ID: 1085730173

View in Genome Browser
Species Human (GRCh38)
Location 11:78991187-78991209
Sequence CTGTCCTGCCCAAAATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085730171_1085730173 13 Left 1085730171 11:78991151-78991173 CCGGCACTGAATACACTGAAGCT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1085730173 11:78991187-78991209 CTGTCCTGCCCAAAATCCCAGGG 0: 1
1: 0
2: 1
3: 24
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085730173 Original CRISPR CTGTCCTGCCCAAAATCCCA GGG Intronic
900029184 1:358691-358713 CAGTTCTGCCCAAATTCCAAAGG + Intergenic
900049786 1:587463-587485 CAGTTCTGCCCAAATTCCAAAGG + Intergenic
900395506 1:2451697-2451719 CTGTCCTGCCCCCATTACCAGGG - Intronic
901801925 1:11713266-11713288 CTGTCTTGCCCAAGGTCACACGG + Intronic
901868904 1:12126067-12126089 CTGTCCTCCCCAAGGCCCCAAGG - Intronic
902290046 1:15429460-15429482 CTTCCCTGCCCATGATCCCACGG - Exonic
902892392 1:19453731-19453753 CTGTCCCGCCCAGAATAGCAGGG + Intronic
903136534 1:21313156-21313178 CTCACCTGCCCACAATGCCAAGG + Intronic
903259723 1:22124872-22124894 CTGTCCTGCCCCACCTCCCCAGG - Intronic
903557062 1:24201705-24201727 CTCTCTAGCCCAAAAGCCCATGG - Intergenic
903656819 1:24954626-24954648 CTGTCCTGGGGAGAATCCCAGGG - Intronic
904298476 1:29539214-29539236 ATTCCCTGCCCCAAATCCCATGG + Intergenic
904586507 1:31583885-31583907 CTTCCCTTCCCAAAATACCAAGG - Intronic
905349075 1:37332025-37332047 CTGTCCTCCCTAACACCCCACGG + Intergenic
905894426 1:41535792-41535814 GTGTCTTGCCCAAAGTCACAAGG + Intronic
906666428 1:47625398-47625420 CTCTCCTCCCTAAAATCCCTTGG + Intergenic
906912777 1:49972993-49973015 CTAACCTGCCCAAGATCACATGG + Intronic
910106889 1:83641451-83641473 CTGTCTTCCCTAACATCCCAGGG + Intergenic
912214584 1:107593522-107593544 CTGTCCAACCCAGTATCCCAAGG + Intronic
915146589 1:153799302-153799324 ATGACCTGCCCAAAGTCCCATGG - Intergenic
919469430 1:197959913-197959935 TTGACCTGCCAAAAATCCCAAGG - Intergenic
920611060 1:207438379-207438401 CTAGCCTGCCCCATATCCCAGGG - Intergenic
922912767 1:229231498-229231520 ACGTCCTGGCCAAGATCCCAGGG - Intergenic
923687864 1:236166338-236166360 GTGTCTTGCCTAAAATCCCGTGG + Intronic
924181723 1:241445771-241445793 CTGTTCTGCCCACAAGGCCATGG - Intergenic
924213635 1:241795994-241796016 CTCTGCCTCCCAAAATCCCAGGG - Intronic
1067881773 10:50052113-50052135 CTGTGCTTCCCAGAGTCCCATGG + Intergenic
1069949871 10:72011380-72011402 CTGTCCTTCCCCAAACCCCAAGG - Exonic
1069961788 10:72083480-72083502 CTGTCCTACCCTAAGCCCCAAGG - Intronic
1071112759 10:82179776-82179798 CAGTCCTTTCCAAAACCCCAAGG - Intronic
