCAGATTTCAGG + Intronic
995282328 5:110350376-110350398 TTCTATGGTACATTCATTTTTGG + Intronic
995629690 5:114119687-114119709 TTCTAAGAAGCCCTCATTTTGGG + Intergenic
995799938 5:115983110-115983132 TTCTAAGGTGCCATGATAATTGG + Intronic
995865624 5:116686877-116686899 CTCTAAGGTATGGTGATTTTGGG - Intergenic
995916052 5:117246204-117246226 TTCTAAGGTAACATGAATTAAGG + Intergenic
996696221 5:126398384-126398406 TTCTAATTTACCCAGTTTTTTGG + Intronic
997088014 5:130824041-130824063 TTGTAAGGTACCCAGATGTTTGG - Intergenic
998682633 5:144487338-144487360 TTCTCAGGACCCTTGATTTTTGG - Intergenic
998776040 5:145603764-145603786 TTCTGAGGTGGACTGATTTTAGG + Intronic
1004728022 6:18329649-18329671 TTCAAAGGAACCATTATTTTTGG - Intergenic
1005469834 6:26152077-26152099 CTCTAAGGTACCCTGAGTGGTGG - Intergenic
1007445908 6:41905823-41905845 TTCTCATGCACCCTGATCTTAGG - Exonic
1009716233 6:67400108-67400130 TTCTTAGTTACCCTTATATTAGG - Intergenic
1010313592 6:74418542-74418564 TTCTAAGGTCACCAGTTTTTGGG + Intergenic
1012032831 6:94094479-94094501 TTCTTAGAGACCCTGATTTTGGG - Intergenic
1012769632 6:103414974-103414996 TCCTAAGGTACTCAGATCTTTGG - Intergenic
1013412609 6:109895065-109895087 CTCTCAGTTACCATGATTTTGGG - Intergenic
1013766669 6:113582118-113582140 TCCTGAGATACCCTTATTTTTGG + Intergenic
1016336282 6:143008415-143008437 TTCTCAGCCACTCTGATTTTGGG + Intergenic
1017085518 6:150709520-150709542 ATCTAAGGTTCCATGATTTGGGG - Intronic
1026444820 7:70474966-70474988 CTCTAGGGTAACCTGATTCTGGG - Intronic
1027968887 7:85051075-85051097 ATCTAAGTTACCCTTGTTTTTGG + Intronic
1035868441 8:3110490-3110512 TTCTAAGGTCTTCAGATTTTAGG - Intronic
1036506155 8:9358325-9358347 TTCTAAGGTACTATGAATTTTGG - Intergenic
1041840390 8:62263656-62263678 TTCTAATGTCATCTGATTTTTGG - Intronic
1042758980 8:72251136-72251158 TTCCAAATTGCCCTGATTTTAGG + Intergenic
1043411093 8:79996408-79996430 TTATAAGATACCCTCATTTATGG - Intronic
1046145068 8:110147857-110147879 TTCAAAGATACCCTGCTTTTAGG - Intergenic
1047342762 8:123999011-123999033 TTCTCAGGGCCCCTGATTTCAGG - Intronic
1050265179 9:3882388-3882410 TTCTCTGATACCCTGATGTTGGG - Intronic
1050599676 9:7237894-7237916 AGCTAAGGAACCCTGATCTTAGG - Intergenic
1052598122 9:30588109-30588131 TTCTAAGGTACTATGATTATGGG - Intergenic
1055030953 9:71770770-71770792 TTGTAAGCTACACTGAGTTTGGG + Intronic
1059159404 9:112019774-112019796 TTATAATGTGCACTGATTTTGGG + Intergenic
1060071103 9:120548464-120548486 TTTGAAGGTGCCCTGACTTTTGG - Intronic
1061084469 9:128391022-128391044 ATCTATGCTACCCTCATTTTGGG - Exonic
1188177952 X:27017666-27017688 GTCAAAGGTAGCCTGATTTTTGG + Intergenic
1190059384 X:47201093-47201115 TTCTCAGCTACCCAGGTTTTGGG + Intronic
1192861027 X:75070507-75070529 TTTTAAGGTACCCTTACTGTTGG - Exonic
1192940605 X:75908144-75908166 CTCTTAGGGTCCCTGATTTTAGG - Intergenic
1195951948 X:110284443-110284465 TCCTTAGCTACCCTGATGTTAGG - Intronic
1199308669 X:146297441-146297463 TTCTTGGGTCCCCTGATTCTAGG - Intergenic
1201417688 Y:13763780-13763802 TCCTAAGGTATCCTGTTTTGGGG + Intergenic