1071412137 10:85407338-85407360 CTGTCCTGCCCCAATTCCCAGGG + Intergenic
1071491068 10:86136752-86136774 ATCTCCTGCCAACAATCCCAGGG + Intronic
1072441726 10:95463009-95463031 CTATCCCACCCTAAATCCCAGGG + Intronic
1074359577 10:112814308-112814330 CTGTCCAGCTTAAAACCCCACGG - Intronic
1075898393 10:126018339-126018361 CTTTCCTGCCCCCAACCCCATGG - Intronic
1076483170 10:130798090-130798112 CTGTCCTGCCCAGCCTCCCTGGG - Intergenic
1079641516 11:22810946-22810968 CTCTCCTGCCCAAAATGTTATGG - Intronic
1079818667 11:25095341-25095363 TTGTACTGCCCATAATCCCCAGG + Intergenic
1081673445 11:44954644-44954666 CTGTCAGGTCCAAAATCCCTGGG - Intergenic
1083996712 11:66276600-66276622 CTGTCCTGCCCAAGAACTGAGGG + Exonic
1084968258 11:72755670-72755692 CACCCCTCCCCAAAATCCCAAGG + Intronic
1085730173 11:78991187-78991209 CTGTCCTGCCCAAAATCCCAGGG + Intronic
1088820125 11:113449394-113449416 CTCACCTGCCCAATTTCCCAGGG - Intronic
1091267527 11:134282462-134282484 CTGTCCTTCTCAAAATGCCCTGG + Intronic
1095247493 12:39939948-39939970 CTGGCATGCCCAGAGTCCCATGG + Intronic
1096738113 12:53672117-53672139 CTCTCCTGCCCCATATCCCTTGG - Intronic
1098146743 12:67505199-67505221 GTCTCTTGCCCAAGATCCCACGG + Intergenic
1101246553 12:102889174-102889196 TTATCTTGCCCACAATCCCAGGG + Intronic
1101848524 12:108383393-108383415 ATGTCTTGCCCTAGATCCCATGG + Intergenic
1102007754 12:109599283-109599305 CTGTCTTGCCCAAGGTCACATGG - Intergenic
1102159322 12:110755813-110755835 CTGTCCTGCTCAGCATCCCCTGG - Intergenic
1102236797 12:111298756-111298778 CTGCCCTCCCCAAGCTCCCAGGG + Intronic
1102348725 12:112176436-112176458 CTGTCCTGCCTGATACCCCAGGG + Intronic
1102978119 12:117221042-117221064 CAGACCTCCCCAAGATCCCATGG + Intronic
1104077809 12:125405928-125405950 CTGTCCTGTCCAAACTCTGATGG - Intronic
1104374210 12:128249787-128249809 CTGTCCTGCCCAAATGCCACCGG - Intergenic
1105579461 13:21680952-21680974 GTGTCCTCTCCAAAACCCCAGGG + Intronic
1111374056 13:87354967-87354989 ATGTAATCCCCAAAATCCCATGG + Intergenic
1115328044 14:32164712-32164734 CTATCCTGCCCATACTCCCCAGG + Intergenic
1118214308 14:63793993-63794015 ATGTCCTGCCTGAAATACCATGG + Intergenic
1119479946 14:74952966-74952988 GGGTCCTTCCCCAAATCCCAAGG + Intronic
1120205554 14:81583356-81583378 CTGTCCTGTGCAATCTCCCATGG + Intergenic
1122241441 14:100370740-100370762 CTATACTGCCCAAAGTGCCAGGG - Intronic
1126893960 15:53237835-53237857 CTGTCCTATCCAAAATCTCGTGG - Intergenic
1127383122 15:58446604-58446626 CTGTGCTGCCCACCGTCCCATGG + Intronic
1128943463 15:71806738-71806760 CTGACCTGCCAAAGAACCCAGGG + Intronic
1133437367 16:5791455-5791477 CCCTCCTGGCCAAGATCCCAGGG - Intergenic
1134231234 16:12432190-12432212 CTGGGCTGCCAAAAAGCCCAAGG - Intronic
1136186044 16:28589558-28589580 CTGCCCTCCCAACAATCCCATGG + Intronic
1136500291 16:30666717-30666739 CTGCCTTGCCCAAGGTCCCATGG - Intronic
1137028447 16:35500846-35500868 CTCACCTGCCCTCAATCCCAGGG - Intergenic
1137243907 16:46687506-46687528 TAGTCCTTCCCAAAATCCCCAGG + Intronic
1138333964 16:56237605-56237627 CTGTGCTTCCCAAAAACACATGG - Intronic
1140378308 16:74463268-74463290 GTGACCTGCTCAAACTCCCAGGG - Intronic
1140884075 16:79227432-79227454 CTGACCTGGCCAAAGTCACAGGG - Intergenic
1141687482 16:85578585-85578607 CTGACTTGCCCAGCATCCCAGGG + Intergenic
1142180619 16:88667662-88667684 CTGTCCAGGCCAAACCCCCAGGG - Intergenic
1142231727 16:88903291-88903313 AGGTCCTGCCCAACATCTCAGGG + Intronic
1142559539 17:801888-801910 CTGTCCTGCCTGAAACCACAGGG - Intronic
1142716490 17:1749800-1749822 CTGTGCTGCCCCAAAGTCCATGG - Intronic
1143722102 17:8819565-8819587 CTGTCCTGCACAACATCCCTGGG - Intronic
1144515264 17:15913106-15913128 CTCTGCTGCCCAGAAGCCCATGG + Intergenic
1144729693 17:17519334-17519356 CTCTCCTCCCCAAAATCCAGGGG + Intronic
1144797627 17:17903095-17903117 CTTTGCTGCCAAAAGTCCCAAGG + Intronic
1146163686 17:30572816-30572838 CTGCCCTGCCCACCACCCCAAGG + Intergenic
1147885744 17:43683303-43683325 CTGGCCTGCCCACAACCCCAGGG + Intergenic
1150324782 17:64247986-64248008 CTGTCTTGCCCAAATGCCCTAGG - Intronic
1150982036 17:70153671-70153693 CTGACCTTCACAAAATGCCATGG + Intergenic
1152219077 17:79051035-79051057 CTCTGCTGGCCAAATTCCCATGG + Intergenic
1152222662 17:79077538-79077560 CTGACCTGCCCCAAAGCCCCAGG - Intronic
1152386803 17:79979696-79979718 CTGTCAGGCCGCAAATCCCACGG + Intronic
1152550096 17:81025209-81025231 CTGCCCTGCCCAAAACCACTTGG + Intergenic
1152950574 17:83227865-83227887 CAGTTCTGCCCAAATTCCAAAGG - Intergenic
1153097073 18:1419318-1419340 CTGAGCTGCCCACTATCCCAAGG + Intergenic
1154274304 18:12946888-12946910 CATTCCTGGCCAAAATCCAAAGG + Intergenic
1157434580 18:47657709-47657731 CTGTCCTGCCCAGCTTTCCATGG + Intergenic
1158322886 18:56282661-56282683 GTGCCCTGCCCATATTCCCAGGG + Intergenic
1160422184 18:78754811-78754833 CTGTCCTGCCCCAGGTCACATGG + Intergenic
1160828505 19:1091687-1091709 CTGGCCTGGCCCAAAGCCCAAGG + Intronic
1160982672 19:1823515-1823537 CTCTCCTGCCCACATGCCCACGG + Intronic
1161741938 19:6026686-6026708 CTGTCCTGTCGCAAATCCCAGGG + Intronic
1161977936 19:7616407-7616429 CAGTCCTGCCCAAGACCCCTCGG - Intronic
1161984599 19:7646637-7646659 CTGGCCTTCCCAGGATCCCAGGG + Intronic
1162351113 19:10150301-10150323 CTGTCCTGCCCATCATCCCCTGG + Intronic
1163847086 19:19643842-19643864 TTGTGCTACCCCAAATCCCACGG + Intergenic
1164713013 19:30372378-30372400 CTGGCCTCAGCAAAATCCCAGGG - Intronic
1167211888 19:48138711-48138733 CTTTCCTGCCCAACAATCCATGG - Intronic
1167775036 19:51549145-51549167 GTGTCCTGGCCAACATCCAAGGG + Intergenic
925262352 2:2539754-2539776 CTGTCCTCACCAAACTCCCAGGG + Intergenic
926214959 2:10900417-10900439 CAGTCCTGCCCAAAATCAAGAGG - Intergenic
928228402 2:29475391-29475413 CTCTCCTGCCCAAGGTCACACGG + Intronic
928791999 2:34968625-34968647 TTGTCATTCCCAAAATCCTAGGG - Intergenic
930544757 2:52752639-52752661 CTGCCATGCCTAAAATCCCCCGG + Intergenic
930658143 2:54027367-54027389 CTGTCCTGCCCTGTATCCCAGGG + Intronic
937033236 2:118758615-118758637 CTTTTCTGCCCATTATCCCAGGG - Intergenic
938068406 2:128293917-128293939 CAGTCCTGCTGAACATCCCAGGG + Intronic
939272369 2:139956638-139956660 CTGACTTGCCCAAAGTCACACGG + Intergenic
940306082 2:152228124-152228146 CTCTCCTGGACAGAATCCCAAGG - Intergenic
942600982 2:177640852-177640874 CTGTCCTACCCAGAAATCCATGG + Intronic
944933115 2:204540705-204540727 CTGTCCTGCTTAAAATCCTTTGG + Intergenic
945319872 2:208408786-208408808 ATATTCTGCCCACAATCCCATGG - Intronic
946303260 2:218839006-218839028 CTCTCCTTCCCAGAGTCCCAGGG + Intergenic
946783960 2:223222590-223222612 CTTTCCTGCCCCTTATCCCAAGG + Intergenic
947743259 2:232494598-232494620 CTGTCCAGCCCACAGCCCCAGGG - Intergenic
948689887 2:239695320-239695342 CTGTCCTGCCCCAGCTCACATGG + Intergenic
1169181712 20:3574804-3574826 CTGTCCTGGTCATTATCCCAAGG - Intronic
1171894698 20:30748771-30748793 ATGTTCTTCCCAAAATCACAGGG + Intergenic
1172025226 20:31943808-31943830 CTGTCCTGCCCATGAGCCCAGGG - Exonic
1172106181 20:32518537-32518559 CTCTCCTGCCACACATCCCACGG - Intronic
1172873620 20:38150934-38150956 CTTACCTGCCCAAAATTCCAAGG + Exonic
1173008860 20:39162986-39163008 CTATCCTCATCAAAATCCCAAGG + Intergenic
1174268414 20:49348632-49348654 CTCACTTGCCCAAAATGCCACGG - Intergenic
1174871453 20:54186380-54186402 CAGTCCTGCCTGAAGTCCCAGGG + Intergenic
1175127876 20:56765938-56765960 GTATCCAGCCAAAAATCCCAGGG + Intergenic
1175279570 20:57794063-57794085 CTGGCCTGCCAAGAAACCCAGGG - Intergenic
1175624981 20:60482523-60482545 CTCTCCTGCCCTCGATCCCATGG + Intergenic
1176366981 21:6039240-6039262 CTGTCCTGCCCACCCACCCACGG - Intergenic
1178445162 21:32633284-32633306 CACTCCTGCCCTAAATCCCTTGG + Intronic
1179449167 21:41456344-41456366 CTGGCAAGTCCAAAATCCCAGGG + Intronic
1179727839 21:43350287-43350309 CTGTCCTCCCCAAAAGTCCTGGG - Intergenic
1179756537 21:43499306-43499328 CTGTCCTGCCCACCCACCCACGG + Intergenic
1179838148 21:44051285-44051307 CTGTCCTGCCCTAATTCCTCCGG - Intronic
1179874524 21:44261415-44261437 CTGTCCTGCCCCTCATCCCTGGG - Intronic
1181754728 22:25015737-25015759 GTGTCCTACCCTACATCCCATGG + Intronic
1183346287 22:37310130-37310152 CAGTCCTGCCCAGAACCCCCAGG + Intronic
1184277574 22:43418897-43418919 CTCTCCTGCCTGAAAGCCCATGG - Intronic
950777936 3:15366466-15366488 CTGGCCTGCCAATAATCCCGTGG + Intergenic
952544478 3:34404112-34404134 ATGTCCTGCCCACAATCAAAAGG - Intergenic
953109428 3:39919299-39919321 CTCTCCTGCTCTAAAGCCCAAGG + Intronic
954644033 3:52119867-52119889 CTGGCCTTCCCAATAACCCAGGG - Intronic
956304641 3:67810528-67810550 CTGTCTTGCCCAAAGTCACTTGG - Intergenic
956785283 3:72637296-72637318 CTCTCCTGCCTAAAACTCCAGGG + Intergenic
966164112 3:176997915-176997937 CAGACCTGCCCCAAAGCCCAAGG + Intergenic
966242732 3:177772763-177772785 CAGACCTCCCTAAAATCCCAAGG - Intergenic
969185228 4:5469557-5469579 CTGTCCTGCCCACTGGCCCATGG - Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
969872053 4:10110754-10110776 CTGTCCAGCCCCAAATGCCAGGG - Intronic
969978539 4:11130231-11130253 AGGTCCTACCCAAAGTCCCAGGG + Intergenic
972342242 4:38162480-38162502 CTGTCCGGCCCAAAAGCCTTAGG - Intergenic
976860770 4:89663449-89663471 CTGATCTGCCCAACATACCAAGG - Intergenic
977172562 4:93781273-93781295 CTGTGCTCCCCAGATTCCCAAGG + Intergenic
979288266 4:118951176-118951198 CTGTGCTGCTAAAAATACCACGG + Intronic
981099669 4:140816296-140816318 CTGGCCTGCCCAAAATTAAATGG - Intergenic
984791809 4:183621861-183621883 CTGTGCTGTCCAAAATGTCAAGG + Intergenic
984887360 4:184461952-184461974 CAGTCCTGCCCCACATCCCCAGG + Intronic
987778184 5:22396672-22396694 TTGTTCTGCCCAAACTCCAATGG + Intronic
989115753 5:37950919-37950941 CAGTCCTCCACAAAAGCCCAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991119589 5:62995426-62995448 CTGTCCTCCCCTAAACCTCATGG - Intergenic
991411097 5:66346630-66346652 GTGTCTTGCCTAAAATCCCATGG + Intergenic
992007466 5:72491927-72491949 CTGTACTGGCCAAAACCCCTGGG + Intronic
992588792 5:78271692-78271714 CTCTCTTGCCCAAATTCCTAAGG + Intronic
996458545 5:123713861-123713883 CTGTAGTGCCCATAATCCCCAGG + Intergenic
997508073 5:134434172-134434194 CTCTCCTGCTCAAAATCCTTGGG - Intergenic
997560698 5:134843957-134843979 ATGACTTGCCCAAAATACCATGG + Intronic
999122116 5:149217648-149217670 CTGCCCAGCCCACCATCCCAGGG + Intronic
1000641634 5:163709851-163709873 CTCTCCAGCCCAAAGCCCCAAGG - Intergenic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001560117 5:172663544-172663566 CAGCCCTGGCCCAAATCCCATGG - Intronic
1001669256 5:173460467-173460489 CTTTCCTTCCAAAAGTCCCATGG + Intergenic
1001977595 5:176012958-176012980 CTGCCCTGACCCAAATCACAAGG - Intronic
1002239826 5:177830808-177830830 CTGCCCTGACCCAAATCACAAGG + Intergenic
1002744806 5:181461680-181461702 CAGTTCTGCCCAAATTCCAAAGG - Intergenic
1003959857 6:11198848-11198870 CTGTTCTGCCCCATATCCCATGG - Intronic
1006744461 6:36331497-36331519 CTGAGCTGCCCAAAGTCCCAAGG - Intronic
1007325147 6:41053797-41053819 CTGTCCTCGCCAAACTCCCTGGG - Intronic
1009985838 6:70780110-70780132 CAGTCCTGCCCACAATCTCAGGG + Intronic
1011017064 6:82768603-82768625 CTGCCCTGCCCAAATCACCAGGG - Intergenic
1012803347 6:103863754-103863776 CCATCTTGCCCAGAATCCCAGGG - Intergenic
1013662168 6:112308858-112308880 CTGTCCTGCCCCAATACTCAAGG + Intergenic
1017168329 6:151431336-151431358 CTCTCCTGCCTAAATTTCCACGG - Intronic
1018034609 6:159871563-159871585 CTGTTTGGCCCAAAATACCAGGG + Intergenic
1019249717 6:170735221-170735243 CAGTTCTGCCCAAATTCCAAAGG - Intergenic
1019701858 7:2477982-2478004 CTGTCCTGCCCCCAGCCCCAGGG + Intergenic
1019889794 7:3937269-3937291 CTGTTCTGCCCACATTCCCAGGG - Intronic
1020078567 7:5274515-5274537 CTGTCCTTCCCAAGACCCCCAGG - Intronic
1020435278 7:8155716-8155738 CAGGCCTGAGCAAAATCCCATGG - Intronic
1022406318 7:30093546-30093568 CTAACATGCTCAAAATCCCATGG - Intronic
1022475242 7:30705760-30705782 CTGTCCTGGGCAGAAACCCATGG + Intronic
1023907286 7:44531702-44531724 CTGCCCCTCCCCAAATCCCAGGG + Intronic
1024354050 7:48396209-48396231 ATGGCCTGCACAACATCCCAAGG - Intronic
1024968260 7:55044607-55044629 CTGCCCTGCCCAAATGCCAAGGG - Intronic
1026832245 7:73617379-73617401 CTGCCATGCCCAGAATCCCAGGG + Intronic
1027169792 7:75863527-75863549 CTGTCCTCTCCAAAATGCAATGG + Intronic
1027993858 7:85398204-85398226 CTGTCCTGCCAAAAATATAAGGG + Intergenic
1029519345 7:101050325-101050347 CTGTCCTGCCCCAAATGCCTAGG + Intronic
1032252616 7:130271095-130271117 CTGTGCTGCCCACAAAGCCAGGG + Intronic
1032749767 7:134827067-134827089 CTGTCCACTCCAAAATCACATGG - Intronic
1033345696 7:140524063-140524085 CTGCCCTGGCCAGAATCCCCTGG - Intronic
1035498379 8:72435-72457 CAGTTCTGCCCAAATTCCAAAGG + Intergenic
1035566001 8:641839-641861 CTGTGCTGGCCAAAACCCCACGG + Intronic
1036665874 8:10737863-10737885 CAGTCAAGCCCTAAATCCCATGG - Intronic
1036700166 8:11008145-11008167 CTGTCCTGCTCAAATACCCTCGG + Intronic
1036765899 8:11549176-11549198 CTGCCCTGCCTAACAGCCCAGGG - Intronic
1036788607 8:11703632-11703654 TTTGCCTTCCCAAAATCCCAGGG - Intronic
1037383913 8:18317489-18317511 CTATCTTTCCCAGAATCCCAAGG + Intergenic
1038033055 8:23661643-23661665 CTCTCCTCCCCAGAATTCCAGGG + Intergenic
1038077191 8:24089692-24089714 ATTTCCTGCCCAAAATGCCATGG + Intergenic
1038357184 8:26840256-26840278 CTGTGCTGACCAAATGCCCAGGG - Intronic
1038665756 8:29536198-29536220 CTCTCCTAGCCAAAATCTCAGGG - Intergenic
1040565761 8:48565222-48565244 CTGTCCAACCCAAAGTCCCAAGG - Intergenic
1040999067 8:53431872-53431894 CTGTCCTTCCCAACATCACGAGG + Intergenic
1041147331 8:54890959-54890981 CTGTTCAGCACAGAATCCCAGGG + Intergenic
1042700089 8:71602689-71602711 CTGCCCTTCCCTAAATTCCAGGG - Intergenic
1043772674 8:84224530-84224552 TTTTCCTGCACAAAATTCCAAGG + Intronic
1045582306 8:103495470-103495492 CTCTGCTGGTCAAAATCCCAAGG - Intergenic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048025960 8:130586852-130586874 ATGTCTTGCCCAATATTCCAAGG + Intergenic
1048286488 8:133145801-133145823 CTGTCCTGGCCAAAAGGCCTTGG - Intergenic
1049657202 8:143804156-143804178 TTGTCCCGCCCTAAATCCCCAGG - Exonic
1052325921 9:27216716-27216738 CAGCCCTGCCCTAGATCCCAAGG - Intronic
1054353941 9:64043994-64044016 ATGTTCTTCCCAAAATCACAGGG - Intergenic
1054881311 9:70147777-70147799 CTGTCCTCTTCAAAATGCCAAGG - Intronic
1056277633 9:85008651-85008673 ATGTCTTGCCCAAAATCACATGG + Intronic
1056834296 9:89942230-89942252 CTGCCCTGCCCAGAACCCCTAGG - Intergenic
1057845602 9:98520234-98520256 CTCTCCTTCCCCCAATCCCATGG - Intronic
1059276963 9:113105835-113105857 CTGTACTCCCCAAAATTCAATGG - Intergenic
1059279288 9:113118716-113118738 CTGTACTCCCCAAAATTCAATGG + Intergenic
1061466290 9:130782794-130782816 CTGTCCTTCCCAACATCCTCAGG - Intronic
1062559845 9:137136639-137136661 CTGATCTGCCCAAAATCCTAGGG + Intergenic
1062694779 9:137867833-137867855 CTGTCCTGCCCACCACCCAAAGG - Intronic
1203742277 Un_GL000218v1:13104-13126 ATGTTCTTCCCAAAATCACAGGG - Intergenic
1203610617 Un_KI270748v1:92159-92181 CAGTTCTGCCCAAATTCCAAAGG - Intergenic
1186589776 X:10917650-10917672 CTGGTCTGCCCAACATGCCAGGG + Intergenic
1187388669 X:18871640-18871662 CTGTCCTCCCCACAGGCCCAGGG - Intergenic
1189436568 X:40998150-40998172 CTGGGCTGCCCCAAATCCAATGG + Intergenic
1189461643 X:41248209-41248231 ATGTCCTGCCCCCACTCCCATGG + Intergenic
1190985075 X:55492477-55492499 CTCTCCTGCCCACAGACCCATGG + Intergenic
1191843267 X:65528146-65528168 CTCTGCTGTACAAAATCCCAGGG - Intronic
1194626925 X:96236085-96236107 CTGTCCTGACAAAAAGCACATGG + Intergenic
1196391557 X:115212231-115212253 CCGTACTCCCCAAAATCTCATGG + Intronic
1197853860 X:130893841-130893863 TTTTCCTCCCCCAAATCCCAAGG + Intronic
1199863234 X:151820717-151820739 CAGTCTTGCCCCAAAACCCATGG + Intergenic
1201155811 Y:11130579-11130601 ATGTTCTTCCCAAAATCACAGGG - Intergenic